Restriction Map of PRP19/YLL036C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PRP19/YLL036C on chromosome XII from coordinates 68256 to 66745.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.19592

EMBOSS_001 SetI | PfoI CviJI | BssKI HaeIII | EcoRII Hin4II* |BsrI | | ScrFI | MaeI ||HphI | | BseBI \ \ \\\ \ \ \ ATGCTTTGTGCTATTAGTGGGAAAGTTCCTAGAAGGCCAGTTCTATCACCTAAATCCAGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAACACGATAATCACCCTTTCAAGGATCTTCCGGTCAAGATAGTGGATTTAGGTCC / / /// / / / | | ||HphI SetI | EcoRII | | |HaeIII | BssKI | | |CviJI | PfoI | | BsrI BseBI | MaeI ScrFI Hin4II* M L C A I S G K V P R R P V L S P K S R C F V L L V G K F L E G Q F Y H L N P G A L C Y * W E S S * K A S S I T * I Q D ----:----|----:----|----:----|----:----|----:----|----:----| X S Q A I L P F T G L L G T R D G L D L X A K H * * H S L E * F A L E I V * I W H K T S N T P F N R S P W N * * R F G P BinI* | MboI | | DpnI Tsp4CI* | | |BstKTI | MseI | | || Hpy188I \ \ \ \ \\ \ ACTATTTTTGAAAAGTCGCTCCTTGAACAGTATGTTAAAGATACGGGGAATGATCCGATA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAAAAACTTTTCAGCGAGGAACTTGTCATACAATTTCTATGCCCCTTACTAGGCTAT / / / // / Tsp4CI* MseI | || Hpy188I | || MboI | |DpnI | BstKTI BinI* T I F E K S L L E Q Y V K D T G N D P I L F L K S R S L N S M L K I R G M I R * Y F * K V A P * T V C * R Y G E * S D N ----:----|----:----|----:----|----:----|----:----|----:----| V I K S F D S R S C Y T L S V P F S G I S * K Q F T A G Q V T H * L Y P S H D S S N K F L R E K F L I N F I R P I I R Y Csp6I |RsaI || MaeI || |SetI CviJI || || Hin6I | SduI || || |GlaI | HgiJII* || || |MstI* | |SmlI || || ||HhaI | |AflII || || ||| MwoI | ||MseI TaqI SfaNI MboII || || ||| | CviJI \ \\\ \ \ \ \\ \\ \\\ \ \ ACAAATGAGCCCTTAAGCATCGAAGAAATAGTGGAAATCGTACCTAGTGCGCAACAAGCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTACTCGGGAATTCGTAGCTTCTTTATCACCTTTAGCATGGATCACGCGTTGTTCGG / / // / / / // / //// / | CviJI |AflII TaqI | MboII || | |||MwoI CviJI HgiJII* |SmlI SfaNI || | ||Hin6I SduI MseI || | |MstI* || | |GlaI || | HhaI || MaeI |Csp6I RsaI SetI T N E P L S I E E I V E I V P S A Q Q A Q M S P * A S K K * W K S Y L V R N K P K * A L K H R R N S G N R T * C A T S L ----:----|----:----|----:----|----:----|----:----|----:----| V F S G K L M S S I T S I T G L A C C A L L H A R L C R L F L P F R V * H A V L C I L G * A D F F Y H F D Y R T R L L G MnlI TaqI |HinfI | TfiI || AccI MaeII | HinfI || |Hpy166II | MseI Hin4I | | Hpy188I || || PleI | SetI Hin4I | | |TfiI || || |MlyI | TaiI TspEI | | |HinfI \\ \\ \\ \ \ \ \ \ \\ TCACTAACAGAGTCTACAAACTCTGCTACGTTAAAAGCGAATTATTCGATTCCGAATCTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGATTGTCTCAGATGTTTGAGACGATGCAATTTTCGCTTAATAAGCTAAGGCTTAGAC / /// / / / // / / // / MnlI ||| PleI | | |Hin4I | | || HinfI ||| MlyI | | |Hin4I | | || TfiI ||AccI | | MseI | | |Hpy188I |Hpy166II | MaeII | | HinfI HinfI TaiI | | TfiI SetI | TaqI TspEI S L T E S T N S A T L K A N Y S I P N L H * Q S L Q T L L R * K R I I R F R I C T N R V Y K L C Y V K S E L F D S E S V ----:----|----:----|----:----|----:----|----:----|----:----| E S V S D V F E A V N F A F * E I G F R R V L L T * L S Q * T L L S N N S E S D * * C L R C V R S R * F R I I R N R I Q HindII Hpy166II MseI | Hpy166II BseGI | MaeIII | |Hin4I | TspDTI | | MboI | |Hin4I | | FokI | | | DpnI | || SfaNI | | |TaqI | | | |BstKTI \ \\ \ \ \ \\ \ \ \ \\ TTGACAAGTTTACAGAATGAATGGGATGCTATAATGCTCGAAAACTTTAAGTTACGATCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTTCAAATGTCTTACTTACCCTACGATATTACGAGCTTTTGAAATTCAATGCTAGT / / / / / / // / /// / | | Hpy166II SfaNI | TspDTI |FokI MseI ||| MboI | Hin4I BseGI TaqI ||DpnI | Hin4I |BstKTI Hpy166II MaeIII HindII L T S L Q N E W D A I M L E N F K L R S * Q V Y R M N G M L * C S K T L S Y D Q D K F T E * M G C Y N A R K L * V T I N ----:----|----:----|----:----|----:----|----:----|----:----| N V L K C F S H S A I I S S F K L N R D T S L N V S H I P H * L A R F S * T V I Q C T * L I F P I S Y H E F V K L * S * Tsp4CI* |SalI ||TaqI ||AccI |||HindII |||Hpy166II |||| BcgI |||| | Tsp4CI* TseI XbaI |||| | | BbvI |BisI |MaeI |||| | | SfaNI ||BbvI |Hpy178III* |||| | | Csp6I ||BlsI || MseI |||| | | |RsaI |||CviRI* \\ \ \\\\ \ \ \\ \\\\ ACTCTAGATAGTTTAACGAAAAAACTGTCGACTGTAATGTACGAAAGAGATGCTGCAAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGATCTATCAAATTGCTTTTTTGACAGCTGACATTACATGCTTTCTCTACGACGTTTC // / / //// // / /// / |XbaI MseI | |||Tsp4CI* || SfaNI ||| BbvI Hpy178III* | ||SalI || BbvI ||CviRI* MaeI | |AccI |Csp6I ||TseI | |TaqI RsaI |BisI | Hpy166II BlsI | HindII | BcgI Tsp4CI* T L D S L T K K L S T V M Y E R D A A K L * I V * R K N C R L * C T K E M L Q S S R * F N E K T V D C N V R K R C C K V ----:----|----:----|----:----|----:----|----:----|----:----| V R S L K V F F S D V T I Y S L S A A F L E L Y N L S F V T S Q L T R F L H Q L S * I T * R F F Q R S Y H V F S I S C L BcgI | TseI | |BisI | ||BlsI | |||Hin6I Hin4II* | ||||GlaI |TfiI | ||||MstI* |HinfI | |||||HhaI || TaqI | |||||| BccI || AsuII MboII \ \\\\\\ \ \\ \ \ TTGGTCGCTGCGCAACTATTGATGGAAAAAAACGAAGATTCGAAGGATTTACCCAAATCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAGCGACGCGTTGATAACTACCTTTTTTTGCTTCTAAGCTTCCTAAATGGGTTTAGG / ///// / / / / / BcgI ||||| BccI | | | MboII ||||Hin6I | | AsuII |||MstI* | | TaqI |||GlaI | HinfI ||TseI | TfiI ||HhaI Hin4II* |BisI BlsI L V A A Q L L M E K N E D S K D L P K S W S L R N Y * W K K T K I R R I Y P N P G R C A T I D G K K R R F E G F T Q I L ----:----|----:----|----:----|----:----|----:----|----:----| N T A A C S N I S F F S S E F S K G L D T P R Q A V I S P F F R L N S P N V W I Q D S R L * Q H F F V F I R L I * G F G MboII | CviJI | | MboII | | MaeIII | | | BarI AluI | | | | BsmAI Cac8I CviJI | | | | | XbaI |MnlI | SetI ApoI | | | | | |MaeI ||AciI | | BarI TspEI | | | | | |Hpy178III* \\\ \ \ \ \ \ \ \ \ \ \\ TCACAGCAAGCGGTAGCTATTACGAGAGAAGAATTTTTACAAGGGCTGTTACAATCTTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTCGTTCGCCATCGATAATGCTCTCTTCTTAAAAATGTTCCCGACAATGTTAGAAGA / / /// / / /// / / | | ||CviJI | MboII ||BarI MaeIII BsmAI | | ||AluI TspEI |MboII | | |BarI ApoI CviJI | | SetI | AciI Cac8I MnlI S Q Q A V A I T R E E F L Q G L L Q S S H S K R * L L R E K N F Y K G C Y N L L T A S G S Y Y E R R I F T R A V T I F * ----:----|----:----|----:----|----:----|----:----|----:----| E C C A T A I V L S S N K C P S N C D E R V A L P L * * S L L I K V L A T V I K * L L R Y S N R S F F K * L P Q * L R R MslI | CfrI | | CviJI | | HaeIII | | | TaqII Cac8I | | | |MseI | AluI | | | ||AhaIII* | CviJI | | | ||| ApoI MnlI | | SetI | | | ||| TspEI \ \ \ \ \ \ \ \\\ \ AGAGACTTTGTAGCGAGGGGCAAGCTCAAAGCACCCAAATGGCCGATTTTAAAAAATTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTGAAACATCGCTCCCCGTTCGAGTTTCGTGGGTTTACCGGCTAAAATTTTTTAAAC // / / / / / / / // / |XbaI MnlI | CviJI MslI | | | |MseI TspEI Hpy178III* | AluI | | | AhaIII* ApoI MaeI Cac8I | | TaqII SetI | CfrI HaeIII CviJI R D F V A R G K L K A P K W P I L K N L E T L * R G A S S K H P N G R F * K I W R L C S E G Q A Q S T Q M A D F K K F G ----:----|----:----|----:----|----:----|----:----|----:----| L S K T A L P L S L A G L H G I K F F K * L S Q L S P C A * L V W I A S K L F N S V K Y R P A L E F C G F P R N * F I Q AluI AluI CviJI CviJI | MseI | SetI TspEI MaeIII | SetI \ \ \ \ \ \ GAGCTATTACAGGCACAAAATTACTCCCGTAACATCAAAACATTCCCATATAAAGAGCTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGATAATGTCCGTGTTTTAATGAGGGCATTGTAGTTTTGTAAGGGTATATTTCTCGAA / / / / / / | CviJI TspEI MaeIII | CviJI | AluI | AluI SetI SetI E L L Q A Q N Y S R N I K T F P Y K E L S Y Y R H K I T P V T S K H S H I K S L A I T G T K L L P * H Q N I P I * R A * ----:----|----:----|----:----|----:----|----:----|----:----| S S N C A C F * E R L M L V N G Y L S S P A I V P V F N S G Y C * F M G M Y L A L * * L C L I V G T V D F C E W I F L K FatI CviRI* |CviAII || NspI TatI || NlaIII |Csp6I || | MwoI ||RsaI || | |MnlI ||| TaqII || | || BccI BseGI \\\ \ \\ \ \\ \ \ AACAAATCTATGTACTATGATAAATGGGTGTGCATGTGTCGCTGTGAGGATGGTGCTTTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTTAGATACATGATACTATTTACCCACACGTACACAGCGACACTCCTACCACGAAAT / /// / // / / / MseI ||TatI | || MnlI BccI BseGI |Csp6I | |FatI TaqII | CviAII RsaI | MwoI CviRI* NlaIII NspI N K S M Y Y D K W V C M C R C E D G A L T N L C T M I N G C A C V A V R M V L Y Q I Y V L * * M G V H V S L * G W C F T ----:----|----:----|----:----|----:----|----:----|----:----| L L D I Y * S L H T H M H R Q S S P A K * C I * T S H Y I P T C T D S H P H H K V F R H V I I F P H A H T A T L I T S * TfiI HinfI FokI TspEI | TaqI Csp6I FokI | MseI | AsuII |RsaI \ \ \ \ \ \\ CATTTTACCCAATTAAAAGATTCGAAAACGATTACCACAATAACTACACCAAATCCCCGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAATGGGTTAATTTTCTAAGCTTTTGCTAATGGTGTTATTGATGTGGTTTAGGGGCA / // / / /// FokI |MseI | AsuII ||BsiYI* TspEI | TaqI ||RsaI HinfI |BsiYI* TfiI BsiYI* H F T Q L K D S K T I T T I T T P N P R I L P N * K I R K R L P Q * L H Q I P V F Y P I K R F E N D Y H N N Y T K S P Y ----:----|----:----|----:----|----:----|----:----|----:----| C K V W N F S E F V I V V I V V G F G R V N * G I L L N S F S * W L L * V L D G M K G L * F I R F R N G C Y S C W I G T AluI CviJI | SetI BssKI | SfaNI BsiYI* | | MnlI |SecI* | | | Hpy178III* |HpaII | | | | AsuI* |BsiYI* | | | | DraII ||ScrFI | | | | |BmgT120I ||CauII* | | | | ||CviJI ||BsiYI* BseGI | | | | ||HaeIII \\\ \ \ \ \ \ \\\ ACCGGGGGAGAGCATCCAGCTATTATTTCCAGAGGGCCTTGTAATCGTTTGCTACTACTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCCCCTCTCGTAGGTCGATAATAAAGGTCTCCCGGAACATTAGCAAACGATGATGAT / // / / / / // / // | || | BseGI | | |SfaNI | |DraII | || BssKI | | MnlI | |AsuI* | || SecI* | CviJI | BmgT120I | |CauII* | AluI | HaeIII | |HpaII SetI | CviJI | |ScrFI Hpy178III* | FokI Csp6I T G G E H P A I I S R G P C N R L L L L P G E S I Q L L F P E G L V I V C Y Y Y R G R A S S Y Y F Q R A L * S F A T T I ----:----|----:----|----:----|----:----|----:----|----:----| V P P S C G A I I E L P G Q L R K S S S Y R P L A D L * * K W L A K Y D N A V V G P S L M W S N N G S P R T I T Q * * * BssKI EcoRII | ScrFI DdeI | BseBI MlyI | Hpy188I | | MaeIII PleI | | MnlI | | BstEII | TsoI | | | MnlI | | | SetI | | HinfI | | | | EciI \ \ \ \ \ \ \ \ \ \ \ \ TATCCAGGTAACCAAATAACTATATTGGACTCAAAAACAAACAAAGTCCTCAGAGAAATA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTCCATTGGTTTATTGATATAACCTGAGTTTTTGTTTGTTTCAGGAGTCTCTTTAT // / / // / /// // / || | BstEII |TsoI HinfI ||| || BspCNI || | MaeIII |PleI ||| |EciI || EcoRII MlyI ||| MnlI || BssKI ||MnlI |BseBI |DdeI |ScrFI Hpy188I SetI Y P G N Q I T I L D S K T N K V L R E I I Q V T K * L Y W T Q K Q T K S S E K * S R * P N N Y I G L K N K Q S P Q R N R ----:----|----:----|----:----|----:----|----:----|----:----| Y G P L W I V I N S E F V F L T R L S I I D L Y G F L * I P S L F L C L G * L F I W T V L Y S Y Q V * F C V F D E S F Y BspCNI SetI |BseMII |HindII || SetI |Hpy166II || | TfiI MaeIII || TspDTI || | HinfI Tsp45I || | TatI || | | AciI | MnlI || | |Csp6I \\ \ \ \ \ \ \\ \ \\ GAGGTAGATTCCGCCAATGAGATTATATATATGTATGGTCACAACGAGGTCAACACAGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCATCTAAGGCGGTTACTCTAATATATATACATACCAGTGTTGCTCCAGTTGTGTCTC / / / / / / // BseMII | AciI | | SetI |TspDTI SetI HinfI | Tsp45I Hpy166II TfiI | MaeIII HindII MnlI E V D S A N E I I Y M Y G H N E V N T E R * I P P M R L Y I C M V T T R S T Q S G R F R Q * D Y I Y V W S Q R G Q H R V ----:----|----:----|----:----|----:----|----:----|----:----| S T S E A L S I I Y I Y P * L S T L V S L P L N R W H S * I Y T H D C R P * C L L Y I G G I L N Y I H I T V V L D V C L BfiI |TfiI |HinfI RsaI AciI NlaIV BsaBI || BseGI ScaI | MnlI |EciI | MnlI || | BsrI \ \ \ \\ \ \ \\ \ \ TACTTCATCTGGGCGGATAATAGAGGAACCATAGGATTTCAATCCTACGAGGATGATTCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAAGTAGACCCGCCTATTATCTCCTTGGTATCCTAAAGTTAGGATGCTCCTACTAAGG /// / // / / / / // ||TatI AciI |NlaIV | MnlI | | |TspDTI |Csp6I MnlI EciI BsaBI | | HinfI ScaI | | TfiI RsaI | | BsrI | BseGI BfiI Y F I W A D N R G T I G F Q S Y E D D S T S S G R I I E E P * D F N P T R M I P L H L G G * * R N H R I S I L R G * F P ----:----|----:----|----:----|----:----|----:----|----:----| Y K M Q A S L L P V M P N * D * S S S E T S * R P P Y Y L F W L I E I R R P H N V E D P R I I S S G Y S K L G V L I I G TatI |Csp6I ||RsaI ||| TseI ||| |BisI BbvI ||| ||BlsI TspDTI TspDTI ||| |||AciI | EcoNI | FokI Hpy188I ||| |||NspBII* | | BsiYI* \ \ \ \\\ \\\\ \ \ \ CAGTATATTGTTCATTCTGCTAAATCAGATGTTGAGTACAGCAGCGGTGTCCTACATAAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATATAACAAGTAAGACGATTTAGTCTACAACTCATGTCGTCGCCACAGGATGTATTC / / /// /// / / / // FokI Hpy188I ||| ||| AciI | | |BbvI ||| ||| | | EcoNI ||| ||| | BsiYI* ||| ||| TspDTI ||| ||NspBII* ||| ||TseI ||| |BisI ||| BlsI ||TatI |Csp6I RsaI Q Y I V H S A K S D V E Y S S G V L H K S I L F I L L N Q M L S T A A V S Y I R V Y C S F C * I R C * V Q Q R C P T * G ----:----|----:----|----:----|----:----|----:----|----:----| W Y I T * E A L D S T S Y L L P T R C L G T Y Q E N Q * I L H Q T C C R H G V Y L I N N M R S F * I N L V A A T D * M L BetI* MaeII BspMII* | SetI |HpaII | TaiI TfiI EcoP15I |Hpy178III* | |Hpy166II HinfI | CviJI || Tsp4CI* | || HphI \ \ \ \\ \ \ \\ \ GATTCATTATTATTAGCCCTTTACTCTCCGGACGGTATATTAGACGTTTACAACTTGTCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGTAATAATAATCGGGAAATGAGAGGCCTGCCATATAATCTGCAAATGTTGAACAGT / / / // / / / / / HinfI | CviJI || Tsp4CI* | | | HphI TfiI EcoP15I |BspMII* | | Hpy166II |BetI* | MaeII Hpy178III* TaiI HpaII SetI D S L L L A L Y S P D G I L D V Y N L S I H Y Y * P F T L R T V Y * T F T T C H F I I I S P L L S G R Y I R R L Q L V I ----:----|----:----|----:----|----:----|----:----|----:----| S E N N N A R * E G S P I N S T * L K D P N M I I L G K S E P R Y I L R K C S T I * * * * G K V R R V T Y * V N V V Q * SetI | BssKI | EcoRII | | ScrFI | | BseBI | | | Cac8I | | | | AluI | | | | CviJI | | | | | XbaI | | | | | SetI | | | | | |MaeI CviJI | | | | | |Hpy178III* | MnlI | | | | | || TfiI | |MboII MseI | | | | | || HinfI | ||TspDTI SetI \ \ \ \ \ \\ \ \ \\\ \ TCACCTGACCAGGCAAGCTCTAGATTCCCCGTAGATGAAGAAGCCAAGATAAAAGAGGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGACTGGTCCGTTCGAGATCTAAGGGGCATCTACTTCTTCGGTTCTATTTTCTCCAA / / / / / // / / // / SetI | | | | || HinfI | |TspDTI SetI | | | | || TfiI | |MboII | | | | |XbaI | MnlI | | | | Hpy178III* CviJI | | | | MaeI | | | CviJI | | | AluI | | Cac8I | | SetI | EcoRII | BssKI BseBI ScrFI S P D Q A S S R F P V D E E A K I K E V H L T R Q A L D S P * M K K P R * K R L T * P G K L * I P R R * R S Q D K R G * ----:----|----:----|----:----|----:----|----:----|----:----| D G S W A L E L N G T S S S A L I F S T M V Q G P L S * I G R L H L L W S L L P * R V L C A R S E G Y I F F G L Y F L N BccI FokI PflMI ApoI Csp6I BsrI |MaeIII BsiYI* TspEI CviRI* |RsaI | BseGI |Tsp45I Tsp4CI* \ \ \\ \ \ \\ \ AAATTTGCAGACAATGGGTACTGGATGGTAGTAGAGTGTGACCAAACTGTGGTTTGCTTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAACGTCTGTTACCCATGACCTACCATCATCTCACACTGGTTTGACACCAAACGAAA / / / // / / / / / / | | CviRI* || | BseGI | | | Tsp4CI* | TspEI || BsrI | | BsiYI* | ApoI |Csp6I | | PflMI MseI RsaI | Tsp45I BccI | MaeIII FokI K F A D N G Y W M V V E C D Q T V V C F N L Q T M G T G W * * S V T K L W F A L I C R Q W V L D G S R V * P N C G L L * ----:----|----:----|----:----|----:----|----:----|----:----| L N A S L P Y Q I T T S H S W V T T Q K * I Q L C H T S S P L L T H G F Q P K S F K C V I P V P H Y Y L T V L S H N A K BseGI | Cac8I | | NheI ApoI DdeI | | |MaeI TspEI |SetI | | |FokI EcoRI || EcoNI | | ||Cac8I | Hpy178III* || | BsiYI* | | ||| BmtI BciVI | |MmeI \\ \ \ \ \ \\\ \ \ \ \\ GACCTAAGAAAGGATGTCGGCACGCTAGCGTATCCAACTTACACAATCCCAGAATTCAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGATTCTTTCCTACAGCCGTGCGATCGCATAGGTTGAATGTGTTAGGGTCTTAAGTTC / /// / / / //// / / / SetI ||EcoNI BseGI | | |||FokI BciVI | Hpy178III* |DdeI | | ||NheI EcoRI BsiYI* | | |MaeI TspEI | | Cac8I MmeI | BmtI ApoI Cac8I D L R K D V G T L A Y P T Y T I P E F K T * E R M S A R * R I Q L T Q S Q N S R P K K G C R H A S V S N L H N P R I Q D ----:----|----:----|----:----|----:----|----:----|----:----| S R L F S T P V S A Y G V * V I G S N L Q G L F P H R C A L T D L K C L G L I * V * S L I D A R * R I W S V C D W F E L HgiCI* | NlaIV | |SduI | |BseSI | || MaeIII | || Tsp4CI* MlyI HinfI | || | SetI PleI | Hpy178III* CviRI* \ \\ \ \ \ \ \ \ ACGGGCACCGTTACCTATGACATTGACGACTCTGGAAAGAATATGATTGCATACTCAAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCCGTGGCAATGGATACTGTAACTGCTGAGACCTTTCTTATACTAACGTATGAGTTTG / / / / / // / / / | | | | MaeIII |PleI | Hpy178III* CviRI* | | | SetI MlyI HinfI | | Tsp4CI* | | HgiCI* | NlaIV BseSI SduI T G T V T Y D I D D S G K N M I A Y S N R A P L P M T L T T L E R I * L H T Q T G H R Y L * H * R L W K E Y D C I L K R ----:----|----:----|----:----|----:----|----:----|----:----| V P V T V * S M S S E P F F I I A Y E F S P C R * R H C Q R S Q F S Y S Q M S L R A G N G I V N V V R S L I H N C V * V ApoI TspEI TspEI TspEI MnlI \ \ \ \ GAGAGCAATTCGCTGACGATATACAAATTTGACAAGAAAACAAAAAATTGGACTAAAGAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCGTTAAGCGACTGCTATATGTTTAAACTGTTCTTTTGTTTTTTAACCTGATTTCTG / / / / TspEI TspEI | MnlI ApoI TspEI E S N S L T I Y K F D K K T K N W T K D R A I R * R Y T N L T R K Q K I G L K T E Q F A D D I Q I * Q E N K K L D * R R ----:----|----:----|----:----|----:----|----:----|----:----| S L L E S V I Y L N S L F V F F Q V L S R S C N A S S I C I Q C S F L F N S * L L A I R Q R Y V F K V L F C F I P S F V Hin6I |GlaI MslI ||HhaI | TspRI |||HaeII | | MaeII |||| BseRI | | |BtrI |||| | CviRI* | | || SetI |||| | |MnlI BtsI TspRI | | || TaiI \\\\ \ \\ \ \ \ \ \\ \ GAGGAGAGCGCCCTCTGTTTGCAAAGCGACACTGCCGATTTCACTGATATGGACGTGGTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTCGCGGGAGACAAACGTTTCGCTGTGACGGCTAAAGTGACTATACCTGCACCAT //// / / / / / / // |||| BseRI | TspRI TspRI MslI | |MaeII |||Hin6I | BtsI | BtrI ||GlaI CviRI* TaiI |HhaI MnlI SetI HaeII E E S A L C L Q S D T A D F T D M D V V R R A P S V C K A T L P I S L I W T W Y G E R P L F A K R H C R F H * Y G R G M ----:----|----:----|----:----|----:----|----:----|----:----| S S L A R Q K C L S V A S K V S I S T T R P S R G R N A F R C Q R N * Q Y P R P L L A G E T Q L A V S G I E S I H V H Y AciI BisI Eco57I BccI |BlsI BbvII* Eco57MI |AciI ||TauI Hpy188I | MboII | SspI CviRI* \\ \\\ \ \ \ \ \ \ TGCGGAGATGGTGGTATTGCCGCTATTCTGAAGACAAATGATAGTTTCAATATTGTTGCA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCCTCTACCACCATAACGGCGATAAGACTTCTGTTTACTATCAAAGTTATAACAACGT / / //// / / / / / | AciI |||AciI Hpy188I | | SspI CviRI* BccI ||BisI | Eco57MI |BlsI | Eco57I TauI BbvII* MboII C G D G G I A A I L K T N D S F N I V A A E M V V L P L F * R Q M I V S I L L H R R W W Y C R Y S E D K * * F Q Y C C I ----:----|----:----|----:----|----:----|----:----|----:----| H P S P P I A A I R F V F S L K L I T A I R L H H Y Q R * E S S L H Y N * Y Q Q A S I T T N G S N Q L C I I T E I N N C TTGACACCCTAA 1510 ----:----|-- AACTGTGGGATT L T P * * H P X D T L X ----:----|-- N V G * M S V R Q C G L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AluI 6 AluBI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BarI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 BcgI 1 BciVI 1 BfuI BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BmtI 1 BspOI BsaBI 1 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 3 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 1 CviJI 14 CviKI-1 CviRI* 6 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I EciI 2 Eco57I 1 AcuI Eco57MI 1 EcoNI 2 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FatI 1 FokI 6 GlaI 3 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindII 3 HincII HinfI 11 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 5 MaeI 6 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 7 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MlyI 3 SchI MmeI 1 MnlI 13 MseI 9 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 3 PpsI RsaI 7 AfaI SalI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 18 SfaNI 4 LweI SmlI 1 SmoI SspI 1 TaiI 3 TaqI 6 TaqII 2 TatI 3 TauI 1 TfiI 8 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 10 TasI,Tsp509I,Sse9I TspRI 2 TscAI XbaI 3 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BaeI BalI BamHI BbvCI Bce83I* BceAI BclI BdaI BglI BglII BmeT110I BplI Bpu10I BsaAI BsaXI BsePI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI GsuI HgaI HgiAI* HindIII HpaI Hpy99I KasI KpnI Ksp632I* MauBI McrI* MfeI MluI Mph1103I MroNI NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TspGWI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769