Restriction Map of DAD2/YKR083C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DAD2/YKR083C on chromosome XI from coordinates 596822 to 596421.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16212

EMBOSS_001 Eco57I TfiI Eco57MI HinfI TspEI |TspDTI \ \ \\ ATGGATTCAATAGATGAACAAATTGCTATAAAGCGAAAAGAACTTCAGTCATTACAAAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAAGTTATCTACTTGTTTAACGATATTTCGCTTTTCTTGAAGTCAGTAATGTTTTC / / // HinfI | |TspDTI TfiI | Eco57MI | Eco57I TspEI M D S I D E Q I A I K R K E L Q S L Q K W I Q * M N K L L * S E K N F S H Y K R G F N R * T N C Y K A K R T S V I T K D ----:----|----:----|----:----|----:----|----:----|----:----| X S E I S S C I A I F R F S S * D N C F X P N L L H V F Q * L A F L V E T M V F H I * Y I F L N S Y L S F F K L * * L L TsoI | CviJI | |BseGI | ||MseI | ||| ApoI | ||| TspEI | ||| | FokI | ||| | TspGWI | ||| | | AluI MboI BccI | ||| | | CviJI | DpnI BsrI MseI | ||| | | | SetI | |BstKTI \ \ \ \\\ \ \ \ \ \ \\ ATAACCAGTTTAACGGATGGCTTAAAAATTCAGCTAACAGAGTTGAATGAGCAGATCAAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGGTCAAATTGCCTACCGAATTTTTAAGTCGATTGTCTCAACTTACTCGTCTAGTTT / // / // / / //// // / BsrI || | || | | |||CviJI || MboI || | || | | |||AluI |DpnI || | || | | ||FokI BstKTI || | || | | |SetI || | || | | TspEI || | || | | ApoI || | || | TspGWI || | || MseI || | |CviJI || | BseGI || TsoI |MseI BccI I T S L T D G L K I Q L T E L N E Q I K * P V * R M A * K F S * Q S * M S R S K N Q F N G W L K N S A N R V E * A D Q R ----:----|----:----|----:----|----:----|----:----|----:----| I V L K V S P K F I * S V S N F S C I L S L W N L P H S L F E A L L T S H A S * Y G T * R I A * F N L * C L Q I L L D F TspDTI | AsuI* | |CviJI | |HaeIII AciI | |BmgT120I | BsmI | ||TspRI TfiI | |TfiI | ||| MfeI MfeI HinfI | |HinfI | ||| TspEI TspEI | TspDTI \ \\ \ \\\ \ \ \ \ GAAATGGGAATGAATGCGGATTCAGTGGCCCAATTGATGAACAATTGGGATTCTATAATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACCCTTACTTACGCCTAAGTCACCGGGTTAACTACTTGTTAACCCTAAGATATTAT / / / // /// / / / / | | | || ||| TspEI | | HinfI | | | || ||| MfeI | | TfiI | | | || ||AsuI* | TspDTI | | | || |BmgT120I TspEI | | | || HaeIII MfeI | | | || CviJI | | | |TspDTI | | | HinfI | | | TfiI | | TspRI | AciI BsmI E M G M N A D S V A Q L M N N W D S I I K W E * M R I Q W P N * * T I G I L * * N G N E C G F S G P I D E Q L G F Y N K ----:----|----:----|----:----|----:----|----:----|----:----| S I P I F A S E T A W N I F L Q S E I I L F P F S H P N L P G I S S C N P N * L F H S H I R I * H G L Q H V I P I R Y Y CviRI* | MnlI Cac8I | | CviRI* HphI \ \ \ \ \ AACAATATATCGCAAGCAAGTTTGGGATTATTGCAATATGCAGAGGGTGATTATGAGATA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTATATAGCGTTCGTTCAAACCCTAATAACGTTATACGTCTCCCACTAATACTCTAT / / / / / Cac8I | MnlI CviRI* HphI CviRI* N N I S Q A S L G L L Q Y A E G D Y E I T I Y R K Q V W D Y C N M Q R V I M R * Q Y I A S K F G I I A I C R G * L * D R ----:----|----:----|----:----|----:----|----:----|----:----| F L I D C A L K P N N C Y A S P S * S I L C Y I A L L N P I I A I H L P H N H S V I Y R L C T Q S * Q L I C L T I I L Y AsuI* AvaII |BmgT120I || SecI* TfiI TfiI SetI || DsaI* HinfI HinfI |Hpy178III* || |Tsp4CI* | DdeI | Hpy188I || TspDTI \\ \\ \ \ \ \ \\ \ GGACCGTGGAAAGATTCTAAGAAAAAGGAATCTGAACAATCAAATGAAACAGGTCTTGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGGCACCTTTCTAAGATTCTTTTTCCTTAGACTTGTTAGTTTACTTTGTCCAGAACTT // / / / // / / || DsaI* | DdeI |Hpy188I SetI Hpy178III* || SecI* HinfI HinfI TspDTI |Tsp4CI* TfiI TfiI |AvaII |AsuI* BmgT120I G P W K D S K K K E S E Q S N E T G L E D R G K I L R K R N L N N Q M K Q V L K T V E R F * E K G I * T I K * N R S * S ----:----|----:----|----:----|----:----|----:----|----:----| P G H F S E L F F S D S C D F S V P R S L V T S L N * S F P I Q V I L H F L D Q S R P F I R L F L F R F L * I F C T K F BarI | MboII | |TspDTI | || BsaBI | || |MboI | || |BglII | || |XhoII | || |BseGI | || || DpnI | || || |BstKTI | || || || Acc65I | || || || HgiCI* | || || || |FokI | || || || |Csp6I | || || || ||RsaI | || || || ||NlaIV Hin6I | || || || ||| KpnI |GlaI | || || || ||| MboII ||HhaI MnlI | || || || ||| |TspDTI \\\ \ \ \\ \\ \\ \\\ \\ GCGCAAGAAAATGATAAGAATGATGAAGATAATGATGAGGATGAAGATCTGGTACCCTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTTCTTTTACTATTCTTACTACTTCTATTACTACTCCTACTTCTAGACCATGGGAAC /// // / // // / / //// ||Hin6I |BarI TspDTI || || | | |||FokI |GlaI MnlI MboII || || | | ||HgiCI* HhaI || || | | ||Acc65I || || | | |TspDTI || || | | |MboII || || | | |Csp6I || || | | NlaIV || || | | RsaI || || | KpnI || || XhoII || || BglII || || MboI || |DpnI || BstKTI |BsaBI BseGI A Q E N D K N D E D N D E D E D L V P L R K K M I R M M K I M M R M K I W Y P C A R K * * E * * R * * * G * R S G T L A ----:----|----:----|----:----|----:----|----:----|----:----| A C S F S L F S S S L S S S S S R T G K L A L F H Y S H H L Y H H P H L D P V R R L F I I L I I F I I I L I F I Q Y G Q Hpy188I |TspEI HpaII BarI || BccI MaeIII \ \ \\ \ \ CCGGAAACAATGGTCAGAATTAGGGTAGATGGTAACGAATGA 370 380 390 400 ----:----|----:----|----:----|----:----|-- GGCCTTTGTTACCAGTCTTAATCCCATCTACCATTGCTTACT // / / / / |HpaII | | BccI MaeIII BarI | TspEI Hpy188I P E T M V R I R V D G N E * R K Q W S E L G * M V T N X G N N G Q N * G R W * R M X ----:----|----:----|----:----|----:----|-- G S V I T L I L T S P L S H A P F L P * F * P L H Y R I R F C H D S N P Y I T V F S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 1 BspACI,SsiI AluI 1 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BccI 2 BglII 1 BmgT120I 2 BsaBI 1 Bse8I,BseJI BseGI 2 BstF5I,BtsCI BsmI 1 BsaMI,Mva1269I,PctI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 Cac8I 1 BstC8I Csp6I 1 CviQI,RsaNI CviJI 3 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 FokI 2 GlaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HinfI 5 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy178III* 1 Hpy188III Hpy188I 2 KpnI 1 MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 2 MunI MnlI 2 MseI 2 Tru1I,Tru9I NlaIV 1 BspLI,BmiI,PspN4I RsaI 1 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 2 TfiI 5 PfeI TsoI 1 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* Hin4I Hin4II* HindII HindIII HpaI Hpy166II Hpy8I Hpy99I KasI Ksp632I* MaeI MaeII MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TseI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769