Restriction Map of ATG10/YLL042C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ATG10/YLL042C on chromosome XII from coordinates 52590 to 52087.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12365

EMBOSS_001 BssKI EcoRII MlyI TfiI | ScrFI PleI HinfI | BseBI CviJI CviRI* TsoI HinfI \ \ \ \ \ \ \ ATGATTCCTTACCAGGAGTGGCATAGCCAACTGCAATCGTTGTATGACTCCCAGATTTTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAAGGAATGGTCCTCACCGTATCGGTTGACGTTAGCAACATACTGAGGGTCTAAAAG / / / / / / // / HinfI | EcoRII CviJI | | |PleI HinfI TfiI | BssKI | | MlyI BseBI | TsoI ScrFI CviRI* M I P Y Q E W H S Q L Q S L Y D S Q I F * F L T R S G I A N C N R C M T P R F S D S L P G V A * P T A I V V * L P D F P ----:----|----:----|----:----|----:----|----:----|----:----| X I G * W S H C L W S C D N Y S E W I K X S E K G P T A Y G V A I T T H S G S K H N R V L L P M A L Q L R Q I V G L N E BsiYI* | AsuI* | Bsp120I | |AsuI* | |DraII | |BmgT120I | ||BsrI | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | ||| ApaI | ||| SduI | ||| BseSI BseGI | ||| HgiJII* | TspDTI | ||| | BfiI MslI BccI | | FokI \ \\\ \ \ \ \ \ \ \ CATAACTGGGCCCTTTGCCAAGATGTCCATTTGAATGATGAAAAGGATGGACTTCTTTTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTGACCCGGGAAACGGTTCTACAGGTAAACTTACTACTTTTCCTACCTGAAGAAAAC / / /// / / / / / | | ||| BfiI MslI BccI | TspDTI | | ||Bsp120I BseGI | | ||DraII | | ||AsuI* | | |BmgT120I | | |AsuI* | | BmgT120I | | HaeIII | | NlaIV | | CviJI | HgiJII* | BseSI | BsrI | SduI | ApaI BsiYI* H N W A L C Q D V H L N D E K D G L L L I T G P F A K M S I * M M K R M D F F C * L G P L P R C P F E * * K G W T S F A ----:----|----:----|----:----|----:----|----:----|----:----| W L Q A R Q W S T W K F S S F S P S R K G Y S P G K G L H G N S H H F P H V E K M V P G K A L I D M Q I I F L I S K K Q SfeI* | CviRI* | | PstI SetI | | BseMII MseI | TaqI | | |BspCNI DdeI TspEI \ \ \ \ \ \\ \ \ CGTTTAATACCTACTCGACAACTGCAGAAAAATACTGAGCGTATAGAAAATAAATTACTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAATTATGGATGAGCTGTTGACGTCTTTTTATGACTCGCATATCTTTTATTTAATGAT / / / / / /// / / | | SetI TaqI | ||SfeI* DdeI TspEI | MseI | |BspCNI FokI | CviRI* | BseMII PstI R L I P T R Q L Q K N T E R I E N K L L V * Y L L D N C R K I L S V * K I N Y * F N T Y S T T A E K Y * A Y R K * I T K ----:----|----:----|----:----|----:----|----:----|----:----| R K I G V R C S C F F V S R I S F L N S A N L V * E V V A S F Y Q A Y L F Y I V T * Y R S S L Q L F I S L T Y F I F * * CviJI | SduI TspEI | HgiJII* \ \ \ AATCATATAGAATTATATCTTACATATTCAAAAGTATATAACGAGCCCTTACTACTTTTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTATATCTTAATATAGAATGTATAAGTTTTCATATATTGCTCGGGAATGATGAAAAC / / / TspEI | CviJI HgiJII* SduI N H I E L Y L T Y S K V Y N E P L L L L I I * N Y I L H I Q K Y I T S P Y Y F C S Y R I I S Y I F K S I * R A L T T F A ----:----|----:----|----:----|----:----|----:----|----:----| F * I S N Y R V Y E F T Y L S G K S S K L D Y L I I D * M N L L I Y R A R V V K I M Y F * I K C I * F Y I V L G * * K Q SfaNI Hin4I MnlI BccI BseRI | TspEI Hin4I BbvI \ \ \ \ \ \ \ CGAATATGGGAGGAGAAAAGCATAGATGGTATTCCAATGACCAAATTGATGCTCCCAACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTATACCCTCCTCTTTTCGTATCTACCATAAGGTTACTGGTTTAACTACGAGGGTTGA / / / / / MnlI | BseRI | TspEI BccI | Hin4I | Hin4I SfaNI R I W E E K S I D G I P M T K L M L P T E Y G R R K A * M V F Q * P N * C S Q L N M G G E K H R W Y S N D Q I D A P N * ----:----|----:----|----:----|----:----|----:----|----:----| R I H S S F L M S P I G I V L N I S G V A F I P P S F C L H Y E L S W I S A G L S Y P L L F A Y I T N W H G F Q H E W S EcoRV | TaqI | | TfiI | | HinfI | | | TseI MaeI | | | |BisI Hin4I ApoI | BciVI MseI | | | ||BlsI Hin4I TspEI | | SetI |MmeI \ \ \ \\\ \ \ \ \ \ \\ GATATCGAATCGCTGCTTGATGTTCAAGGCAAATTCCAACTAGGTTTGGATACTATCATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGCTTAGCGACGAACTACAAGTTCCGTTTAAGGTTGATCCAAACCTATGATAGTAA / / / /// / / // / / | | | ||| Hin4I TspEI |MaeI | Hin4II* | | | ||| Hin4I ApoI BciVI MmeI | | | ||TseI SetI | | | |BisI | | | BlsI | | HinfI | | TfiI | TaqI EcoRV BbvI D I E S L L D V Q G K F Q L G L D T I I I S N R C L M F K A N S N * V W I L S L Y R I A A * C S R Q I P T R F G Y Y H * ----:----|----:----|----:----|----:----|----:----|----:----| S I S D S S S T * P L N W S P K S V I M Q Y R I A A Q H E L C I G V L N P Y * * I D F R Q K I N L A F E L * T Q I S D N Hin4II* MaeIII |BssKI BseGI Tsp45I |EcoRII | FatI BstEII || ScrFI | |CviAII FatI |BseMII || BseBI | || BccI |CviAII ||SetI || |SetI SetI FokI | || NlaIII || NlaIII ||BspCNI \\ \\ \ \ \ \\ \ \\ \ \\\ AACCTGGAAGGTAGCGTTTGGTATTCTTTCCATCCATGCGATACATCATGTATAGTAGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGACCTTCCATCGCAAACCATAAGAAAGGTAGGTACGCTATGTAGTACATATCATCCA / / // / / / /// / // /// | | |SetI FokI BseGI | ||BccI | |FatI ||BspCNI | | EcoRII | |FatI | CviAII |BseMII | | BssKI | CviAII NlaIII Hin4I | BseBI NlaIII SetI | ScrFI MseI SetI N L E G S V W Y S F H P C D T S C I V G T W K V A F G I L S I H A I H H V * * V P G R * R L V F F P S M R Y I M Y S R * ----:----|----:----|----:----|----:----|----:----|----:----| L R S P L T Q Y E K W G H S V D H I T P * G P L Y R K T N K G D M R Y M M Y L L V Q F T A N P I R E M W A I C * T Y Y T Hin4I |BssKI |EcoRII ||TspDTI |||ScrFI |||BseBI |||| CviJI |||| |DdeI |||| || HphI |||| || | FatI |||| || | |CviAII |||| || | || NlaIII |||| || | || | HindII |||| || | || | Hpy166II |||| || | || | | Hin4I |||| || | || | | Hin4I |||| || | || | | | SmlI |||| || | || | | | AflII |||| || | || | | | |MseI |||| || | || | | | ||BccI |||| || | || | | | ||| Hin4I TsoI |||| || | || | | | ||| | Eam1105I | Hin4I |||| || | || | | | ||| | | TspDTI | Hin4I \\\\ \\ \ \\ \ \ \ \\\ \ \ \ \ \ GACCAGGCTGAGTTCATGTCAACTTACTTAAGACGATGGGTCAGTATTTTCATATTTAGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTCCGACTCAAGTACAGTTGAATGAATTCTGCTACCCAGTCATAAAAGTATAAATCA / / / / / / / // / / // // // | | | | | | | || | | || |TspDTI |Hin4I | | | | | | | || | | || Eam1105I |Hin4I | | | | | | | || | | |AflII TsoI | | | | | | | || | | |SmlI | | | | | | | || | | MseI | | | | | | | || | | BccI | | | | | | | || | Hin4I | | | | | | | || Hpy166II | | | | | | | || HindII | | | | | | | |Hin4I | | | | | | | |Hin4I | | | | | | | |FatI | | | | | | | CviAII | | | | | | NlaIII | | | | | DdeI | | | | HphI | | | EcoRII | | | BssKI | | | CviJI | | BseBI | | ScrFI | BstEII | Tsp45I | MaeIII TspDTI D Q A E F M S T Y L R R W V S I F I F S T R L S S C Q L T * D D G S V F S Y L V P G * V H V N L L K T M G Q Y F H I * L ----:----|----:----|----:----|----:----|----:----|----:----| S W A S N M D V * K L R H T L I K M N L H G P Q T * T L K S L V I P * Y K * I * V L S L E H * S V * S S P D T N E Y K T TspDTI TfiI |SetI HinfI \\ \ TGGTTAGGTTATGAAGATTCATAG 490 500 ----:----|----:----|---- ACCAATCCAATACTTCTAAGTATC // / |TspDTI HinfI SetI TfiI W L G Y E D S * G * V M K I H X V R L * R F I X ----:----|----:----|---- Q N P * S S E Y N T L N H L N M P * T I F I * L # Enzymes that cut Frequency Isoschizomers AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I ApaI 1 ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BccI 4 BciVI 1 BfuI BfiI 1 BmrI,BmuI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI Bsp120I 1 PspOMI BspCNI 2 BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI CviAII 3 CviJI 4 CviKI-1 CviRI* 2 HpyCH4V DdeI 2 BstDEI,HpyF3I DraII 1 EcoO109I Eam1105I 1 AspEI,BmeRI,DriI,AhdI EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 3 FokI 2 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 5 Hin4II* 1 HpyAV HindII 1 HincII HinfI 4 HphI 1 AsuHPI Hpy166II 1 Hpy8I MaeI 1 FspBI,BfaI,XspI MaeIII 1 MlyI 1 SchI MmeI 1 MnlI 1 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PleI 1 PpsI PstI 1 ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SetI 6 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI TaqI 2 TfiI 3 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 1 NmuCI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BclI BdaI BetI* BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstKTI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DpnI DraIII DrdI DsaI* EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HhaI Hin6I HindIII HinP1I HpaI HpaII Hpy178III*Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeII MauBI MboI MboII McrI* MfeI MluI Mph1103I MroNI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaiI TaqII TatI TauI Tsp4CI* TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769