Restriction Map of FLO10/YKR102W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

FLO10/YKR102W on chromosome XI from coordinates 646356 to 649865.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.20605

TseI CviJI Cfr10I SfeI* |BisI |HpaII | AluI ||BlsI || CviJI | CviJI ||| TaqI || HaeIII | | SetI \\\ \ \\ \ \ \ \ ATGCCTGTGGCTGCTCGATATATATTTTTGACCGGCCTATTTTTGCTATCTGTAGCTAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGACACCGACGAGCTATATATAAAAACTGGCCGGATAAAAACGATAGACATCGATTA //// / // /// / |||| TaqI |Cfr10I ||| MwoI |||TseI |HaeIII ||CviJI ||BisI |CviJI ||AluI |BlsI HpaII |SfeI* CviJI SetI M P V A A R Y I F L T G L F L L S V A N C L W L L D I Y F * P A Y F C Y L * L M A C G C S I Y I F D R P I F A I C S * C ----:----|----:----|----:----|----:----|----:----|----:----| X G T A A R Y I N K V P R N K S D T A L X A Q P Q E I Y I K S R G I K A I Q L * H R H S S S I Y K Q G A * K Q * R Y S I MaeI Cac8I | Csp6I | AluI | |MnlI | CviJI | |RsaI | PvuII MboII | |SetI | NspBII* | GsuI MwoI | || SfeI* CviJI | | SetI | Eco57MI \ \ \\ \ \ \ \ \ \ \ GTTGCTCTAGGTACTACAGAGGCTTGTTTGCCAGCTGGAGAGAAGAAAAATGGTATGACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGAGATCCATGATGTCTCCGAACAAACGGTCGACCTCTCTTCTTTTTACCATACTGA // /// / / / / // || ||| | CviJI | NspBII* |Eco57MI || ||| SfeI* | PvuII |GsuI || ||Csp6I | CviJI MboII || |RsaI | AluI || MnlI Cac8I |MaeI SetI SetI V A L G T T E A C L P A G E K K N G M T L L * V L Q R L V C Q L E R R K M V * L C S R Y Y R G L F A S W R E E K W Y D Y ----:----|----:----|----:----|----:----|----:----|----:----| T A R P V V S A Q K G A P S F F F P I V H Q E L Y * L P K N A L Q L S S F H Y S N S * T S C L S T Q W S S L L F I T H S SspI | TspDTI TfiI | | MseI HinfI TspGWI TsoI \ \ \ \ \ \ ATAAACTTTTACCAATATTCCTTAAAAGATTCATCTACATACTCAAATCCGTCATATATG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTGAAAATGGTTATAAGGAATTTTCTAAGTAGATGTATGAGTTTAGGCAGTATATAC / / / / / / | | MseI | TspGWI TsoI | TspDTI HinfI SspI TfiI I N F Y Q Y S L K D S S T Y S N P S Y M * T F T N I P * K I H L H T Q I R H I W K L L P I F L K R F I Y I L K S V I Y G ----:----|----:----|----:----|----:----|----:----|----:----| I F K * W Y E K F S E D V Y E F G D Y I * L S K G I N R L L N M * M S L D T M Y Y V K V L I G * F I * R C V * I R * I H MwoI |HindIII || AluI CviJI || CviJI HaeIII || | SetI | SfaNI CviRI* BsrI BfiI || | | FokI \ \ \ \ \ \\ \ \ \ GCCTATGGTTATGCTGATGCAGAAAAACTGGGTTCTGTAAGTGGGCAAACAAAGCTTTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGGATACCAATACGACTACGTCTTTTTGACCCAAGACATTCACCCGTTTGTTTCGAAAGG / / / / / / / / / HaeIII SfaNI CviRI* BsrI BfiI | | | HindIII CviJI | | CviJI | | AluI | SetI MwoI A Y G Y A D A E K L G S V S G Q T K L S P M V M L M Q K N W V L * V G K Q S F P L W L C * C R K T G F C K W A N K A F H ----:----|----:----|----:----|----:----|----:----|----:----| A * P * A S A S F S P E T L P C V F S E P R H N H Q H L F V P N Q L H A F L A K G I T I S I C F F Q T R Y T P L C L K G BccI | BseGI | | FatI | | |CviAII | | || BccI | | || |NlaIII | | || || PflMI | | || || BsiYI* | | || || | Hin6I Hpy188I TaqI | | || || | |GlaI | SfaNI SfaNI ClaI | | || || | ||HhaI | | BcgI | Hpy188I \ \ \ \\ \\ \ \\\ \ \ \ \ \ ATCGATTATTCCATCCCATGTAATGGCGCATCAGATACTTGTGCTTGTTCCGATGATGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTAATAAGGTAGGGTACATTACCGCGTAGTCTATGAACACGAACAAGGCTACTACTA / / // / // /// / / / / / | | |BseGI | |BccI ||| | | SfaNI | SfaNI | | BccI | |FatI ||| | BcgI Hpy188I | ClaI | BsiYI* ||| Hpy188I | TaqI | CviAII ||Hin6I FokI | PflMI |GlaI NlaIII HhaI I D Y S I P C N G A S D T C A C S D D D S I I P S H V M A H Q I L V L V P M M M R L F H P M * W R I R Y L C L F R * * C ----:----|----:----|----:----|----:----|----:----|----:----| M S * E M G H L P A D S V Q A Q E S S S W R N N W G M Y H R M L Y K H K N R H H D I I G D W T I A C * I S T S T G I I I BcgI Hin6I |GlaI |Eco47III ||HhaI |||HaeII |||| BssKI |||| SecI* |||| EcoRII |||| | ScrFI |||| | BseBI |||| | | SetI |||| | | | Csp6I |||| | | | |RsaI |||| | | | || BsrI TspRI MseI Hpy188I \\\\ \ \ \ \\ \ \ \ \ GCTACTGAATATAGCGCTTCCCAGGTTGTACCAGTGAAGCGTGGCGTTAAACTTTGTTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGACTTATATCGCGAAGGGTCCAACATGGTCACTTCGCACCGCAATTTGAAACAAGA ///// //// // / / ||||Hin6I |||| |Csp6I MseI Hpy188I |||| |||| TspRI |||| |||| RsaI |||| |||| BsrI |||| |||EcoRII |||| |||BssKI |||| ||SecI* |||| |BseBI |||| |ScrFI |||| SetI |||Eco47III |||GlaI ||HhaI |HaeII BcgI A T E Y S A S Q V V P V K R G V K L C S L L N I A L P R L Y Q * S V A L N F V L Y * I * R F P G C T S E A W R * T L F * ----:----|----:----|----:----|----:----|----:----|----:----| A V S Y L A E W T T G T F R P T L S Q E H * Q I Y R K G P Q V L S A H R * V K N S S F I A S G L N Y W H L T A N F K T R BbvI | BsaBI | |MboI | || DpnI | || |BstKTI MaeII | || || MwoI BseMII | SetI | || || | Hin6I MboII |BspCNI DdeI | TaiI | || || | |GlaI \ \\ \ \ \ \ \\ \\ \ \\ GATAATACAACTCTTTCTTCTAAAACTGAGAAACGTGAAAATGACGATTGCGATCAAGGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATGTTGAGAAAGAAGATTTTGACTCTTTGCACTTTTACTGCTAACGCTAGTTCCG / // / / / / // / /// MboII |BspCNI | | MaeII | || | ||GlaI BseMII | TaiI | || | |HhaI | SetI | || | HaeII DdeI | || | Hin4I | || MboI | |MwoI | |DpnI | BstKTI | BbvI BsaBI D N T T L S S K T E K R E N D D C D Q G I I Q L F L L K L R N V K M T I A I K A * Y N S F F * N * E T * K * R L R S R R ----:----|----:----|----:----|----:----|----:----|----:----| S L V V R E E L V S F R S F S S Q S * P Q Y Y L E K K * F Q S V H F H R N R D L I I C S K R R F S L F T F I V I A I L A MaeII |MaeIII || SetI TseI MboI Hpy188I || TaiI HhaI BglII |TfiI || |XcmI |BisI XhoII |HinfI || || SecI* |HaeII Hpy188I ||GsuI || || DsaI* ||BlsI | DpnI ||Eco57MI || || |TaqII ||Hin4I BsrI | |BstKTI ||| Hin4I || || |Tsp4CI* \\\ \ \ \\ \\\ \ \\ \\ \\ GCTGCCTACTGGAGTTCAGATCTGTTCGGATTCTACACAACACCCACCAACGTAACCGTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGGATGACCTCAAGTCTAGACAAGCCTAAGATGTGTTGTGGGTGGTTGCATTGGCAC //// / / // / // / / / // // / |||TseI BsrI | || | || | HinfI | || || DsaI* ||BisI | || | || | TfiI | || || SecI* |BlsI | || | || Hin4I | || |Tsp4CI* Hin6I | || | |Eco57MI | || |MaeIII | || | |GsuI | || TaqII | || | Hpy188I | |XcmI | || XhoII | MaeII | || BglII TaiI | || MboI SetI | |DpnI | BstKTI Hpy188I A A Y W S S D L F G F Y T T P T N V T V L P T G V Q I C S D S T Q H P P T * P W C L L E F R S V R I L H N T H Q R N R G ----:----|----:----|----:----|----:----|----:----|----:----| A A * Q L E S R N P N * V V G V L T V T R Q R S S N L D T R I R C L V W W R L R S G V P T * I Q E S E V C C G G V Y G H PflMI BsiYI* | Acc65I | HgiCI* | |Csp6I | ||RsaI | ||BsrI | ||NlaIV MaeIII | ||| KpnI | SetI | ||| | SetI CviJI Tsp4CI* \ \ \ \\\ \ \ \ \ GAAATGACAGGTTACTTTTTACCACCAAAAACTGGTACCTACACATTTGGCTTCGCTACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACTGTCCAATGAAAAATGGTGGTTTTTGACCATGGATGTGTAAACCGAAGCGATGA / / / / /// / // SetI MaeIII | | ||HgiCI* CviJI |BcgI | | ||Acc65I Tsp4CI* | | |Csp6I | | NlaIV | | RsaI | | SetI | BsrI | KpnI BsiYI* PflMI E M T G Y F L P P K T G T Y T F G F A T K * Q V T F Y H Q K L V P T H L A S L L N D R L L F T T K N W Y L H I W L R Y C ----:----|----:----|----:----|----:----|----:----|----:----| S I V P * K K G G F V P V * V N P K A V P F S L N S K V V L F Q Y R C M Q S R * F H C T V K * W W F S T G V C K A E S S BcgI | MmeI | |TfiI | |HinfI | || BseGI | || | TspEI | || | | FokI | || | | | BsaXI SetI BsaXI | || | | | | MnlI | BcgI | Hpy166II \ \\ \ \ \ \ \ \ \ \ \ GTGGATGATTCAGCAATTTTATCGGTTGGAGGTAATGTTGCCTTTGAATGTTGTAAACAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTACTAAGTCGTTAAAATAGCCAACCTCCATTACAACGGAAACTTACAACATTTGTC / / / // // / / / / | | HinfI || |MnlI SetI BcgI BsaXI Hpy166II | | TfiI || FokI | BseGI |TspEI MmeI BsaXI V D D S A I L S V G G N V A F E C C K Q W M I Q Q F Y R L E V M L P L N V V N R G * F S N F I G W R * C C L * M L * T G ----:----|----:----|----:----|----:----|----:----|----:----| T S S E A I K D T P P L T A K S H Q L C Q P H N L L K I P Q L Y H Q R Q I N Y V H I I * C N * R N S T I N G K F T T F L FatI NcoI StyI SecI* MseI DsaI* | TspGWI |CviAII | | Tsp4CI* ||SfaNI CviJI MnlI | | | MseI ||| NlaIII \ \ \ \ \ \ \\\ \ GAACAGCCTCCTATCACATCAACGGATTTCACTATTAACGGTATTAAACCATGGAACGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCGGAGGATAGTGTAGTTGCCTAAAGTGATAATTGCCATAATTTGGTACCTTGCGT / / / / / / / // / CviJI MnlI | | | | | || SfaNI | | | | | |DsaI* | | | | | |SecI* | | | | | |StyI | | | | | |NcoI | | | | | |FatI | | | | | CviAII | | | | NlaIII | | | MseI | | Tsp4CI* | MseI TspGWI E Q P P I T S T D F T I N G I K P W N A N S L L S H Q R I S L L T V L N H G T Q T A S Y H I N G F H Y * R Y * T M E R R ----:----|----:----|----:----|----:----|----:----|----:----| S C G G I V D V S K V I L P I L G H F A P V A E * * M L P N * * * R Y * V M S R F L R R D C * R I E S N V T N F W P V C HindII Hpy166II | MaeII | | Csp6I | | |RsaI | | |SetI | | |TaiI | | ||FatI | | ||AflIII | | ||BspLU11I* | | |||CviAII | | |||| NspI | | |||| Csp6I | | |||| NlaIII | | |||| |RsaI | | |||| || Cfr10I MboI CviRI* | | |||| || |HpaII | DpnI | SetI | | |||| || || MaeIII | |BstKTI \ \ \ \ \\\\ \\ \\ \ \ \\ GATGCACCTACCGACATAAAGGGGTCAACGTACATGTACGCCGGTTACTATTACCCGATC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGTGGATGGCTGTATTTCCCCAGTTGCATGTACATGCGGCCAATGATAATGGGCTAG // // /// //// // / // / |SetI || ||| |||| || MaeIII || MboI CviRI* || ||| |||| |Cfr10I |DpnI || ||| |||| HpaII BstKTI || ||| |||Csp6I || ||| ||RsaI || ||| |BspLU11I* || ||| |AflIII || ||| |FatI || ||| CviAII || ||NlaIII || ||Csp6I || ||NspI || |RsaI || MaeII |TaiI |SetI Hpy166II HindII D A P T D I K G S T Y M Y A G Y Y Y P I M H L P T * R G Q R T C T P V T I T R S C T Y R H K G V N V H V R R L L L P D Q ----:----|----:----|----:----|----:----|----:----|----:----| S A G V S M F P D V Y M Y A P * * * G I L H V * R C L P T L T C T R R N S N G S I C R G V Y L P * R V H V G T V I V R D BssKI EcoRII |SecI* ||ScrFI ||BseBI BccI ||| Csp6I |BaeI ||| |RsaI || BseMII TspEI ||| |BciVI || |BspCNI \ \\\ \\ \\ \\ AAAATTGTTTATTCAAATGCTGTATCCTGGGGTACGCTTCCTGTTAGTGTGGTATTGCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAACAAATAAGTTTACGACATAGGACCCCATGCGAAGGACAATCACACCATAACGGT / / / /// / /// TspEI | | ||Csp6I BaeI ||BspCNI | | |RsaI |BseMII | | BciVI BccI | EcoRII | BssKI | SecI* BseBI ScrFI K I V Y S N A V S W G T L P V S V V L P K L F I Q M L Y P G V R F L L V W Y C Q N C L F K C C I L G Y A S C * C G I A R ----:----|----:----|----:----|----:----|----:----|----:----| L I T * E F A T D Q P V S G T L T T N G * F Q K N L H Q I R P Y A E Q * H P I A F N N I * I S Y G P T R K R N T H Y Q W MnlI | Csp6I | |RsaI MseI Hin4II* | || DdeI SetI | BaeI Bce83I* \ \\ \ \ \ \ \ GATGGTACTGAGGTTAATGATGATTTTGAAGGATATGTTTTTTCTTTTGACGATAATGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCATGACTCCAATTACTACTAAAACTTCCTATACAAAAAAGAAAACTGCTATTACGA / // // / / / / | || |DdeI MseI | BaeI Bce83I* | || SetI Hin4II* | |Csp6I | RsaI MnlI D G T E V N D D F E G Y V F S F D D N A M V L R L M M I L K D M F F L L T I M L W Y * G * * * F * R I C F F F * R * C Y ----:----|----:----|----:----|----:----|----:----|----:----| S P V S T L S S K S P Y T K E K S S L A L H Y Q P * H H N Q L I H K K K Q R Y H I T S L N I I I K F S I N K R K V I I S DdeI EspI* EcoP15I | BaeI |SmlI | |FatI || MwoI | ||MwoI || | TspGWI | ||CviAII || | |AluI | |||Cac8I || | |CviJI | |||| SphI || | || SetI | |||| NspI || | || | Tsp4CI* BseMII | |||| CviRI* || | || | | TspRI |BspCNI | |||| NlaIII MboII \\ \ \\ \ \ \ \\ \ \\\\ \ \ ACTCAAGCTCACTGTTCCGTTCCAAACCCTGCTGAGCATGCAAGAACTTGTGTATCATCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTCGAGTGACAAGGCAAGGTTTGGGACGACTCGTACGTTCTTGAACACATAGTAGA / ///// / // / /// /// / | ||||| Tsp4CI* |BspCNI | ||| ||CviRI* MboII | ||||CviJI BseMII | ||| ||FatI | ||||TspRI | ||| |CviAII | ||||AluI | ||| Cac8I | |||SmlI | ||NlaIII | ||SetI | ||NspI | |TspGWI | ||SphI | EcoP15I | |EspI* MwoI | |DdeI | MwoI BaeI T Q A H C S V P N P A E H A R T C V S S L K L T V P F Q T L L S M Q E L V Y H L S S S L F R S K P C * A C K N L C I I C ----:----|----:----|----:----|----:----|----:----|----:----| V * A * Q E T G F G A S C A L V Q T D D * E L E S N R E L G Q Q A H L F K H I M S L S V T G N W V R S L M C S S T Y * R TspRI | TatI | Bsp1407I | |Csp6I | ||RsaI | ||| Hin4I Tth111I BaeI | ||| | BsmAI |HinfI | BssKI | ||| | Eco31I || AccI | EcoRII | ||| | |Csp6I || |Hpy166II | | ScrFI | ||| | |Hpy166II || || BsrI CviRI* | | BseBI BsrI | ||| | ||RsaI || || |PleI \ \ \ \ \ \ \\\ \ \\\ \\ \\ \\ GCAACATCTTCCTGGTCGTCCAGTGAAGTCTGTACAGAGTGTACCGAGACCGAGTCTACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTGTAGAAGGACCAGCAGGTCACTTCAGACATGTCTCACATGGCTCTGGCTCAGATGG / / / / / //// //// / /// | BaeI | | TspRI |||| |||Eco31I | ||AccI CviRI* | | BsrI |||| |||BsmAI | ||BsrI | EcoRII |||| ||Csp6I | |Hpy166II | BssKI |||| |RsaI | HinfI BseBI |||| Hpy166II Tth111I ScrFI |||Bsp1407I |||TatI ||Csp6I |RsaI Hin4I A T S S W S S S E V C T E C T E T E S T Q H L P G R P V K S V Q S V P R P S L P N I F L V V Q * S L Y R V Y R D R V Y Q ----:----|----:----|----:----|----:----|----:----|----:----| A V D E Q D D L S T Q V S H V S V S D V Q L M K R T T W H L R Y L T Y R S R T * C C R G P R G T F D T C L T G L G L R G NdeI | MaeIII | Tsp45I | | MboII | | | MaeI | | | | AluI | | | | CviJI | | | | | SetI | | | | | | BssKI TspRI | | | | | | EcoRII | TatI MlyI | | | | | | | SapI | Bsp1407I | TaqII | | | | | | | ScrFI | |Csp6I | | MaeIII | | | | | | | BseBI | ||RsaI | | Tsp45I | | | | | | | Ksp632I* | ||| Hin4I | | | Hin4I | | | | | | | | BsrI | ||| | ApaLI \ \ \ \ \ \ \ \ \ \ \ \ \ \ \\\ \ \ AGTTATGTGACACCATATGTCACTAGCTCTTCCTGGTCGTCCAGTGAAGTCTGTACAGAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCAATACACTGTGGTATACAGTGATCGAGAAGGACCAGCAGGTCACTTCAGACATGTCTC // / / / / //// / / / //// / || Hin4I | | | |||CviJI | | TspRI |||| HgiAI* |TaqII | | | |||AluI | | BsrI |||| BseSI PleI | | | ||MaeI | Ksp632I* |||| SduI MlyI | | | |SetI | EcoRII |||Bsp1407I | | | Tsp45I | BssKI |||TatI | | | MaeIII | SapI ||Csp6I | | MboII BseBI |RsaI | NdeI ScrFI Hin4I Tsp45I MaeIII S Y V T P Y V T S S S W S S S E V C T E V M * H H M S L A L P G R P V K S V Q S L C D T I C H * L F L V V Q * S L Y R V ----:----|----:----|----:----|----:----|----:----|----:----| L * T V G Y T V L E E Q D D L S T Q V S W N H S V M H * * S K R T T W H L R Y L T I H C W I D S A R G P R G T F D T C L Tth111I |HinfI || TstI || BsaXI || |AccI || ||Hpy166II || ||| MaeI || ||| |PleI || ||| ||MlyI || ||| ||| TaqII || ||| ||| | SetI || ||| ||| | | Hin4I || ||| ||| | | | HphI || ||| ||| | | | | NdeI || ||| ||| | | | | MnlI || ||| ||| | | | | | MaeIII BsmAI || ||| ||| | | | | | Tsp45I Eco31I || ||| ||| | | | | | | MboII |CviRI* || ||| ||| | | | | | | | BsaXI |Hpy166II || ||| ||| | | | | | | | | AluI || SduI || ||| ||| | | | | | | | | TstI SapI || BseSI || ||| ||| | | | | | | | | CviJI Ksp632I* || HgiAI* || ||| ||| | | | | | | | | | SetI | Hpy99I \\ \ \\ \\\ \\\ \ \ \ \ \ \ \ \ \ \ \ \ TGCACCGAGACCGAGTCTACTAGCACCTCTACTCCATATGTCACCAGCTCTTCCTCGTCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTGGCTCTGGCTCAGATGATCGTGGAGATGAGGTATACAGTGGTCGAGAAGGAGCAGC / // / // /// //// / / / / / // / / / / | || | || ||| |||Hin4I | | | | | || CviJI | | TspRI | || | || ||| ||SetI | | | | | || AluI | | BsrI | || | || ||| |TaqII | | | | | |SetI | Ksp632I* | || | || ||| PleI | | | | | Tsp45I | SapI | || | || ||| MlyI | | | | | MaeIII Hpy99I | || | || ||| MaeI | | | | BsaXI | || | || ||AccI | | | | TstI | || | || |Hpy166II | | | MboII | || | || HinfI | | NdeI | || | |Tth111I | MnlI | || | BsaXI HphI | || TstI | |Eco31I | |BsmAI | ApaLI Hpy166II CviRI* C T E T E S T S T S T P Y V T S S S S S A P R P S L L A P L L H M S P A L P R R H R D R V Y * H L Y S I C H Q L F L V V ----:----|----:----|----:----|----:----|----:----|----:----| H V S V S D V L V E V G Y T V L E E E D T C R S R T * * C R * E M H * W S K R T A G L G L R S A G R S W I D G A R G R R ApaLI | BseMII | CviRI* | Hpy166II | |BspCNI | ||SduI | ||BseSI | ||HgiAI* | ||| TspGWI | ||| |DdeI | ||| || HinfI | ||| || | AccI | ||| || | |Hpy166II | ||| || | || BsrI | ||| || | || |PleI | ||| || | || ||MlyI TspRI | ||| || | || ||| EcoP15I BsrI | Csp6I | ||| || | || ||| | MaeIII |MnlI | |RsaI | ||| || | || ||| | Tsp45I NdeI \\ \ \\ \ \\\ \\ \ \\ \\\ \ \ \ TCCAGTGAAGTCTGTACGGAGTGCACCGAAACTGAGTCTACCAGTTATGTGACACCATAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCACTTCAGACATGCCTCACGTGGCTTTGACTCAGATGGTCAATACACTGTGGTATA / // /// / / / /// / / / / MnlI || ||| | | | ||| PleI | | NdeI || ||| | | | ||| MlyI | Tsp45I || ||| | | | ||AccI | MaeIII || ||| | | | ||BsrI EcoP15I || ||| | | | |Hpy166II || ||| | | | HinfI || ||| | | DdeI || ||| | TspGWI || ||| ApaLI || ||Hpy166II || ||CviRI* || |BspCNI || HgiAI* || BseMII || BseSI || SduI |Csp6I RsaI S S E V C T E C T E T E S T S Y V T P Y P V K S V R S A P K L S L P V M * H H M Q * S L Y G V H R N * V Y Q L C D T I C ----:----|----:----|----:----|----:----|----:----|----:----| D L S T Q V S H V S V S D V L * T V G Y T W H L R Y P T C R F Q T * W N H S V M G T F D T R L A G F S L R G T I H C W I BbvI | AluI | CviJI | | SetI | | | AccI | | | |Hpy166II | | | || TseI | | | || |BisI | | | || ||BlsI | | | || ||| AciI MaeI | | | || ||| BisI | AluI | | | || ||| |BlsI | CviJI | | | || ||| ||TauI | | SetI BsrI TspRI \ \ \ \\ \\\ \\\ \ \ \ \ \ GTCAGCTCGTCTACTGCTGCCGCAAACTACACTAGCTCATTCTCATCGTCCAGTGAAGTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTCGAGCAGATGACGACGGCGTTTGATGTGATCGAGTAAGAGTAGCAGGTCACTTCAG / / / // ////// /// / | | | |AccI |||||AciI ||CviJI TspRI | | | | ||||BisI ||AluI BsrI | | | | |||BlsI |MaeI | | | | ||TseI SetI | | | | ||TauI | | | | |BisI | | | | BlsI | | | Hpy166II | | BbvI | CviJI | AluI SetI V S S S T A A A N Y T S S F S S S S E V S A R L L L P Q T T L A H S H R P V K S Q L V Y C C R K L H * L I L I V Q * S L ----:----|----:----|----:----|----:----|----:----|----:----| T L E D V A A A F * V L E N E D D L S T H * S T * Q Q R L S C * S M R M T W H L D A R R S S G C V V S A * E * R G T F D NdeI TatI MnlI Bsp1407I DdeI | MaeIII | ApaLI | HinfI | Tsp45I | | BseMII | | TstI | | MboII | | CviRI* | | BsaXI | | | MaeI | | Hpy166II | | |AccI | | | |BsaXI | | |BspCNI | | ||Hpy166II | | | || AluI | | ||SduI | | ||| MaeI | | | || TstI |Csp6I | ||BseSI | | ||| |PleI | | | || CviJI ||RsaI | ||HgiAI* | | ||| ||MlyI SetI | | | || | SetI \\\ \ \\\ \ \ \\\ \\\ \ \ \ \ \\ \ \ TGTACAGAGTGCACCGAAACTGAGTCTACTAGCACCTCTACTCCATATGTCACTAGCTCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ACATGTCTCACGTGGCTTTGACTCAGATGATCGTGGAGATGAGGTATACAGTGATCGAGA /// /// / / / / /// / / / / / / //// ||| ||| ApaLI | | | ||| | SetI | | | | |||CviJI ||| ||| | | | ||| PleI | | | | |||AluI ||| ||| | | | ||| MlyI | | | | ||MaeI ||| ||| | | | ||| MaeI | | | | |SetI ||| ||| | | | ||AccI | | | | Tsp45I ||| ||| | | | |Hpy166II | | | | MaeIII ||| ||| | | | HinfI | | | BsaXI ||| ||| | | DdeI | | | TstI ||| ||| | BsaXI | | MboII ||| ||| TstI | NdeI ||| ||Hpy166II MnlI ||| ||CviRI* ||| |BspCNI ||| HgiAI* ||| BseMII ||| BseSI ||| SduI ||Bsp1407I ||TatI |Csp6I RsaI C T E C T E T E S T S T S T P Y V T S S V Q S A P K L S L L A P L L H M S L A L Y R V H R N * V Y * H L Y S I C H * L F ----:----|----:----|----:----|----:----|----:----|----:----| Q V S H V S V S D V L V E V G Y T V L E R Y L T C R F Q T * * C R * E M H * * S T C L A G F S L R S A G R S W I D S A R TspRI | TatI | Bsp1407I Tth111I | |Csp6I |HinfI | ||RsaI || AccI | ||| Hin4I || |Hpy166II | ||| | ApaLI || || BsrI BssKI | ||| | |BsmAI || || |PleI EcoRII | ||| | |Eco31I || || ||MlyI | SapI | ||| | ||CviRI* || || ||| TaqII | ScrFI | ||| | ||Hpy166II || || ||| EcoP15I | BseBI | ||| | ||| SduI || || ||| | MaeIII | Ksp632I* | ||| | ||| BseSI || || ||| | Tsp45I | | BsrI | ||| | ||| HgiAI* || || ||| | | Hin4I \ \ \ \ \\\ \ \\\ \ \\ \\ \\\ \ \ \ TCCTGGTCGTCCAGTGAAGTCTGTACAGAGTGCACCGAGACCGAGTCTACCAGTTATGTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGGACCAGCAGGTCACTTCAGACATGTCTCACGTGGCTCTGGCTCAGATGGTCAATACAC / / / //// / / // / /// // / / | | TspRI |||| | | |Eco31I | ||| || | EcoP15I | | BsrI |||| | | |BsmAI | ||| || Hin4I | Ksp632I* |||| | | ApaLI | ||| |TaqII | EcoRII |||| | Hpy166II | ||| PleI | BssKI |||| | CviRI* | ||| MlyI | SapI |||| HgiAI* | ||AccI BseBI |||| BseSI | ||BsrI ScrFI |||| SduI | |Hpy166II |||Bsp1407I | HinfI |||TatI Tth111I ||Csp6I |RsaI Hin4I S W S S S E V C T E C T E T E S T S Y V P G R P V K S V Q S A P R P S L P V M * L V V Q * S L Y R V H R D R V Y Q L C D ----:----|----:----|----:----|----:----|----:----|----:----| E Q D D L S T Q V S H V S V S D V L * T K R T T W H L R Y L T C R S R T * W N H G P R G T F D T C L A G L G L R G T I H BbvI | AluI | CviJI | | SetI | | | AccI | | | |Hpy166II | | | || TseI | | | || |BisI | | | || ||BlsI | | | || ||| AciI MaeI | | | || ||| BisI | AluI | | | || ||| |BlsI | CviJI NdeI | | | || ||| ||TauI | | SetI BsrI \ \ \ \ \\ \\\ \\\ \ \ \ \ ACACCATATGTCAGCTCGTCTACTGCTGCCGCAAACTACACTAGCTCATTCTCATCGTCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTATACAGTCGAGCAGATGACGACGGCGTTTGATGTGATCGAGTAAGAGTAGCAGG / / / / / // ////// /// / | | | | | |AccI |||||AciI ||CviJI TspRI | | | | | | ||||BisI ||AluI BsrI | | | | | | |||BlsI |MaeI | | | | | | ||TseI SetI | | | | | | ||TauI | | | | | | |BisI | | | | | | BlsI | | | | | Hpy166II | | | | BbvI | | | CviJI | | | AluI | | SetI | NdeI Tsp45I MaeIII T P Y V S S S T A A A N Y T S S F S S S H H M S A R L L L P Q T T L A H S H R P T I C Q L V Y C C R K L H * L I L I V Q ----:----|----:----|----:----|----:----|----:----|----:----| V G Y T L E D V A A A F * V L E N E D D S V M H * S T * Q Q R L S C * S M R M T C W I D A R R S S G C V V S A * E * R G TspRI | TatI | Bsp1407I DdeI | | ApaLI | HinfI | | | BseMII | | TstI | | | CviRI* | | BsaXI | | | Hpy166II | | |AccI NdeI | | | |BspCNI | | ||Hpy166II MnlI | | | ||SduI | | ||| MaeI | MaeIII | |Csp6I | ||BseSI | | ||| |PleI | Tsp45I | ||RsaI | ||HgiAI* | | ||| ||MlyI SetI | | MboII \ \\\ \ \\\ \ \ \\\ \\\ \ \ \ \ AGTGAAGTCTGTACAGAGTGCACCGAAACTGAGTCTACTAGCACCTCTACTCCATATGTC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTCAGACATGTCTCACGTGGCTTTGACTCAGATGATCGTGGAGATGAGGTATACAG /// /// / / / / /// / / / / / / ||| ||| ApaLI | | | ||| | SetI | | | BsaXI ||| ||| | | | ||| PleI | | | TstI ||| ||| | | | ||| MlyI | | MboII ||| ||| | | | ||| MaeI | NdeI ||| ||| | | | ||AccI MnlI ||| ||| | | | |Hpy166II ||| ||| | | | HinfI ||| ||| | | DdeI ||| ||| | BsaXI ||| ||| TstI ||| ||Hpy166II ||| ||CviRI* ||| |BspCNI ||| HgiAI* ||| BseMII ||| BseSI ||| SduI ||Bsp1407I ||TatI |Csp6I RsaI S E V C T E C T E T E S T S T S T P Y V V K S V Q S A P K L S L L A P L L H M S * S L Y R V H R N * V Y * H L Y S I C H ----:----|----:----|----:----|----:----|----:----|----:----| L S T Q V S H V S V S D V L V E V G Y T W H L R Y L T C R F Q T * * C R * E M H T F D T C L A G F S L R S A G R S W I D TspRI | TatI | Bsp1407I | |Csp6I | ||RsaI | ||| Hin4I | ||| | ApaLI | ||| | |BsmAI MaeI | ||| | |Eco31I Tth111I |BsaXI SapI | ||| | ||CviRI* |HinfI || AluI Ksp632I* | ||| | ||Hpy166II || AccI || TstI | Hpy99I | ||| | ||| SduI || |Hpy166II || CviJI | | BsrI | ||| | ||| BseSI || || BsrI || | SetI | | |MnlI | ||| | ||| HgiAI* || || |PleI \\ \ \ \ \ \\ \ \\\ \ \\\ \ \\ \\ \\ ACTAGCTCTTCCTCGTCGTCCAGTGAAGTCTGTACAGAGTGCACCGAGACCGAGTCTACC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCGAGAAGGAGCAGCAGGTCACTTCAGACATGTCTCACGTGGCTCTGGCTCAGATGG //// / / / / //// / / // / /// |||CviJI | | | MnlI |||| | | |Eco31I | ||AccI |||AluI | | TspRI |||| | | |BsmAI | ||BsrI ||MaeI | | BsrI |||| | | ApaLI | |Hpy166II |SetI | Ksp632I* |||| | Hpy166II | HinfI Tsp45I | SapI |||| | CviRI* Tth111I MaeIII Hpy99I |||| HgiAI* |||| BseSI |||| SduI |||Bsp1407I |||TatI ||Csp6I |RsaI Hin4I T S S S S S S S E V C T E C T E T E S T L A L P R R P V K S V Q S A P R P S L P * L F L V V Q * S L Y R V H R D R V Y Q ----:----|----:----|----:----|----:----|----:----|----:----| V L E E E D D L S T Q V S H V S V S D V * * S K R T T W H L R Y L T C R S R T * S A R G R R G T F D T C L A G L G L R G BbvI | AluI | CviJI | | SetI | | | AccI | | | |Hpy166II | | | || TseI MlyI | | | || |BisI | TaqII | | | || ||BlsI | EcoP15I | | | || ||| AciI MaeI | | MaeIII | | | || ||| BisI | AluI | | Tsp45I | | | || ||| |BlsI | CviJI | | | Hin4I NdeI | | | || ||| ||TauI | | SetI \ \ \ \ \ \ \ \ \\ \\\ \\\ \ \ \ AGTTATGTGACACCATATGTCAGCTCGTCTACTGCTGCCGCAAACTACACTAGCTCTTTC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TCAATACACTGTGGTATACAGTCGAGCAGATGACGACGGCGTTTGATGTGATCGAGAAAG // / / / / / / / // ////// /// || | | | | | | | |AccI |||||AciI ||CviJI || | | | | | | | | ||||BisI ||AluI || | | | | | | | | |||BlsI |MaeI || | | | | | | | | ||TseI SetI || | | | | | | | | ||TauI || | | | | | | | | |BisI || | | | | | | | | BlsI || | | | | | | | Hpy166II || | | | | | | BbvI || | | | | | CviJI || | | | | | AluI || | | | | SetI || | | | NdeI || | | Tsp45I || | | MaeIII || | EcoP15I || Hin4I |TaqII PleI MlyI S Y V T P Y V S S S T A A A N Y T S S F V M * H H M S A R L L L P Q T T L A L S L C D T I C Q L V Y C C R K L H * L F L ----:----|----:----|----:----|----:----|----:----|----:----| L * T V G Y T L E D V A A A F * V L E K W N H S V M H * S T * Q Q R L S C * S K T I H C W I D A R R S S G C V V S A R E TspRI | TatI HinfI | Bsp1407I | TstI | | ApaLI | BsaXI | | | CviRI* | |AccI | | | Hpy166II | ||Hpy166II | | | | SduI | ||| MaeI | |Csp6I | | BseSI | ||| |PleI BsrI | ||RsaI | | HgiAI* | ||| ||MlyI SetI HphI \ \ \\\ \ \ \ \ \\\ \\\ \ \ TCATCGTCCAGTGAAGTCTGTACAGAGTGCACCGAAACCGAGTCTACTAGCACCTCTACT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCAGGTCACTTCAGACATGTCTCACGTGGCTTTGGCTCAGATGATCGTGGAGATGA / /// / / / / / /// / / / TspRI ||| | | ApaLI | | ||| | SetI HphI BsrI ||| | | | | ||| PleI ||| | | | | ||| MlyI ||| | | | | ||| MaeI ||| | | | | ||AccI ||| | | | | |Hpy166II ||| | | | | HinfI ||| | | | BsaXI ||| | | TstI ||| | Hpy166II ||| | CviRI* ||| HgiAI* ||| BseSI ||| SduI ||Bsp1407I ||TatI |Csp6I RsaI S S S S E V C T E C T E T E S T S T S T H R P V K S V Q S A P K P S L L A P L L I V Q * S L Y R V H R N R V Y * H L Y S ----:----|----:----|----:----|----:----|----:----|----:----| E D D L S T Q V S H V S V S D V L V E V R M T W H L R Y L T C R F R T * * C R * * R G T F D T C L A G F G L R S A G R S NdeI MnlI | MaeIII | Tsp45I TspRI | | MboII | TatI | | | BsaXI | Bsp1407I | | | | AluI | |Csp6I | | | | TstI | ||RsaI | | | | CviJI | ||| Hin4I | | | | | SetI | ||| | ApaLI | | | | | | BssKI | ||| | |BsmAI | | | | | | EcoRII | ||| | |Eco31I | | | | | | | SapI | ||| | ||CviRI* | | | | | | | ScrFI | ||| | ||Hpy166II | | | | | | | BseBI | ||| | ||| SduI | | | | | | | Ksp632I* | ||| | ||| BseSI | | | | | | | | BsrI | ||| | ||| HgiAI* Tth111I \ \ \ \ \ \ \ \ \ \ \\\ \ \\\ \ \ CCATATGTCACCAGCTCTTCCTGGTCGTCCAGTGAAGTCTGTACAGAGTGCACCGAGACC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTATACAGTGGTCGAGAAGGACCAGCAGGTCACTTCAGACATGTCTCACGTGGCTCTGG / / / / // / / / / //// / / // | | | | || CviJI | | TspRI |||| | | |Eco31I | | | | || AluI | | BsrI |||| | | |BsmAI | | | | |SetI | Ksp632I* |||| | | ApaLI | | | | Tsp45I | EcoRII |||| | Hpy166II | | | | MaeIII | BssKI |||| | CviRI* | | | BsaXI | SapI |||| HgiAI* | | | TstI BseBI |||| BseSI | | MboII ScrFI |||| SduI | NdeI |||Bsp1407I MnlI |||TatI ||Csp6I |RsaI Hin4I P Y V T S S S W S S S E V C T E C T E T H M S P A L P G R P V K S V Q S A P R P I C H Q L F L V V Q * S L Y R V H R D R ----:----|----:----|----:----|----:----|----:----|----:----| G Y T V L E E Q D D L S T Q V S H V S V E M H * W S K R T T W H L R Y L T C R S W I D G A R G P R G T F D T C L A G L G BbvI | AluI HinfI | CviJI | AccI | | SetI | |Hpy166II | | | AccI | || BsrI | | | |Hpy166II | || |PleI | | | || TseI | || ||MlyI | | | || |BisI | || ||| TaqII | | | || ||BlsI | || ||| EcoP15I | | | || ||| AciI | || ||| | MaeIII | | | || ||| BisI | || ||| | Tsp45I | | | || ||| |BlsI | || ||| | | Hin4I NdeI | | | || ||| ||TauI MaeI \ \\ \\\ \ \ \ \ \ \ \ \\ \\\ \\\ \ GAGTCTACCAGTTATGTGACACCATATGTCAGCTCGTCTACTGCTGCCGCAAACTACACT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAGATGGTCAATACACTGTGGTATACAGTCGAGCAGATGACGACGGCGTTTGATGTGA / /// // / / / / / / / // ////// / | ||| || | | | | | | | |AccI |||||AciI SetI | ||| || | | | | | | | | ||||BisI | ||| || | | | | | | | | |||BlsI | ||| || | | | | | | | | ||TseI | ||| || | | | | | | | | ||TauI | ||| || | | | | | | | | |BisI | ||| || | | | | | | | | BlsI | ||| || | | | | | | | Hpy166II | ||| || | | | | | | BbvI | ||| || | | | | | CviJI | ||| || | | | | | AluI | ||| || | | | | SetI | ||| || | | | NdeI | ||| || | | Tsp45I | ||| || | | MaeIII | ||| || | EcoP15I | ||| || Hin4I | ||| |TaqII | ||| PleI | ||| MlyI | ||AccI | ||BsrI | |Hpy166II | HinfI Tth111I E S T S Y V T P Y V S S S T A A A N Y T S L P V M * H H M S A R L L L P Q T T L V Y Q L C D T I C Q L V Y C C R K L H * ----:----|----:----|----:----|----:----|----:----|----:----| S D V L * T V G Y T L E D V A A A F * V R T * W N H S V M H * S T * Q Q R L S C L R G T I H C W I D A R R S S G C V V S TspRI | TatI FokI | Bsp1407I |HinfI | | ApaLI || TstI | | | CviRI* || BsaXI | | | Hpy166II || |AccI AluI | | | | SduI || ||Hpy166II CviJI | |Csp6I | | BseSI || ||| PleI | SetI BsrI | ||RsaI | | HgiAI* || ||| |MlyI \ \ \ \ \\\ \ \ \ \\ \\\ \\ AGCTCATTCTCATCGTCCAGTGAAGTCTGTACAGAGTGCACCGAAACCGAGTCTACAAGC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGTAAGAGTAGCAGGTCACTTCAGACATGTCTCACGTGGCTTTGGCTCAGATGTTCG // / /// / / / / / /// // |CviJI TspRI ||| | | ApaLI | | ||| |BseGI |AluI BsrI ||| | | | | ||| PleI MaeI ||| | | | | ||| MlyI ||| | | | | ||AccI ||| | | | | |Hpy166II ||| | | | | HinfI ||| | | | | FokI ||| | | | BsaXI ||| | | TstI ||| | Hpy166II ||| | CviRI* ||| HgiAI* ||| BseSI ||| SduI ||Bsp1407I ||TatI |Csp6I RsaI S S F S S S S E V C T E C T E T E S T S A H S H R P V K S V Q S A P K P S L Q A L I L I V Q * S L Y R V H R N R V Y K H ----:----|----:----|----:----|----:----|----:----|----:----| L E N E D D L S T Q V S H V S V S D V L * S M R M T W H L R Y L T C R F R T * L A * E * R G T F D T C L A G F G L R C A MnlI NdeI | TspDTI | CviRI* | |BsrI | | BsaXI | || AluI | | |SetI | || CviJI BseGI | | ||TstI | || | SetI AciI \ \ \ \\\ \ \\ \ \ \ ACATCCACTCCATATGCAACCTCATCTACTGGCACAGCTACTTCATTTACCGCTTCAACT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGGTGAGGTATACGTTGGAGTAGATGACCGTGTCGATGAAGTAAATGGCGAAGTTGA / / / /// / / / | | BsaXI ||| | CviJI AciI | | TstI ||| | AluI | | SetI ||| SetI | CviRI* ||BsrI NdeI |TspDTI MnlI T S T P Y A T S S T G T A T S F T A S T H P L H M Q P H L L A Q L L H L P L Q L I H S I C N L I Y W H S Y F I Y R F N F ----:----|----:----|----:----|----:----|----:----|----:----| V D V G Y A V E D V P V A V E N V A E V C M W E M H L R M * Q C L * K M * R K L C G S W I C G * R S A C S S * K G S * S FatI |CviAII || NlaIII || |AcyI || |MaeII || ||ZraI || |||XcmI || ||||SetI || ||||TaiI || ||||AatII || ||||| AsuI* || ||||| AvaII MboII || ||||| |BmgT120I Tsp4CI* | CviJI \\ \\\\\ \\ \ \ \ TCCAATACCATGACGTCTTTGGTCCAAACAGACACAACCGTTTCTTTCAGCCTATCTTCA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTATGGTACTGCAGAAACCAGGTTTGTCTGTGTTGGCAAAGAAAGTCGGATAGAAGT / // // // / / / | || |MaeII |AvaII Tsp4CI* | CviJI | || |AcyI |AsuI* MboII | || XcmI BmgT120I | || ZraI | |AatII | |FatI | |TaiI | |SetI | CviAII NlaIII S N T M T S L V Q T D T T V S F S L S S P I P * R L W S K Q T Q P F L S A Y L Q Q Y H D V F G P N R H N R F F Q P I F N ----:----|----:----|----:----|----:----|----:----|----:----| E L V M V D K T W V S V V T E K L R D E K W Y W S T K P G F L C L R K K * G I K G I G H R R Q D L C V C G N R E A * R * PleI TspDTI |MlyI |MmeI ||MaeI ||| TatI Tsp4CI* SfeI* ||| |Csp6I | BsaXI |BsaXI ||| ||RsaI | | Cac8I TspDTI || HinfI ||| ||ScaI \ \ \ \ \\ \ \\\ \\\ ACTGTAAGCGAGCATACCAACGCTCCAACTTCATCTGTAGAGTCAAATGCTAGTACTTTC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TGACATTCGCTCGTATGGTTGCGAGGTTGAAGTAGACATCTCAGTTTACGATCATGAAAG // / / / / / // / / /// |BsaXI Cac8I TspDTI BsaXI | | || | | ||TatI Tsp4CI* | | || | | |Csp6I | | || | | ScaI | | || | | RsaI | | || | MaeI | | || PleI | | || MlyI | | |MmeI | | TspDTI | HinfI SfeI* T V S E H T N A P T S S V E S N A S T F L * A S I P T L Q L H L * S Q M L V L S C K R A Y Q R S N F I C R V K C * Y F H ----:----|----:----|----:----|----:----|----:----|----:----| V T L S C V L A G V E D T S D F A L V K L Q L R A Y W R E L K M Q L T L H * Y K S Y A L M G V S W S * R Y L * I S T S E TseI |BisI ||BlsI ||| MseI ||| | FokI ||| | | BbvI ||| | | | MaeIII ||| | | | | MaeII ||| | | | | | SetI ||| | | | | | TaiI ||| | | | | | BseGI \\\ \ \ \ \ \ \ ATATCGTCAAATAAAGGCAGCGTTAAAAGTTATGTTACGTCATCCATACATAGCATTACG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGCAGTTTATTTCCGTCGCAATTTTCAATACAATGCAGTAGGTATGTATCGTAATGC /// / / / / // ||TseI MseI | | | |MaeII |BisI | | | MaeIII BlsI | | | BseGI | | TaiI | | SetI | BbvI FokI I S S N K G S V K S Y V T S S I H S I T Y R Q I K A A L K V M L R H P Y I A L R I V K * R Q R * K L C Y V I H T * H Y A ----:----|----:----|----:----|----:----|----:----|----:----| M D D F L P L T L L * T V D D M C L M V * I T L Y L C R * F N H * T M W V Y C * Y R * I F A A N F T I N R * G Y M A N R MaeIII FatI Tsp4CI* |CviAII | TsoI || NlaIII | |MaeI BsmAI || | MaeI | || AluI | TspEI || | | MaeIII | || CviJI | | NmeAIII || | | | BciVI | || | SetI | | |MboII \\ \ \ \ \ \ \\ \ \ \ \ \\ CCCATGTATCCTAGTAACCAAACCGTAACATCTAGCTCTGTTGTCTCCACACCAATTACT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTACATAGGATCATTGGTTTGGCATTGTAGATCGAGACAACAGAGGTGTGGTTAATGA / // / / / / / /// / /// | |FatI | | | | | ||CviJI | ||MboII | CviAII | | | | | ||AluI | |TspEI NlaIII | | | | | |MaeI | NmeAIII | | | | | SetI BsmAI | | | | MaeIII | | | | TsoI | | | Tsp4CI* | | MaeIII | BciVI MaeI P M Y P S N Q T V T S S S V V S T P I T P C I L V T K P * H L A L L S P H Q L L H V S * * P N R N I * L C C L H T N Y F ----:----|----:----|----:----|----:----|----:----|----:----| G M Y G L L W V T V D L E T T E V G I V A W T D * Y G F R L M * S Q Q R W V L * G H I R T V L G Y C R A R N D G C W N S Hpy188I |TfiI |HinfI || SecI* || | CviJI || | HaeIII || | | DdeI || | | | MnlI || | | | MaeIII Hpy188I Hpy188I || | | | | MnlI |ApoI |TfiI || | | | | | BspCNI |TspEI |HinfI || | | | | | |BseMII MnlI |EcoRI \\ \\ \ \ \ \ \ \\ \ \\ TCCGAATCTTCTGAATCCTCGGCCTCAGTTACCATTCTACCCTCAACTATCACTTCTGAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTTAGAAGACTTAGGAGCCGGAGTCAATGGTAAGATGGGAGTTGATAGTGAAGACTT / / / / // // / // / / | | | | || |DdeI | |BseMII MnlI Hpy188I | | | | || MnlI | BspCNI | | | | |HaeIII MaeIII | | | | |CviJI MnlI | | | | SecI* | | | HinfI | | | TfiI | | Hpy188I | HinfI | TfiI Hpy188I S E S S E S S A S V T I L P S T I T S E P N L L N P R P Q L P F Y P Q L S L L N R I F * I L G L S Y H S T L N Y H F * I ----:----|----:----|----:----|----:----|----:----|----:----| E S D E S D E A E T V M R G E V I V E S K R I K Q I R P R L * W E V R L * * K Q G F R R F G R G * N G N * G * S D S R F SetI BccI |BseRI MnlI | Hin4II* ||TspDTI HphI | TspEI \ \ \\\ \ \ \ TTCAAACCATCTACAATGAAAACGAAGGTCGTTAGTATCTCCTCATCACCAACTAATTTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTGGTAGATGTTACTTTTGCTTCCAGCAATCATAGAGGAGTAGTGGTTGATTAAAC / // / // / / // EcoRI |Hin4II* | |TspDTI HphI MnlI |Hin4I TspEI BccI | BseRI |Hin4I ApoI SetI TspEI F K P S T M K T K V V S I S S S P T N L S N H L Q * K R R S L V S P H H Q L I * Q T I Y N E N E G R * Y L L I T N * F D ----:----|----:----|----:----|----:----|----:----|----:----| N L G D V I F V F T T L I E E D G V L K I * V M * L S F S P R * Y R R M V L * N E F W R C H F R L D N T D G * * W S I Q TfiI HinfI | FokI Hin4I | | TspDTI Hin4I | | | Hin4I | AluI | | | Hin4I | CviJI | | | Tsp4CI* | | SetI DdeI | | | | BseGI \ \ \ \ \ \ \ \ \ ATTACCAGCTATGACACTACATCTAAGGATTCAACTGTTGGTTCATCCACATCGTCTGTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGGTCGATACTGTGATGTAGATTCCTAAGTTGACAACCAAGTAGGTGTAGCAGACAT / / / // // / | CviJI | || || BseGI | AluI | || |Tsp4CI* SetI | || FokI | |Hin4I | |Hin4I | |HinfI | |TfiI | TspDTI DdeI I T S Y D T T S K D S T V G S S T S S V L P A M T L H L R I Q L L V H P H R L * Y Q L * H Y I * G F N C W F I H I V C K ----:----|----:----|----:----|----:----|----:----|----:----| I V L * S V V D L S E V T P E D V D D T S * W S H C * M * P N L Q Q N M W M T Q N G A I V S C R L I * S N T * G C R R Y CviJI | MboI AluI | | DpnI CviJI | | |BstKTI | SetI | | || MaeI AjuI | | MaeI AjuI SspI \ \ \\ \ \ \ \ \ \ \ AGCCTGATCTCTAGTATTTCTCTACCAAGTAGTTATTCAGCTTCTAGCGAACAAATATTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGACTAGAGATCATAAAGAGATGGTTCATCAATAAGTCGAAGATCGCTTGTTTATAAA / // / / / / // / | || | MaeI | | |MaeI SspI | || | AjuI | | AjuI | || MboI | CviJI | |DpnI | AluI | BstKTI SetI CviJI S L I S S I S L P S S Y S A S S E Q I F A * S L V F L Y Q V V I Q L L A N K Y F P D L * Y F S T K * L F S F * R T N I S ----:----|----:----|----:----|----:----|----:----|----:----| L R I E L I E R G L L * E A E L S C I N L G S R * Y K E V L Y N N L K * R V F I A Q D R T N R * W T T I * S R A F L Y K Tsp4CI* | FalI AluI | FalI CviJI | | MseI | SetI BccI | | | MboII TaqI PshAI \ \ \ \ \ \ \ \ \ CACAGCTCCATCGTTAGTTCAAACGGTCAAGCATTAACAAGTTTTTCTTCGACCAAAGTC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTCGAGGTAGCAATCAAGTTTGCCAGTTCGTAATTGTTCAAAAAGAAGCTGGTTTCAG / / / // // / / / | CviJI BccI |FalI |MboII | | FalI | AluI |FalI MseI | | FalI SetI Tsp4CI* | PshAI TaqI H S S I V S S N G Q A L T S F S S T K V T A P S L V Q T V K H * Q V F L R P K S Q L H R * F K R S S I N K F F F D Q S Q ----:----|----:----|----:----|----:----|----:----|----:----| * L E M T L E F P * A N V L K E E V L T E C S W R * N L R D L M L L N K K S W L V A G D N T * V T L C * C T K R R G F D FalI FalI | MboII | |DdeI | || Hpy188I | || |TfiI | || |HinfI | || || MnlI | || || | BtgZI TfiI | || || | |Hpy188I HinfI | || || | ||TfiI |Eco57I | || || | ||HinfI |Eco57MI | || || | ||BspCNI BseGI ||TspRI | || || | |||BseMII FokI | BsrI ||| MboII \ \\ \\ \ \\\\ \ \ \ \\\ \ AGTTCCTCAGAATCTTCTGAATCACATAGAACATCGCCCACTACATCCAGTGAATCAGGC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGGAGTCTTAGAAGACTTAGTGTATCTTGTAGCGGGTGATGTAGGTCACTTAGTCCG / // // // // / / / / / / | || || || |HinfI FokI | TspRI | | MboII | || || || |TfiI | BsrI | HinfI | || || || BtgZI BseGI | TfiI | || || |BseMII Eco57MI | || || Hpy188I Eco57I | || || BspCNI | || |MnlI | || HinfI | || TfiI | |DdeI | Hpy188I MboII S S S E S S E S H R T S P T T S S E S G V P Q N L L N H I E H R P L H P V N Q A F L R I F * I T * N I A H Y I Q * I R H ----:----|----:----|----:----|----:----|----:----|----:----| L E E S D E S D C L V D G V V D L S D P * N R L I K Q I V Y F M A W * M W H I L T G * F R R F * M S C R G S C G T F * A Ksp632I* | MnlI | | AluI TaqI | | CviJI |FalI MboII | | | SetI |FalI | Csp6I | | | | Hpy178III* ||TfiI | |RsaI | | | | |FalI SfaNI ||HinfI | || SetI | | | | |FalI \ \\\ \ \\ \ \ \ \ \ \\ ATCAAATCTTCAGGCGTTGAAATCGAATCTACAAGTACCTCTTCTTTCAGCTTTCACGAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTAGAAGTCCGCAACTTTAGCTTAGATGTTCATGGAGAAGAAAGTCGAAAGTGCTT / / / / / // // // / SfaNI FalI | | | |Csp6I || |FalI Hpy178III* FalI | | | RsaI || |FalI | | | SetI || CviJI | | MboII || AluI | HinfI |Ksp632I* | TfiI |SetI TaqI MnlI I K S S G V E I E S T S T S S F S F H E S N L Q A L K S N L Q V P L L S A F T K Q I F R R * N R I Y K Y L F F Q L S R N ----:----|----:----|----:----|----:----|----:----|----:----| M L D E P T S I S D V L V E E K L K * S C * I K L R Q F R I * L Y R K K * S E R D F R * A N F D F R C T G R R E A K V F DdeI |FokI || MlyI || PleI || | MaeIII || | Tsp45I SetI || | | HinfI SfeI* | MnlI || | | | BspCNI | TspGWI | | MboII || | | | |BseGI | |CviJI | | | MnlI || | | | |BseMII BccI \ \\ \ \ \ \ \\ \ \ \ \\ \ ACTTCTACAGCCTCCACCTCCGTTCAAATATCTTCTCAGTTTGTGACTCCATCCTCCCCT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGATGTCGGAGGTGGAGGCAAGTTTATAGAAGAGTCAAACACTGAGGTAGGAGGGGA / // / / / / /// /// / | || SetI | | MnlI ||PleI ||HinfI BccI | |CviJI | MboII ||FokI |BseMII | SfeI* MnlI |MlyI |Tsp45I TspGWI DdeI |MaeIII |BseGI BspCNI T S T A S T S V Q I S S Q F V T P S S P L L Q P P P P F K Y L L S L * L H P P L F Y S L H L R S N I F S V C D S I L P Y ----:----|----:----|----:----|----:----|----:----|----:----| V E V A E V E T * I D E * N T V G D E G F K * L R W R R E F I K E T Q S E M R G S R C G G G G N L Y R R L K H S W G G R TatI SfeI* |MboII | MnlI |Csp6I | | CviJI ||RsaI | | | SduI ||| ApoI MnlI Tsp4CI* | | | HgiJII* BarI ||| TspEI \ \ \ \ \ \ \ \\\ \ ATTTCCACAGTTGCCCCTCGTTCTACAGGGCTCAATAGTCAAACTGAAAGTACAAATTCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGTGTCAACGGGGAGCAAGATGTCCCGAGTTATCAGTTTGACTTTCATGTTTAAGA / / / // / / / /// / MnlI Tsp4CI* | || CviJI BarI | ||TatI TspEI | |HgiJII* | |Csp6I ApoI | |SduI | RsaI | SfeI* MboII MnlI I S T V A P R S T G L N S Q T E S T N S F P Q L P L V L Q G S I V K L K V Q I L F H S C P S F Y R A Q * S N * K Y K F F ----:----|----:----|----:----|----:----|----:----|----:----| I E V T A G R E V P S L L * V S L V F E * K W L Q G E N * L A * Y D F Q F Y L N N G C N G R T R C P E I T L S F T C I R Hin6I |GlaI FatI ||HhaI |CviAII |||HaeII Hin4II* || BarI ||||Cac8I | AluI StyI || |NlaIII ||||| MboII | CviJI SecI* || || Hpy188I ||||| TspDTI | | SetI \ \\ \\ \ \\\\\ \ \ \ \ TCCAAGGAAACCATGTCGTCTGAAAATAGCGCCAGCGTTATGCCTTCTTCATCAGCTACA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTCCTTTGGTACAGCAGACTTTTATCGCGGTCGCAATACGGAAGAAGTAGTCGATGT / / / // / //// / // // / | | | |FatI Hpy188I |||| | |MboII || CviJI | | | CviAII |||| | TspDTI || AluI | | NlaIII |||| Cac8I |SetI | BarI |||Hin6I Hin4II* SecI* ||GlaI StyI |HhaI HaeII S K E T M S S E N S A S V M P S S S A T P R K P C R L K I A P A L C L L H Q L H Q G N H V V * K * R Q R Y A F F I S Y I ----:----|----:----|----:----|----:----|----:----|----:----| E L S V M D D S F L A L T I G E E D A V K W P F W T T Q F Y R W R * A K K M L * G L F G H R R F I A G A N H R R * * S C BetI* BspMII* |HpaII |Hpy178III* || TspDTI || | BsiI* || | | Hpy178III* || | | | MboI MaeIII MboII || | | | | DpnI BsiYI* | BsrI |TspRI || | | | | |BstKTI \ \ \ \\ \\ \ \ \ \ \\ TCTCCCAAAACAGGCAAAGTTACCAGTGATGAAACTTCTTCCGGATTTTCTCGTGATCGC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGGTTTTGTCCGTTTCAATGGTCACTACTTTGAAGAAGGCCTAAAAGAGCACTAGCG / / / / /// /// / / BsiYI* | | MboII ||BspMII* ||| | TspRI | MaeIII ||BetI* ||| MboI TspRI |Hpy178III* ||DpnI BsrI |HpaII |BstKTI TspDTI Hpy178III* BsiI* S P K T G K V T S D E T S S G F S R D R L P K Q A K L P V M K L L P D F L V I A S Q N R Q S Y Q * * N F F R I F S * S H ----:----|----:----|----:----|----:----|----:----|----:----| D G L V P L T V L S S V E E P N E R S R M E W F L C L * W H H F K K R I K E H D R G F C A F N G T I F S R G S K R T I A OliI MslI |Eco57I |Eco57MI BseGI ||Tsp4CI* | Hpy188I ||| TspRI | | FokI MnlI TspDTI \\\ \ \ \ \ \ \ ACCACTGTGTATAGGATGACTTCAGAAACACCCTCCACAAATGAACAAACAACTTTGATT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGACACATATCCTACTGAAGTCTTTGTGGGAGGTGTTTACTTGTTTGTTGAAACTAA /// / / / / / ||Tsp4CI* | Hpy188I FokI MnlI TspDTI |MslI BseGI |OliI Eco57MI Eco57I T T V Y R M T S E T P S T N E Q T T L I P L C I G * L Q K H P P Q M N K Q L * L H C V * D D F R N T L H K * T N N F D Y ----:----|----:----|----:----|----:----|----:----|----:----| V V T Y L I V E S V G E V F S C V V K I C W Q T Y S S K L F V R W L H V F L K S G S H I P H S * F C G G C I F L C S Q N TseI AluI CviJI |BisI Tsp4CI* BbvI |Bce83I* | SmlI | TfiI ||BlsI | | BsmAI SecI* Tsp4CI* | HinfI ||SetI | | | SfeI* DsaI* \ \ \ \\\ \ \ \ \ \ ACTGTAAGTTCTTGTGAATCAAATAGCTGCTCAAACACAGTCTCAAGTGCTGTAGTTTCC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TGACATTCAAGAACACTTAGTTTATCGACGAGTTTGTGTCAGAGTTCACGACATCAAAGG / / / ////// / / / / Tsp4CI* | | |||||TseI Tsp4CI* | | SfeI* | | ||||BisI | BsmAI | | |||BlsI SmlI | | ||CviJI | | ||AluI | | |Bce83I* | | SetI | HinfI | TfiI BbvI T V S S C E S N S C S N T V S S A V V S L * V L V N Q I A A Q T Q S Q V L * F P C K F L * I K * L L K H S L K C C S F H ----:----|----:----|----:----|----:----|----:----|----:----| V T L E Q S D F L Q E F V T E L A T T E * Q L N K H I L Y S S L C L R L H Q L K S Y T R T F * I A A * V C D * T S Y N G FatI |CviAII || HgiCI* || NlaIII CfrI BceAI || | NlaIV | CviJI | BsiYI* || | | SduI | HaeIII | | BccI TspRI || | | BseSI \ \ \ \ \ \ \\ \ \ \ ACGGCCACCACTACCATCAATGGGATTACCACTGAATATACTACATGGTGCCCTCTTTCT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCGGTGGTGATGGTAGTTACCCTAATGGTGACTTATATGATGTACCACGGGAGAAAGA // / / / / / / //// / || CfrI | | | TspRI | |||| HgiCI* |HaeIII | | BccI | |||NlaIV |CviJI | BceAI | ||BseSI DsaI* BsiYI* | ||SduI SecI* | |FatI | CviAII NlaIII T A T T T I N G I T T E Y T T W C P L S R P P L P S M G L P L N I L H G A L F L G H H Y H Q W D Y H * I Y Y M V P S F C ----:----|----:----|----:----|----:----|----:----|----:----| V A V V V M L P I V V S Y V V H H G R E W P W W * W * H S * W Q I Y * M T G E K R G G S G D I P N G S F I S C P A R K R MboII HinfI | TspEI Tsp4CI* | Hpy188I | | BsiYI* TspEI |TspGWI | | PleI | | | MaeIII MnlI | MseI || TspEI | | |MlyI | | | Tsp4CI* \ \ \ \\ \ \ \ \\ \ \ \ \ GCTACGGAATTAACAACGGTAAGTAAATTAGAGTCAGAAGAAAAAACCACCCTAATTACG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGCCTTAATTGTTGCCATTCATTTAATCTCAGTCTTCTTTTTTGGTGGGATTAATGC / // / / // / / / / / MnlI |MseI Tsp4CI* | || PleI MboII | | Tsp4CI* TspEI TspGWI | || MlyI | TspEI | |Hpy188I BsiYI* | HinfI TspEI A T E L T T V S K L E S E E K T T L I T L R N * Q R * V N * S Q K K K P P * L R Y G I N N G K * I R V R R K N H P N Y G ----:----|----:----|----:----|----:----|----:----|----:----| A V S N V V T L L N S D S S F V V R I V Q * P I L L P L Y I L T L L F F W G L * S R F * C R Y T F * L * F F F G G * N R AarI PleI Hpy188I MwoI BspMI HinfI |MlyI | HphI | SetI | TaqI \ \\ \ \ \ \ \ \ GTTACTTCTTGTGAGTCTGGTGTCTGTTCCGAAACTGCTTCACCTGCTATCGTTTCGACA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGAAGAACACTCAGACCACAGACAAGGCTTTGACGAAGTGGACGATAGCAAAGCTGT / / / / / // / / / MaeIII HinfI PleI | HphI |SetI | | TspRI MlyI Hpy188I MwoI | | BtsI | TaqI BspMI AarI V T S C E S G V C S E T A S P A I V S T L L L V S L V S V P K L L H L L S F R Q Y F L * V W C L F R N C F T C Y R F D S ----:----|----:----|----:----|----:----|----:----|----:----| T V E Q S D P T Q E S V A E G A I T E V P * K K H T Q H R N R F Q K V Q * R K S N S R T L R T D T G F S S * R S D N R C FatI |CviAII || NlaIII CviJI || | NlaIV |BtsI || | |CviJI || AlwNI || | || SduI || | TspRI MaeIII || | || HgiJII* || | | Tsp4CI* | Tsp4CI* || | || | CviJI \\ \ \ \ \ \ \\ \ \\ \ \ GCCACTGCTACCGTCAATGATGTCGTTACAGTTTATTCCACATGGAGCCCACAGGCTACA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGACGATGGCAGTTACTACAGCAATGTCAAATAAGGTGTACCTCGGGTGTCCGATGT / / / / ///// / AlwNI Tsp4CI* Tsp4CI* | ||||CviJI CviJI CviJI MaeIII | |||NlaIV | ||HgiJII* | ||SduI | |FatI | CviAII NlaIII A T A T V N D V V T V Y S T W S P Q A T P L L P S M M S L Q F I P H G A H R L Q H C Y R Q * C R Y S L F H M E P T G Y K ----:----|----:----|----:----|----:----|----:----|----:----| A V A V T L S T T V T * E V H L G C A V L W Q * R * H H R * L K N W M S G V P * G S S G D I I D N C N I G C P A W L S C EcoP15I |BsrI |TspDTI || BglI || MwoI || | CviJI || | | BcgI BseMII MaeI Hpy188I || | | |BbvI |BspCNI | AciI BcgI | TaqI || | | || MnlI |Hpy188I \ \ \ \ \ \\ \ \ \\ \ \\ AATAAACTAGCGGTTAGTTCTGACATCGAAAATAGTGCCAGTAAGGCTTCATTCGTTTCA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTGATCGCCAATCAAGACTGTAGCTTTTATCACGGTCATTCCGAAGTAAGCAAAGT / / / / / / // / / / ///// | | BcgI Hpy188I TaqI | |MwoI | BcgI | ||||Hpy188I | AciI | |BglI CviJI | |||BspCNI MaeI | EcoP15I | ||BseMII TspDTI | |Hin4I BsrI | BbvI MnlI N K L A V S S D I E N S A S K A S F V S I N * R L V L T S K I V P V R L H S F Q * T S G * F * H R K * C Q * G F I R F R ----:----|----:----|----:----|----:----|----:----|----:----| F L S A T L E S M S F L A L L A E N T E L Y V L P * N Q C R F Y H W Y P K M R K I F * R N T R V D F I T G T L S * E N * Hin4I | TseI | BsmAI | CviJI | AlwNI | |BisI | ||BlsI Hin4I PflMI | ||| DdeI | TspEI BsiYI* \ \\\ \ \ \ \ GAGGCTGCTGAGACAAAATCCATAAGCAGAAACAACAATTTTGTTCCAACTTCTGGGACT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGACGACTCTGTTTTAGGTATTCGTCTTTGTTGTTAAAACAAGGTTGAAGACCCTGA / ///// / / / / | ||||| DdeI Hin4I TspEI BsiYI* | ||||BsmAI PflMI | |||TseI | ||BisI | |BlsI | CviJI AlwNI E A A E T K S I S R N N N F V P T S G T R L L R Q N P * A E T T I L F Q L L G L G C * D K I H K Q K Q Q F C S N F W D Y ----:----|----:----|----:----|----:----|----:----|----:----| S A A S V F D M L L F L L K T G V E P V L P Q Q S L I W L C F C C N Q E L K Q S L S S L C F G Y A S V V I K N W S R P S MluI AflIII BslFI | FnuDII* BseMII |MmeI HgaI | | Hpy188I |BspCNI \\ \ \ \ \ \\ ACTTCTATTGAAACACATACAACCACTACAAGCAACGCGTCTGAAAATAGCGACAATGTT 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGATAACTTTGTGTATGTTGGTGATGTTCGTTGCGCAGACTTTTATCGCTGTTACAA / / / / / / // MmeI BslFI HgaI | | Hpy188I |BspCNI | AflIII BseMII | MluI FnuDII* T S I E T H T T T T S N A S E N S D N V L L L K H I Q P L Q A T R L K I A T M F F Y * N T Y N H Y K Q R V * K * R Q C F ----:----|----:----|----:----|----:----|----:----|----:----| V E I S V C V V V V L L A D S F L S L T * K * Q F V Y L W * L C R T Q F Y R C H S R N F C M C G S C A V R R F I A V I N DdeI |Hpy188I ||MwoI MaeIII MnlI ||| CviJI Tsp45I \ \\\ \ \ TCTGCTTCTGAGGCTGTCAGTAGCAAAAGTGTCACAAATCCCGTGTTGATTAGTGTATCT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGAAGACTCCGACAGTCATCGTTTTCACAGTGTTTAGGGCACAACTAATCACATAGA / // / / / MnlI || | CviJI Tsp45I || DdeI MaeIII |Hpy188I MwoI S A S E A V S S K S V T N P V L I S V S L L L R L S V A K V S Q I P C * L V Y L C F * G C Q * Q K C H K S R V D * C I S ----:----|----:----|----:----|----:----|----:----|----:----| E A E S A T L L L L T V F G T N I L T D K Q K Q P Q * Y C F H * L D R T S * H I R S R L S D T A F T D C I G H Q N T Y R MboI XhoII | DpnI | |BstKTI | ||MaeI | ||| TatI | ||| |Csp6I | ||| ||RsaI | ||| ||BinI* | ||| ||| CviJI CviJI | ||| ||| | NmeAIII | BsiI* MnlI | ||| ||| | | MnlI \ \ \ \ \\\ \\\ \ \ \ CAACAGCCTCGTGGCACACCAGCAAGTAGTATGATAGGATCTAGTACAGCCTCTTTAGAG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCGGAGCACCGTGTGGTCGTTCATCATACTATCCTAGATCATGTCGGAGAAATCTC / / / // / / /// / / / CviJI | MnlI || | | ||| | NmeAIII MnlI BsiI* || | | ||| CviJI || | | ||TatI || | | |BinI* || | | |Csp6I || | | RsaI || | MaeI || XhoII || MboI |DpnI BstKTI Q Q P R G T P A S S M I G S S T A S L E N S L V A H Q Q V V * * D L V Q P L * R T A S W H T S K * Y D R I * Y S L F R D ----:----|----:----|----:----|----:----|----:----|----:----| * C G R P V G A L L I I P D L V A E K S E V A E H C V L L Y Y S L I * Y L R K L L L R T A C W C T T H Y S R T C G R * L AluI CviJI | SetI | | SecI* | | | SetI | | | MwoI | | | | BsrDI | | | | | MnlI TspDTI | | | | | CviRI* | TsoI BsrDI \ \ \ \ \ \ \ \ \ ATGTCAAGCTACCTCGGCATTGCAAATCATCTACTAACCAATAGTGGTATTAGTATTTTC 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTCGATGGAGCCGTAACGTTTAGTAGATGATTGGTTATCACCATAATCATAAAAG / / // // // / / / | | || || |CviRI* | TsoI BsrDI | | || || MnlI TspDTI | | || |SecI* | | || BsrDI | | |MwoI | | SetI | CviJI | AluI SetI M S S Y L G I A N H L L T N S G I S I F C Q A T S A L Q I I Y * P I V V L V F S V K L P R H C K S S T N Q * W Y * Y F H ----:----|----:----|----:----|----:----|----:----|----:----| I D L * R P M A F * R S V L L P I L I K S T L S G R C Q L D D V L W Y H Y * Y K H * A V E A N C I M * * G I T T N T N E MnlI BsiYI* | BsrI MseI \ \ \ ATTGCCTCCCTATTACTGGCAATCGTTTAA 3490 3500 3510 ----:----|----:----|----:----| TAACGGAGGGATAATGACCGTTAGCAAATT / / / / | | BsrI MseI | MnlI BsiYI* I A S L L L A I V * L P P Y Y W Q S F X C L P I T G N R L X ----:----|----:----|----:----| M A E R N S A I T * * Q R G I V P L R K N G G * * Q C D N L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 Acc65I 1 Asp718I AccI 14 FblI,XmiI AciI 6 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AjuI 1 AluI 26 AluBI AlwNI 2 CaiI ApaLI 9 Alw44I,VneI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BarI 1 BbvI 8 BseXI,BstV1I,Lsp1109I BccI 7 Bce83I* 2 BpuEI BceAI 1 BcgI 3 BciVI 2 BfuI BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmgT120I 1 BsaBI 1 Bse8I,BseJI BsaXI 7 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 11 BseRI 1 BseSI 10 BaeGI,BstSLI BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI Bsp1407I 9 BsrGI,BstAUI BspCNI 11 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 24 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstKTI 6 BtgZI 1 BtsI 1 Cac8I 4 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 22 CviQI,RsaNI CviAII 9 CviJI 46 CviKI-1 CviRI* 15 HpyCH4V DdeI 12 BstDEI,HpyF3I DpnI 6 MalI DsaI* 3 BtgI,BstDSI Eco31I 5 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 4 EcoP15I 6 EcoRI 1 EcoRII 6 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 9 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 4 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 9 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 3 HpyAV Hin6I 4 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 25 HpaII 3 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 26 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 18 Hpy99I 2 KpnI 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 19 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 22 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 19 MluI 1 MlyI 14 SchI MmeI 3 MnlI 29 MseI 9 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 9 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 10 FauNDI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NmeAIII 2 NspBII* 1 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PflMI 3 BasI,AccB7I,Van91I PleI 14 PpsI PshAI 1 BstPAI,BoxI PvuII 1 RsaI 22 AfaI SapI 5 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 12 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 48 SfaNI 5 LweI SfeI* 6 BstSFI,SfcI,BfmI SmlI 2 SmoI SphI 1 PaeI,BbuI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 6 TaqII 6 TatI 12 TauI 4 TfiI 11 PfeI TseI 9 ApeKI TsoI 3 Tsp45I 12 NmuCI Tsp4CI* 17 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 17 TscAI TstI 5 Tth111I 5 PflFI,PsyI,AspI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI AclI AflII AgeI AhaIII* AlfI AloI ApaI AscI AsuII AvaI AvrII BalI BamHI BbvCI BbvII* BclI BdaI BmeT110I BmtI BplI Bpu10I BsaAI BsePI BseYI BsgI BsmI Bsp120I BspHI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI CauII* Cfr9I CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I FauI FseI FspAI GsaI HpaI KasI MauBI McrI* MfeI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NotI NruI NsiI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769