Restriction Map of NUP133/YKR082W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

NUP133/YKR082W on chromosome XI from coordinates 592825 to 596298.


Csp6I |RsaI MboII || BsrDI | TatI Hin4II* || | AciI | |Csp6I | PsrI FalI || | MslI FalI | ||RsaI | |AciI | DdeI || | | BstXI \ \ \\\ \ \\ \ \ \\ \ \ \ ATGAGTGAAAAAAAAGTACATCTTCGTTTGCGGAAGGAACTTAGCGTACCCATTGCGGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCACTTTTTTTTCATGTAGAAGCAAACGCCTTCCTTGAATCGCATGGGTAACGCCAC / /// / / / / // / /// | ||TatI | | FalI | || | ||AciI | |Csp6I | | AciI | || | |PsrI | RsaI | Hin4II* | || | MslI MboII PsrI | || BstXI | |Csp6I | |BsrDI | RsaI DdeI M S E K K V H L R L R K E L S V P I A V * V K K K Y I F V C G R N L A Y P L R W E * K K S T S S F A E G T * R T H C G G ----:----|----:----|----:----|----:----|----:----|----:----| X L S F F T C R R K R F S S L T G M A T X S H F F L V D E N A S P V * R V W Q P H T F F F Y M K T Q P L F K A Y G N R H TfiI BssKI HinfI CviJI | BssKI EcoRII | SecI* | ScrFI | EcoRII | BseBI | | ScrFI | MboII | | BseBI | |TspDTI | | | Hin6I | || StuI | | | |GlaI Ksp632I* | || CviJI PsrI | | | ||HhaI |MnlI | || HaeIII MnlI \ \ \ \ \\\ \\ \ \\ \ \ GTTGAAAACGAATCCCTGGCGCAGTTGTCTTATGAAGAGGAAAGCCAGGCCTCTCTAATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTTTGCTTAGGGACCGCGTCAACAGAATACTTCTCCTTTCGGTCCGGAGAGATTAC / ///// / / // / / / | ||||Hin6I | Ksp632I* || | EcoRII MnlI | |||GlaI MnlI || | HaeIII | ||EcoRII || | BssKI | ||BssKI || | CviJI | ||HhaI || | StuI | |SecI* || BseBI | BseBI || ScrFI | ScrFI |TspDTI HinfI |MboII TfiI CviJI V E N E S L A Q L S Y E E E S Q A S L M L K T N P W R S C L M K R K A R P L * W * K R I P G A V V L * R G K P G L S N G ----:----|----:----|----:----|----:----|----:----|----:----| T S F S D R A C N D * S S S L W A E R I P Q F R I G P A T T K H L P F G P R E L N F V F G Q R L Q R I F L F A L G R * H MslI |FatI |NcoI |StyI |SecI* |DsaI* ||CviAII Tsp4CI* ||| NlaIII | MseI ||| | TseI | | BbvI TspEI ||| | |BisI | | | MaeIII | StyI ||| | ||BlsI | | | | SetI | SecI* SetI \\\ \ \\\ \ \ \ \ \ \ \ \ GACATTTCCATGGAGCAGCAACAGTTAAGGTTACATTCGCACTTTGATAATTCCAAGGTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAAAGGTACCTCGTCGTTGTCAATTCCAATGTAAGCGTGAAACTATTAAGGTTCCAA // // /// / / / / / / / || || ||| | | | MaeIII | | SecI* || || ||| | | BbvI | | StyI || || ||| | MseI | SetI || || ||| | SetI TspEI || || ||| Tsp4CI* || || ||TseI || || |BisI || || BlsI || |DsaI* || |SecI* || |StyI || |NcoI || |FatI || CviAII |NlaIII MslI D I S M E Q Q Q L R L H S H F D N S K V T F P W S S N S * G Y I R T L I I P R F H F H G A A T V K V T F A L * * F Q G F ----:----|----:----|----:----|----:----|----:----|----:----| S M E M S C C C N L N C E C K S L E L T P C K W P A A V T L T V N A S Q Y N W P V N G H L L L L * P * M R V K I I G L N Hin4II* | SfeI* | | BarI | | Tsp4CI* | | | AciI | | | | TfiI BarI | | | | HinfI \ \ \ \ \ \ TTCACAGAAAATAACAGATACATAGTAAAAACCCTTCAAACAGACTACAGTAGCGGATTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGTCTTTTATTGTCTATGTATCATTTTTGGGAAGTTTGTCTGATGTCATCGCCTAAG / / / // / / BarI | | |SfeI* | HinfI | | | | TfiI | | | AciI | | Tsp4CI* | BarI Hin4II* F T E N N R Y I V K T L Q T D Y S S G F S Q K I T D T * * K P F K Q T T V A D S H R K * Q I H S K N P S N R L Q * R I Q ----:----|----:----|----:----|----:----|----:----|----:----| K V S F L L Y M T F V R * V S * L L P N K * L F Y C I C L L F G E F L S C Y R I E C F I V S V Y Y F G K L C V V T A S E TaqI CviRI* SpeI MaeIII TspEI ClaI | TspEI |MaeI \ \ \ \ \ \\ AGTAACGATGACGAATTGAATGGATATATCGATATGCAAATTGGATATGGACTAGTCAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTGCTACTGCTTAACTTACCTATATAGCTATACGTTTAACCTATACCTGATCAGTTA / / / / / // MaeIII TspEI ClaI | TspEI |SpeI TaqI CviRI* MaeI S N D D E L N G Y I D M Q I G Y G L V N V T M T N * M D I S I C K L D M D * S M * R * R I E W I Y R Y A N W I W T S Q * ----:----|----:----|----:----|----:----|----:----|----:----| L L S S S N F P Y I S I C I P Y P S T L * Y R H R I S H I Y R Y A F Q I H V L * T V I V F Q I S I D I H L N S I S * D I Hin4II* | BsiYI* | | SetI | | |Hpy166II | | || Hpy178III* | | || | SspI BciVI \ \ \\ \ \ \ GACCACAAGAAGGTTTACATCTGGAATATTCACTCCACTCAAAAGGATACGCCCTATATA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTGTTCTTCCAAATGTAGACCTTATAAGTGAGGTGAGTTTTCCTATGCGGGATATAT / / / / / / / | | SetI | | SspI BciVI | BsiYI* | Hpy178III* Hin4II* Hpy166II D H K K V Y I W N I H S T Q K D T P Y I T T R R F T S G I F T P L K R I R P I * P Q E G L H L E Y S L H S K G Y A L Y N ----:----|----:----|----:----|----:----|----:----|----:----| S W L F T * M Q F I * E V * F S V G * I H G C S P K C R S Y E S W E F P Y A R Y V V L L N V D P I N V G S L L I R G I Y Hin6I FnuDII* |GlaI |TspDTI ||HhaI |||BssKI |||SecI* |||EcoRII |||| ScrFI Tsp4CI* |||| BseBI |Csp6I |||| | SetI ||RsaI Hpy188I |||| | |CviRI* \\\ \ \\\\ \ \\ ACTGTACCATTTCGTTCTGATGATAATGATGAAATAGCAGTCGCGCCCAGGTGCATACTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGACATGGTAAAGCAAGACTACTATTACTACTTTATCGTCAGCGCGGGTCCACGTATGAT / // / //// //// / | |Csp6I Hpy188I |||| |||| CviRI* | RsaI |||| |||EcoRII Tsp4CI* |||| |||BssKI |||| ||SecI* |||| |BseBI |||| |ScrFI |||| SetI |||Hin6I ||GlaI |FnuDII* |HhaI TspDTI T V P F R S D D N D E I A V A P R C I L L Y H F V L M I M M K * Q S R P G A Y * C T I S F * * * * * N S S R A Q V H T N ----:----|----:----|----:----|----:----|----:----|----:----| V T G N R E S S L S S I A T A G L H M S L Q V M E N Q H Y H H F L L R A W T C V S Y W K T R I I I I F Y C D R G P A Y * MboI HinfI BclI | BseGI | DpnI | | BsmAI | |BstKTI | | |PleI TfiI | ||Hpy178III* | | ||MlyI HinfI | ||| Hin4I | | ||FokI | TspRI | ||| | MnlI \ \ \\\ \ \ \ \\\ \ \ ACTTTCCCTGCTACAATGGATGAGTCTCCATTAGCACTGAATCCTAATGATCAGGACGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAGGGACGATGTTACCTACTCAGAGGTAATCGTGACTTAGGATTACTAGTCCTGCTT / / /// / / //// / / | HinfI ||| FokI HinfI |||| | MnlI BseGI ||BsmAI TfiI |||| Hpy178III* |TspRI |||BclI PleI |||MboI MlyI ||Hin4I |DpnI BstKTI T F P A T M D E S P L A L N P N D Q D E L S L L Q W M S L H * H * I L M I R T K F P C Y N G * V S I S T E S * * S G R N ----:----|----:----|----:----|----:----|----:----|----:----| V K G A V I S S D G N A S F G L S * S S L K G Q * L P H T E M L V S D * H D P R S E R S C H I L R W * C Q I R I I L V F BetI* SetI MnlI |HpaII CviJI |Hin4I |Hin4I EcoRV \\ \ \\ \\ \ ACCGGAGGGCTTATCATTATCAAAGGTAGCAAAGCGATATATTATGAGGATATCAACTCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCTCCCGAATAGTAATAGTTTCCATCGTTTCGCTATATAATACTCCTATAGTTGAGG // / / / / / || CviJI Hin4I | MnlI EcoRV |BetI* SetI Hin4I HpaII T G G L I I I K G S K A I Y Y E D I N S P E G L S L S K V A K R Y I M R I S T P R R A Y H Y Q R * Q S D I L * G Y Q L H ----:----|----:----|----:----|----:----|----:----|----:----| V P P S I M I L P L L A I Y * S S I L E F R L A * * * * L Y C L S I N H P Y * S G S P K D N D F T A F R Y I I L I D V G Hpy188I BsiI* Hin4I | ApoI Hpy178III* TspEI | MseI | TspEI | TspEI MboII \ \ \ \ \ \ \ \ ATAAATAATTTGAACTTTAAGTTATCTGAAAAATTCTCTCACGAGTTAGAATTACCCATC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTATTAAACTTGAAATTCAATAGACTTTTTAAGAGAGTGCTCAATCTTAATGGGTAG / / / / / / / / / | TspEI MseI Hpy188I TspEI | BsiI* | MboII Hin4I ApoI Hpy178III* TspEI I N N L N F K L S E K F S H E L E L P I * I I * T L S Y L K N S L T S * N Y P S K * F E L * V I * K I L S R V R I T H Q ----:----|----:----|----:----|----:----|----:----|----:----| M F L K F K L N D S F N E * S N S N G M W L Y N S S * T I Q F I R E R T L I V W Y I I Q V K L * R F F E R V L * F * G D EcoP15I | MaeIII | Tsp45I Ksp632I* | | EciI BccI | AciI | | | SetI MseI SetI BspMI \ \ \ \ \ \ \ \ \ \ AACTCTTCGGGCGGAGAGAAGTGTGACCTAATGTTAAACTGCGAACCTGCTGGTATAGTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGAAGCCCGCCTCTCTTCACACTGGATTACAATTTGACGCTTGGACGACCATATCAC / // / // / / / / BccI |AciI | || Tsp45I MseI SetI BspMI Ksp632I* | || MaeIII | |SetI | EciI EcoP15I N S S G G E K C D L M L N C E P A G I V T L R A E R S V T * C * T A N L L V * C L F G R R E V * P N V K L R T C W Y S A ----:----|----:----|----:----|----:----|----:----|----:----| L E E P P S F H S R I N F Q S G A P I T * S K P R L S T H G L T L S R V Q Q Y L V R R A S L L T V * H * V A F R S T Y H ApoI TspEI | FatI | NcoI | StyI | SecI* | DsaI* | |TsoI | |CviAII | || NlaIII | || | Hpy166II SspI PsiI | || | | SetI \ \ \ \\ \ \ \ CTTTCTACAAATATGGGCAGAATATTTTTTATAACCATTAGAAATTCCATGGGTAAACCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGATGTTTATACCCGTCTTATAAAAAATATTGGTAATCTTTAAGGTACCCATTTGGA / / // // // SspI PsiI || || |SetI || || Hpy166II || |DsaI* || |SecI* || |StyI || |NcoI || |FatI || CviAII |NlaIII TspEI TsoI ApoI L S T N M G R I F F I T I R N S M G K P F L Q I W A E Y F L * P L E I P W V N L F Y K Y G Q N I F Y N H * K F H G * T S ----:----|----:----|----:----|----:----|----:----|----:----| S E V F I P L I N K I V M L F E M P L G A K * L Y P C F I K * L W * F N W P Y V K R C I H A S Y K K Y G N S I G H T F R AsuI* AvaII MseI |BmgT120I | Eco57I SetI || ApoI MnlI | Eco57MI | TspEI || TspEI \ \ \ \ \ \\ \ CAACTGAAGTTAGGCAAACTATTAAATAAACCTTTCAAATTGGGTATCTGGTCCAAAATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACTTCAATCCGTTTGATAATTTATTTGGAAAGTTTAACCCATAGACCAGGTTTTAA / // / / // / MnlI |MseI SetI TspEI |AvaII TspEI Eco57MI |AsuI* ApoI Eco57I BmgT120I Q L K L G K L L N K P F K L G I W S K I N * S * A N Y * I N L S N W V S G P K F T E V R Q T I K * T F Q I G Y L V Q N F ----:----|----:----|----:----|----:----|----:----|----:----| * S F N P L S N F L G K L N P I Q D L I E V S T L C V I L Y V K * I P Y R T W F L Q L * A F * * I F R E F Q T D P G F N AsuI* AvaII |BmgT120I || SetI || | SecI* || | |BsiYI* || | || EcoNI BsmAI || | || | BsiYI* Tsp4CI* | Hin4I || | || | | MnlI \ \ \ \\ \ \\ \ \ \ TTCAATACAAACAGTTCAGTTGTCTCATTACGAAATGGACCTATCCTCGGTAAGGGGACA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTATGTTTGTCAAGTCAACAGAGTAATGCTTTACCTGGATAGGAGCCATTCCCCTGT / / / /// / /// / / / Tsp4CI* Hin4I BsmAI ||| | ||| | | SetI ||| | ||| | Hin4I ||| | ||| MnlI ||| | ||EcoNI ||| | |SecI* ||| | BsiYI* ||| BsiYI* ||AvaII ||AsuI* |BmgT120I SetI F N T N S S V V S L R N G P I L G K G T S I Q T V Q L S H Y E M D L S S V R G Q Q Y K Q F S C L I T K W T Y P R * G D K ----:----|----:----|----:----|----:----|----:----|----:----| K L V F L E T T E N R F P G I R P L P V K * Y L C N L Q R M V F H V * G R Y P S E I C V T * N D * * S I S R D E T L P C ApoI TspEI FatI ApoI Hin4I | AlfI |CviAII TspEI | SetI BslFI | AlfI || NlaIII FokI EcoRI \ \ \ \ \ \\ \ \ \ AGGTTAGTATATATTACTACTAACAAAGGAATTTTTCAAACATGGCAGTTGTCTGCCACG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAATCATATATAATGATGATTGTTTCCTTAAAAAGTTTGTACCGTCAACAGACGGTGC / // / // / BslFI |TspEI | |FatI FokI |ApoI | CviAII AlfI NlaIII AlfI R L V Y I T T N K G I F Q T W Q L S A T G * Y I L L L T K E F F K H G S C L P R V S I Y Y Y * Q R N F S N M A V V C H E ----:----|----:----|----:----|----:----|----:----|----:----| L N T Y I V V L L P I K * V H C N D A V L T L I Y * * * C L F K E F M A T T Q W P * Y I N S S V F S N K L C P L Q R G R PfoI BseGI GsuI BssKI | AlfI BccI Hpy166II CviJI EcoRII | AlfI | TspEI | MmeI Eco57MI HinfI |PleI \ \ \ \ \ \ \ \ \\ AATTCCCATCCAACAAAATTGATTGATGTAAACATTTACGAAGCCATTTTAGAGTCGCTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGGTAGGTTGTTTTAACTAACTACATTTGTAAATGCTTCGGTAAAATCTCAGCGAG / / / / / / / / / | AlfI BccI TspEI | MmeI | CviJI HinfI | AlfI Hpy166II Eco57MI EcoRI GsuI TspEI BseGI ApoI N S H P T K L I D V N I Y E A I L E S L I P I Q Q N * L M * T F T K P F * S R S F P S N K I D * C K H L R S H F R V A P ----:----|----:----|----:----|----:----|----:----|----:----| F E W G V F N I S T F M * S A M K S D S S N G D L L I S Q H L C K R L W K L T A I G M W C F Q N I Y V N V F G N * L R E BciVI |FatI ||CviAII ||| NlaIII ||| |Csp6I ||| ||RsaI ||| |||MaeII ||| |||| SetI ||| |||| TaiI MlyI ||| |||| | FokI HinfI ScrFI ||| |||| | | MlyI | MboII BseBI BsaBI ||| |||| | | PleI | | BseGI BslFI \ \ \\\ \\\\ \ \ \ \ \ \ \ CAGGATTTGTATCCATTTGCTCATGGTACGTTGAAGATTTGGGACTCTCATCCATTACAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTAAACATAGGTAAACGAGTACCATGCAACTTCTAAACCCTGAGAGTAGGTAATGTT // / / / / // // / /// / / / / || | BsaBI | | || || MaeII ||FokI | HinfI | BslFI || EcoRII | | || |Csp6I |PleI | BseGI TstI || BssKI | | || RsaI MlyI MboII || PfoI | | || TaiI |BseBI | | || SetI |ScrFI | | |FatI PleI | | CviAII MlyI | NlaIII BciVI Q D L Y P F A H G T L K I W D S H P L Q R I C I H L L M V R * R F G T L I H Y K G F V S I C S W Y V E D L G L S S I T R ----:----|----:----|----:----|----:----|----:----|----:----| W S K Y G N A * P V N F I Q S E * G N C G P N T D M Q E H Y T S S K P S E D M V L I Q I W K S M T R Q L N P V R M W * L Tsp4CI* | FatI | |CviAII Hpy166II TspDTI | || CviRI* TstI | TspDTI | TstI | || NlaIII BsrDI \ \ \ \ \ \ \\ \ \ GATGAAAGTTCACAACTTTTCCTGTCATCTATTTACGACAGTTCATGCAATGAAACATAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTCAAGTGTTGAAAAGGACAGTAGATAAATGCTGTCAAGTACGTTACTTTGTATA / / // / / // / | TspDTI |TspDTI | | || BsrDI Hpy166II TstI | | |CviRI* | | |FatI | | CviAII | NlaIII Tsp4CI* D E S S Q L F L S S I Y D S S C N E T Y M K V H N F S C H L F T T V H A M K H I * K F T T F P V I Y L R Q F M Q * N I L ----:----|----:----|----:----|----:----|----:----|----:----| S S L E C S K R D D I * S L E H L S V Y L H F N V V K G T M * K R C N M C H F M I F T * L K E Q * R N V V T * A I F C I MboII | TaqI | MboII | | TfiI TspDTI MboII | | HinfI \ \ \ \ \ TATATTCTTTCCACGATTATCTTCGATTCTTCTTCTAATAGTTTTACTATTTTTTCCACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAAGAAAGGTGCTAATAGAAGCTAAGAAGAAGATTATCAAAATGATAAAAAAGGTGA / / / / / / TspDTI MboII | | | HinfI | | | TfiI | | TaqI | MboII MboII Y I L S T I I F D S S S N S F T I F S T I F F P R L S S I L L L I V L L F F P L Y S F H D Y L R F F F * * F Y Y F F H L ----:----|----:----|----:----|----:----|----:----|----:----| * I R E V I I K S E E E L L K V I K E V N Y E K W S * R R N K K * Y N * * K K W I N K G R N D E I R R R I T K S N K G S MseI PleI | CviJI MslI HinfI |MlyI | | DdeI \ \ \\ \ \ \ TATAGATTGAACACTTTTATGGAGTCAATAACCGACACAAAGTTTAAGCCTAAGATATTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATATCTAACTTGTGAAAATACCTCAGTTATTGGCTGTGTTTCAAATTCGGATTCTATAAA / / / / / / MslI HinfI PleI | | DdeI MlyI | CviJI MseI Y R L N T F M E S I T D T K F K P K I F I D * T L L W S Q * P T Q S L S L R Y L * I E H F Y G V N N R H K V * A * D I Y ----:----|----:----|----:----|----:----|----:----|----:----| * L N F V K I S D I V S V F N L G L I N K Y I S C K * P T L L R C L T * A * S I I S Q V S K H L * Y G V C L K L R L Y K BccI | DdeI | |SetI | || Hpy188I | || | MnlI | || | | BspCNI | || | | |BseMII MaeIII | || | | || BsmI MnlI | SetI \ \\ \ \ \\ \ \ \ \ ATACCTCAGATGGAGAATGCTAACGATACCAATGAGGTAACTTCCATTTTGGTAATGTTC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGAGTCTACCTCTTACGATTGCTATGGTTACTCCATTGAAGGTAAAACCATTACAAG / / // / // / / / / | | |DdeI | || BsmI MnlI SetI MaeIII | | | | |BseMII | | | | BspCNI | | | MnlI | | Hpy188I | BccI SetI I P Q M E N A N D T N E V T S I L V M F Y L R W R M L T I P M R * L P F W * C S T S D G E C * R Y Q * G N F H F G N V P ----:----|----:----|----:----|----:----|----:----|----:----| I G * I S F A L S V L S T V E M K T I N * V E S P S H * R Y W H P L K W K P L T Y R L H L I S V I G I L Y S G N Q Y H E SetI |Hpy166II || BspCNI || |MlyI || |PleI || |TspEI || |BseMII || || HphI || || | HinfI || || | | MaeI || || | | | AluI || || | | | CviJI AjuI || || | | | | SetI |DdeI || || | | | | | AjuI \\ \\ \\ \ \ \ \ \ \ CCCAATGCTGTTGTCATTACTCAGGTGAACTCAAAATTGGACTCTAGCTATTCAATGAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTACGACAACAGTAATGAGTCCACTTGAGTTTTAACCTGAGATCGATAAGTTACTCT / // / // // / / /// AjuI || | || || | | ||CviJI || | || || | | ||AluI || | || || | | |AjuI || | || || | | |MaeI || | || || | | SetI || | || || | HinfI || | || || TspEI || | || |HphI || | || |PleI || | || MlyI || | |BseMII || | BspCNI || Hpy166II |DdeI SetI P N A V V I T Q V N S K L D S S Y S M R P M L L S L L R * T Q N W T L A I Q * E Q C C C H Y S G E L K I G L * L F N E K ----:----|----:----|----:----|----:----|----:----|----:----| G L A T T M V * T F E F N S E L * E I L G W H Q Q * * E P S S L I P S * S N L S G I S N D N S L H V * F Q V R A I * H S Hin4I Hin4I MboII | MlyI |CviJI TsoI | PleI MboII || DdeI TspEI | MaeIII \ \\ \ \ \ \ AGAAAGTGGGAAGATATTGTTAGCCTTAGAAATGACATTGATATAATTGGTTCTGGTTAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCACCCTTCTATAACAATCGGAATCTTTACTGTAACTATATTAACCAAGACCAATG / / / / / // // / MboII | | DdeI TsoI |TspEI || MaeIII | CviJI Hin4I |PleI MboII Hin4I MlyI R K W E D I V S L R N D I D I I G S G Y E S G K I L L A L E M T L I * L V L V T K V G R Y C * P * K * H * Y N W F W L R ----:----|----:----|----:----|----:----|----:----|----:----| L F H S S I T L R L F S M S I I P E P * F F T P L Y Q * G * F H C Q Y L Q N Q N S L P F I N N A K S I V N I Y N T R T V MseI | Hin4I SfeI* HinfI | Hin4I | Tsp4CI* MnlI \ \ \ \ \ \ GACTCAAAATCTTTGTATGTTTTAACGAAACAAATGGGGGTGCTACAGTTTTTTGTGAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTTTTAGAAACATACAAAATTGCTTTGTTTACCCCCACGATGTCAAAAAACACTTT / / / // / HinfI | MseI |SfeI* MnlI Hin4I Tsp4CI* Hin4I D S K S L Y V L T K Q M G V L Q F F V K T Q N L C M F * R N K W G C Y S F L * K L K I F V C F N E T N G G A T V F C E R ----:----|----:----|----:----|----:----|----:----|----:----| S E F D K Y T K V F C I P T S C N K T F R S L I K T H K L S V F P P A V T K Q S V * F R Q I N * R F L H P H * L K K H F FatI |CviAII || NlaIII || | MboI || | BclI ApoI BetI* || | | DpnI TspEI |HpaII BsiYI* || | | |BstKTI \ \\ \ \\ \ \ \\ GAGAATGAGGAAACAAATTCTAAACCGGAAGTTGGGTTTGTCAAATCTCATGTTGATCAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTACTCCTTTGTTTAAGATTTGGCCTTCAACCCAAACAGTTTAGAGTACAACTAGTT / // / // // // TspEI |BsiYI* | || || |SetI ApoI |BetI* | || || BclI HpaII | || || MboI | || |DpnI | || BstKTI | |FatI | CviAII NlaIII E N E E T N S K P E V G F V K S H V D Q R M R K Q I L N R K L G L S N L M L I K E * G N K F * T G S W V C Q I S C * S S ----:----|----:----|----:----|----:----|----:----|----:----| S F S S V F E L G S T P N T L D * T S * L S H P F L N * V P L Q T Q * I E H Q D L I L F C I R F R F N P K D F R M N I L SetI |Hpy178III* || ApoI || TspEI AluI GsuI || | Hin4I CviJI Eco57MI || | Hin4I | SetI CviRI* | TspEI || | |MnlI \ \ \ \ \ \\ \ \\ GCTGTTTATTTCTCCAAAATAAATGCAAATCCCATAGATTTCAATTTACCTCCAGAAATT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAAATAAAGAGGTTTTATTTACGTTTAGGGTATCTAAAGTTAAATGGAGGTCTTTAA / / / // // / / CviJI CviRI* Eco57MI |SetI || | TspEI AluI GsuI TspEI || | ApoI || MnlI |Hpy178III* Hin4I Hin4I A V Y F S K I N A N P I D F N L P P E I L F I S P K * M Q I P * I S I Y L Q K F C L F L Q N K C K S H R F Q F T S R N F ----:----|----:----|----:----|----:----|----:----|----:----| A T * K E L I F A F G M S K L K G G S I L Q K N R W F L H L D W L N * N V E L F S N I E G F Y I C I G Y I E I * R W F N FatI |CviAII MaeI || NlaIII | MboI || | Hin4I | | DpnI || | Hin4I | | |BstKTI || | |MseI | | ||Hpy178III* || | ||AhaIII* | | ||| TfiI || | ||| TspEI | | ||| HinfI || | ||| | MseI | | ||| | SfeI* || | ||| | | MnlI TspDTI TsoI \ \ \\\ \ \ \\ \ \\\ \ \ \ \ \ TCACTAGATCAAGAATCTATAGAGCATGATTTAAAATTAACCAGCGAGGAGATTTTTCAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGATCTAGTTCTTAGATATCTCGTACTAAATTTTAATTGGTCGCTCCTCTAAAAAGTA /// / / / / // // // // / / / ||| | | | | || || |MseI |MseI TspDTI TsoI BseRI ||| | | | | || || | TspEI ||| | | | | || || | MnlI ||| | | | | || || AhaIII* ||| | | | | || |FatI ||| | | | | || CviAII ||| | | | | |Hin4I ||| | | | | |Hin4I ||| | | | | NlaIII ||| | | | SfeI* ||| | | HinfI ||| | | TfiI ||| | Hpy178III* ||| MboI ||DpnI |BstKTI MaeI S L D Q E S I E H D L K L T S E E I F H H * I K N L * S M I * N * P A R R F F I T R S R I Y R A * F K I N Q R G D F S F ----:----|----:----|----:----|----:----|----:----|----:----| E S S * S D I S C S K F N V L S S I K * K V L D L I * L A H N L I L W R P S K E * * I L F R Y L M I * F * G A L L N K M TatI MaeII |Csp6I BceAI | SetI BseRI ||RsaI | MmeI | TaiI TspGWI \ \\\ \ \ \ \ \ TCCAACGGCAAGTACATACCCCCTATGCTAAATACGTTGGGGCAACATCTCTCTGTCCGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGCCGTTCATGTATGGGGGATACGATTTATGCAACCCCGTTGTAGAGAGACAGGCA /// // / / / ||TatI |MmeI | MaeII TspGWI |Csp6I BceAI TaiI RsaI SetI S N G K Y I P P M L N T L G Q H L S V R P T A S T Y P L C * I R W G N I S L S V Q R Q V H T P Y A K Y V G A T S L C P * ----:----|----:----|----:----|----:----|----:----|----:----| E L P L Y M G G I S F V N P C C R E T R N W R C T C V G * A L Y T P A V D R Q G G V A L V Y G R H * I R Q P L M E R D T ApoI TspEI ApoI | XmnI TspEI Hpy178III* DdeI HphI \ \ \ \ \ \ AAAGAATTTTTTCAAAATTTCCTGACATTTGTTGCTAAGAACTTCAACTATAAAATATCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTAAAAAAGTTTTAAAGGACTGTAAACAACGATTCTTGAAGTTGATATTTTATAGT / / / / / TspEI | Hpy178III* DdeI HphI XmnI TspEI ApoI ApoI K E F F Q N F L T F V A K N F N Y K I S K N F F K I S * H L L L R T S T I K Y H R I F S K F P D I C C * E L Q L * N I T ----:----|----:----|----:----|----:----|----:----|----:----| L S N K * F K R V N T A L F K L * L I D Y L I K E F N G S M Q Q * S S * S Y F I F F K K L I E Q C K N S L V E V I F Y * TspEI | MboI | XhoII | | DpnI | | |BstKTI | | || MboI | | || Hpy188I MboI | | || | DpnI BglII | | || | |TaqI XhoII | | || | |BinI* | DpnI | | || | |BstKTI | |BstKTI | | || | || ApoI | ||Hpy178III* | | || | || TspEI | ||| TspEI MseI \ \ \\ \ \\ \ \ \\\ \ \ CCCGAACTGAAATTGGATCTGATCGAAAAATTTGAGATCTTGAATTGCTGTATTAAGTTC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCTTGACTTTAACCTAGACTAGCTTTTTAAACTCTAGAACTTAACGACATAATTCAAG / // / // // / // / / / / | || | || |TaqI | || | | TspEI MseI | || | || BinI* | || | Hpy178III* | || | || MboI | || XhoII | || | |DpnI | || BglII | || | BstKTI | || MboI | || Hpy188I | |DpnI | || XhoII | BstKTI | || MboI TspEI | |DpnI ApoI | BstKTI TspEI P E L K L D L I E K F E I L N C C I K F P N * N W I * S K N L R S * I A V L S S R T E I G S D R K I * D L E L L Y * V Q ----:----|----:----|----:----|----:----|----:----|----:----| G S S F N S R I S F N S I K F Q Q I L N V R V S I P D S R F I Q S R S N S Y * T G F Q F Q I Q D F F K L D Q I A T N L E BbvII* Hpy188I Hpy188I | MboII \ \ \ \ AATAGTATCATCAGACAATCTGATGTATTGAACGATATATGGGAGAAGACTTTATCAAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCATAGTAGTCTGTTAGACTACATAACTTGCTATATACCCTCTTCTGAAATAGTTTG / / / Hpy188I Hpy188I BbvII* MboII N S I I R Q S D V L N D I W E K T L S N I V S S D N L M Y * T I Y G R R L Y Q T * Y H Q T I * C I E R Y M G E D F I K L ----:----|----:----|----:----|----:----|----:----|----:----| L L I M L C D S T N F S I H S F V K D F * Y Y * * V I Q H I S R Y I P S S K I L I T D D S L R I Y Q V I Y P L L S * * V TspDTI Tsp4CI* | BslFI | Hpy178III* Hpy188I MseI | |Tsp4CI* | | MaeII \ \ \ \\ \ \ \ TATAATCTGACACAAAATGAACACTTAACTACTAAAACAGTTGTAATCAACAGTCCCGAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTAGACTGTGTTTTACTTGTGAATTGATGATTTTGTCAACATTAGTTGTCAGGGCTG / / / / / / /// Hpy188I | TspDTI | BslFI | ||TaiI MseI Tsp4CI* | ||SetI | |Hpy178III* | Hpy99I Tsp4CI* Y N L T Q N E H L T T K T V V I N S P D I I * H K M N T * L L K Q L * S T V P T * S D T K * T L N Y * N S C N Q Q S R R ----:----|----:----|----:----|----:----|----:----|----:----| * L R V C F S C K V V L V T T I L L G S S Y D S V F H V S L * * F L Q L * C D R I I Q C L I F V * S S F C N Y D V T G V MseI |AhaIII* Hpy99I MseI || FatI |SetI |AhaIII* || |CviAII |TaiI BsrI || TspEI || || NlaIII \\ \ \\ \ \\ \\ \ GTATTTCCAGTAATCTTTAAACAATTTTTAAACCATGTTGTGTTTGTTTTGTTCCCATCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CATAAAGGTCATTAGAAATTTGTTAAAAATTTGGTACAACACAAACAAAACAAGGGTAGT / / // / // / // | BsrI |MseI | || | |FatI MaeII AhaIII* | || | CviAII | || NlaIII | |MseI | AhaIII* TspEI V F P V I F K Q F L N H V V F V L F P S Y F Q * S L N N F * T M L C L F C S H H I S S N L * T I F K P C C V C F V P I T ----:----|----:----|----:----|----:----|----:----|----:----| T N G T I K L C N K F W T T N T K N G D R I E L L R * V I K L G H Q T Q K T G M Y K W Y D K F L K * V M N H K N Q E W * MaeIII ApoI ApoI | TspEI TspEI BccI TspEI | | MseI BccI EcoRI \ \ \ \ \ \ \ CAAAATCAAAATTTCAAACTAAATGTTACCAATTTAATCAACTTATGCTTTTATGATGGA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTAGTTTTAAAGTTTGATTTACAATGGTTAAATTAGTTGAATACGAAAATACTACCT / / / / / / BccI TspEI | | MseI BccI ApoI | TspEI MaeIII Q N Q N F K L N V T N L I N L C F Y D G K I K I S N * M L P I * S T Y A F M M E K S K F Q T K C Y Q F N Q L M L L * W N ----:----|----:----|----:----|----:----|----:----|----:----| C F * F K L S F T V L K I L K H K * S P V F D F N * V L H * W N L * S I S K H H L I L I E F * I N G I * D V * A K I I S TspDTI |BccI || MnlI Hin4II* SetI || | FokI Hpy178III* | MboII HphI SetI || | | BsiYI* \ \ \ \ \ \\ \ \ \ ATTCTTGAAGAAGGTGAAAAAACTATAAGGTATGAACTTTTGGAGTTAGACCCGATGGAG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGAACTTCTTCCACTTTTTTGATATTCCATACTTGAAAACCTCAATCTGGGCTACCTC / / / / / / / // / / | | SetI MboII | SetI | || | SetI | Hpy178III* HphI | || | FokI Hin4II* | || BsiYI* EcoRI | |MnlI TspEI | BccI ApoI TspDTI I L E E G E K T I R Y E L L E L D P M E F L K K V K K L * G M N F W S * T R W R S * R R * K N Y K V * T F G V R P D G G ----:----|----:----|----:----|----:----|----:----|----:----| I R S S P S F V I L Y S S K S N S G I S F E Q L L H F F * L T H V K P T L G S P N K F F T F F S Y P I F K Q L * V R H L AluI CviJI TspDTI | SetI | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII SetI BseGI | | || NlaIII MseI Tsp4CI* \ \ \ \ \\ \ \ \ GTTGATACATCCAAGCTACCATGGTTCATAAACTTTGATTACTTAAACTGTATCAATCAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTATGTAGGTTCGATGGTACCAAGTATTTGAAACTAATGAATTTGACATAGTTAGTT / / / / // / / BseGI | | | |DsaI* | Tsp4CI* | | | |SecI* MseI | | | |StyI | | | |NcoI | | | |FatI | | | CviAII | | NlaIII | CviJI | AluI TspDTI SetI V D T S K L P W F I N F D Y L N C I N Q L I H P S Y H G S * T L I T * T V S I N * Y I Q A T M V H K L * L L K L Y Q S M ----:----|----:----|----:----|----:----|----:----|----:----| T S V D L S G H N M F K S * K F Q I L * P Q Y M W A V M T * L S Q N S L S Y * D N I C G L * W P E Y V K I V * V T D I L BseRI Hpy178III* MnlI | TfiI MslI | HinfI | MnlI | | MnlI | | Hin4II* | | | PsiI \ \ \ \ \ \ \ TGTTTTTTTGATTTTACATTTGCGTGTGAGGAGGAAGGAAGTCTGGATTCTTATAAAGAG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAAAAAACTAAAATGTAAACGCACACTCCTCCTTCCTTCAGACCTAAGAATATTTCTC // / / / / // / || | Hin4II* | | || PsiI || MnlI | | |MnlI |MslI | | HinfI MnlI | | TfiI | Hpy178III* BseRI C F F D F T F A C E E E G S L D S Y K E V F L I L H L R V R R K E V W I L I K R F F * F Y I C V * G G R K S G F L * R G ----:----|----:----|----:----|----:----|----:----|----:----| H K K S K V N A H S S S P L R S E * L S I N K Q N * M Q T H P P L F D P N K Y L T K K I K C K R T L L F S T Q I R I F L TspEI MboI CviJI ApoI | MseI | DpnI | MseI TspEI | |AhaIII* | |BstKTI \ \ \ \ \\ \ \\ GGCTTGTTAAAGATTGTGAAAATTTTATATTATCAGTTCAACCAATTTAAAATATGGATC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAACAATTTCTAACACTTTTAAAATATAATAGTCAAGTTGGTTAAATTTTATACCTAG / / / /// // / CviJI MseI TspEI ||MseI || MboI ApoI |AhaIII* |DpnI TspEI BstKTI G L L K I V K I L Y Y Q F N Q F K I W I A C * R L * K F Y I I S S T N L K Y G S L V K D C E N F I L S V Q P I * N M D Q ----:----|----:----|----:----|----:----|----:----|----:----| P K N F I T F I K Y * * N L W N L I H I P S T L S Q S F K I N D T * G I * F I S A Q * L N H F N * I I L E V L K F Y P D BinI* MseI Hpy166II TspEI PsiI \ \ \ \ \ AACACGCAACCCGTTAAATCTGTGAACGCCAATGATAATTTTATAAATATCAACAATCTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGCGTTGGGCAATTTAGACACTTGCGGTTACTATTAAAATATTTATAGTTGTTAGAA / / / / / / BinI* MseI Hpy166II | PsiI CspCI TspEI N T Q P V K S V N A N D N F I N I N N L T R N P L N L * T P M I I L * I S T I F H A T R * I C E R Q * * F Y K Y Q Q S L ----:----|----:----|----:----|----:----|----:----|----:----| L V C G T L D T F A L S L K I F I L L R * C A V R * I Q S R W H Y N * L Y * C D V R L G N F R H V G I I I K Y I D V I K TsoI NlaIV | MaeII | |BtrI BssKI | || SetI EcoRII | || TaiI | CspCI | || | CspCI | ScrFI | || | |EcoNI | BseBI | || | || BsiYI* CspCI | |SetI | || | || | SetI CspCI Tsp4CI* \ \ \\ \ \\ \ \\ \ \ \ \ TATGATGATAACCACCTGGATTGGAACCACGTCCTTTGTAAGGTAAATCTAAAAGAACAG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTACTATTGGTGGACCTAACCTTGGTGCAGGAAACATTCCATTTAGATTTTCTTGTC // / / / / / // / / / / / / / || | | | | | || | | | SetI CspCI | Tsp4CI* || | | | | | || | | EcoNI TspRI || | | | | | || | BsiYI* || | | | | | || CspCI || | | | | | |MaeII || | | | | | BtrI || | | | | TaiI || | | | | SetI || | | | NlaIV || | | TsoI || | EcoRII || | BssKI || BseBI || ScrFI |CspCI SetI Y D D N H L D W N H V L C K V N L K E Q M M I T T W I G T T S F V R * I * K N S * * * P P G L E P R P L * G K S K R T V ----:----|----:----|----:----|----:----|----:----|----:----| * S S L W R S Q F W T R Q L T F R F S C K H H Y G G P N S G R G K Y P L D L L V I I I V V Q I P V V D K T L Y I * F F L ApoI Hpy178III* TspRI TspEI | CviRI* \ \ \ \ TGTATTCAAATAGCAGAATTTTACAAAGATTTATCTGGATTGGTGCAAACATTACAAACT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAAGTTTATCGTCTTAAAATGTTTCTAAATAGACCTAACCACGTTTGTAATGTTTGA / / / TspEI | CviRI* ApoI Hpy178III* C I Q I A E F Y K D L S G L V Q T L Q T V F K * Q N F T K I Y L D W C K H Y K L Y S N S R I L Q R F I W I G A N I T N F ----:----|----:----|----:----|----:----|----:----|----:----| H I * I A S N * L S K D P N T C V N C V T Y E F L L I K C L N I Q I P A F M V F T N L Y C F K V F I * R S Q H L C * L S MboI | DpnI | |BstKTI | ||MlyI ApoI | ||PleI MboII TspEI | |||BaeI HinfI Tsp4CI* | BaeI EcoRI \ \\\\ \ \ \ \ \ TTAGATCAAAATGACTCAACAACCGTATCGCTATACGAAACATTCTTCAACGAATTCCCT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTAGTTTTACTGAGTTGTTGGCATAGCGATATGCTTTGTAAGAAGTTGCTTAAGGGA /// // / / // / ||| |PleI HinfI Tsp4CI* |BaeI EcoRI ||| MboI MboII TspEI ||| MlyI ApoI ||DpnI |BstKTI BaeI L D Q N D S T T V S L Y E T F F N E F P * I K M T Q Q P Y R Y T K H S S T N S L R S K * L N N R I A I R N I L Q R I P * ----:----|----:----|----:----|----:----|----:----|----:----| K S * F S E V V T D S Y S V N K L S N G K L D F H S L L R I A I R F M R * R I G * I L I V * C G Y R * V F C E E V F E R TspEI | Eco57I AluI | Eco57MI CviJI SspI BdaI | | MboII | SetI | MseI BdaI | | | SetI \ \ \ \ \ \ \ \ \ AAAGAGTTTAGCTTTACATTATTTGAATATTTAATCAAGCATAAAAAATTGAACGACCTC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCAAATCGAAATGTAATAAACTTATAAATTAGTTCGTATTTTTTAACTTGCTGGAG / / / / / / / / / | CviJI SspI | BdaI | | | SetI | AluI | BdaI | | MboII SetI MseI | TspEI Eco57MI Eco57I K E F S F T L F E Y L I K H K K L N D L K S L A L H Y L N I * S S I K N * T T S R V * L Y I I * I F N Q A * K I E R P H ----:----|----:----|----:----|----:----|----:----|----:----| L S N L K V N N S Y K I L C L F N F S R * L T * S * M I Q I N L * A Y F I S R G F L K A K C * K F I * D L M F F Q V V E MnlI HinfI | SetI | AciI | NlaIV | | BsrBI | | BdaI | | | PleI | | BdaI MseI Tsp4CI* | | | |MlyI \ \ \ \ \ \ \ \ \\ ATCTTCAGGTTCCCACAACAACACGATGTTTTAATACAGTTTTTCCAAGAGTCCGCTCCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAGTCCAAGGGTGTTGTTGTGCTACAAAATTATGTCAAAAAGGTTCTCAGGCGAGGT / // / / / / / | |BdaI | Tsp4CI* | | PleI | |BdaI MseI | | MlyI | NlaIV | BsrBI MnlI | AciI SetI HinfI I F R F P Q Q H D V L I Q F F Q E S A P S S G S H N N T M F * Y S F S K S P L Q L Q V P T T T R C F N T V F P R V R S K ----:----|----:----|----:----|----:----|----:----|----:----| M K L N G C C C S T K I C N K W S D A G * R * T G V V V R H K L V T K G L T R E D E P E W L L V I N * Y L K E L L G S W Csp6I |RsaI |BsiYI* || Tsp4CI* || | FatI || | |CviAII || | || NlaIII || | || | BinI* || | || | |FatI || | || | ||CviAII || | || | ||| MboI || | || | ||| BamHI || | || | ||| XhoII || | || | ||| NlaIII || | || | ||| | DpnI || | || | ||| | NlaIV || | || | ||| | |BstKTI || | || | ||| | || BinI* || | || | ||| | || | TfiI || | || | ||| | || | HinfI || | || | ||| | || | |BccI || | || | ||| | || | || AlwNI || | || | ||| | || | || |Hpy178III* || | || | ||| | || | || || SfaNI || | || | ||| | || | || || BseGI || | || | ||| | || | || || | SplI* || | || | ||| | || | || || | |Csp6I || | || | ||| | || | || || | ||RsaI FatI || | || | ||| | || | || || | ||| MmeI |CviAII || | || | ||| | || | || || | ||| |FokI || NlaIII \\ \ \\ \ \\\ \ \\ \ \\ \\ \ \\\ \\ \\ \ AAGTACGGTCATGTAGCATGGATCCAACAGATTCTGGATGGGTCGTACGCAGATGCCATG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATGCCAGTACATCGTACCTAGGTTGTCTAAGACCTACCCAGCATGCGTCTACGGTAC / /// / // / //// / // // / / /// / / // | ||| | || | |||| | || || | BseGI ||| | | |FatI | ||| | || | |||| | || || | ||| | | CviAII | ||| | || | |||| | || || | ||| | NlaIII | ||| | || | |||| | || || | ||| FokI | ||| | || | |||| | || || | ||SplI* | ||| | || | |||| | || || | |Csp6I | ||| | || | |||| | || || | SfaNI | ||| | || | |||| | || || | MmeI | ||| | || | |||| | || || | RsaI | ||| | || | |||| | || || Hpy178III* | ||| | || | |||| | || |HinfI | ||| | || | |||| | || |TfiI | ||| | || | |||| | || BccI | ||| | || | |||| | |AlwNI | ||| | || | |||| | BinI* | ||| | || | |||| XhoII | ||| | || | |||| BamHI | ||| | || | |||| MboI | ||| | || | |||NlaIV | ||| | || | |||DpnI | ||| | || | ||BstKTI | ||| | || | |FatI | ||| | || | CviAII | ||| | || NlaIII | ||| | || BinI* | ||| | |FatI | ||| | CviAII | ||| NlaIII | ||Tsp4CI* | |Csp6I | RsaI BsiYI* K Y G H V A W I Q Q I L D G S Y A D A M S T V M * H G S N R F W M G R T Q M P * V R S C S M D P T D S G W V V R R C H E ----:----|----:----|----:----|----:----|----:----|----:----| F Y P * T A H I W C I R S P D Y A S A M L T R D H L M S G V S E P H T T R L H W L V T M Y C P D L L N Q I P R V C I G H HindIII Tsp4CI* | AluI MseI | TfiI | CviJI |AhaIII* | HinfI | |SmlI || TspDTI | | Hin4II* | ||SetI \\ \ \ \ \ \ \\\ AATACTTTAAAAAACATTACTGTTGATGATTCAAAGAAGGGCGAAAGCTTGAGCGAATGT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGAAATTTTTTGTAATGACAACTACTAAGTTTCTTCCCGCTTTCGAACTCGCTTACA // / / / / / / / / || TspDTI Tsp4CI* | HinfI | | | SmlI |MseI | TfiI | | HindIII AhaIII* Hin4II* | CviJI | AluI SetI N T L K N I T V D D S K K G E S L S E C I L * K T L L L M I Q R R A K A * A N V Y F K K H Y C * * F K E G R K L E R M * ----:----|----:----|----:----|----:----|----:----|----:----| F V K F F M V T S S E F F P S L K L S H S Y K L F C * Q Q H N L S P R F S S R I I S * F V N S N I I * L L A F A Q A F T CviRI* | TspEI TspEI | | MseI | CviRI* | | | AluI | | Bce83I* | | | CviJI | | | MslI | | | | SetI MaeI TspEI \ \ \ \ \ \ \ \ \ \ \ GAATTGCACTTGAATGTTGCAAAATTAAGCTCGTTGCTAGTTGAAAAGGATAATTTGGAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACGTGAACTTACAACGTTTTAATTCGAGCAACGATCAACTTTTCCTATTAAACCTG /// / / // / / / ||| MslI CviRI* || CviJI MaeI TspEI ||Bce83I* || AluI |CviRI* |MseI TspEI |SetI TspEI E L H L N V A K L S S L L V E K D N L D N C T * M L Q N * A R C * L K R I I W T I A L E C C K I K L V A S * K G * F G H ----:----|----:----|----:----|----:----|----:----|----:----| S N C K F T A F N L E N S T S F S L K S H I A S S H Q L I L S T A L Q F P Y N P F Q V Q I N C F * A R Q * N F L I I Q V BinI* SfaNI | MboI | MfeI | XhoII | TspEI MseI | | DpnI | BseMII VspI | | |BstKTI TspEI | |BspCNI DdeI SspI \ \ \ \\ \ \ \\ \ \ ATTAATACTTTGAGAAAGATCCAATATAATTTAGATACAATTGATGCTGAGAAAAATATT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTATGAAACTCTTTCTAGGTTATATTAAATCTATGTTAACTACGACTCTTTTTATAA / / // / / // / / / VspI | || XhoII | || TspEI DdeI SspI MseI | || MboI | || MfeI | |DpnI | |BspCNI | BstKTI | |SfaNI BinI* | BseMII TspEI I N T L R K I Q Y N L D T I D A E K N I L I L * E R S N I I * I Q L M L R K I F * Y F E K D P I * F R Y N * C * E K Y F ----:----|----:----|----:----|----:----|----:----|----:----| M L V K L F I W Y L K S V I S A S F F I C * Y K S F S G I Y N L Y L Q H Q S F Y N I S Q S L D L I I * I C N I S L F I N Hpy166II | Hpy178III* TspEI Hpy188I | | CviJI \ \ \ \ \ TCAAACAAATTGAAAAAGGGCGAAGTTCAGATATGTAAACGCTTCAAGAATGGCTCTATC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTGTTTAACTTTTTCCCGCTTCAAGTCTATACATTTGCGAAGTTCTTACCGAGATAG / / / / / TspEI Hpy188I Hpy166II | CviJI Hpy178III* S N K L K K G E V Q I C K R F K N G S I Q T N * K R A K F R Y V N A S R M A L S K Q I E K G R S S D M * T L Q E W L Y Q ----:----|----:----|----:----|----:----|----:----|----:----| E F L N F F P S T * I H L R K L F P E I K L C I S F P R L E S I Y V S * S H S * * V F Q F L A F N L Y T F A E L I A R D MslI AluI Hin4I CviJI MboI |SapI | MseI Tsp4CI* XhoII |Ksp632I* | SetI MboII | Hin4I Hpy188I \\ \ \ \ \ \ \ AGGGAAGTTTTCAACATATTAGTGGAAGAGCTTAAATCAACAACAGTAGTCAATCTATCG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTTCAAAAGTTGTATAATCACCTTCTCGAATTTAGTTGTTGTCATCAGTTAGATAGC / / / / / / / / / / | | | | | | MboII | Hin4I Hpy188I | | | | | MseI Tsp4CI* | | | | CviJI | | | | AluI | | | SetI | | Ksp632I* | | SapI | MslI Hin4I R E V F N I L V E E L K S T T V V N L S G K F S T Y * W K S L N Q Q Q * S I Y R G S F Q H I S G R A * I N N S S Q S I G ----:----|----:----|----:----|----:----|----:----|----:----| L S T K L M N T S S S L D V V T T L R D * P L K * C I L P L A * I L L L L * D I P F N E V Y * H F L K F * C C Y D I * R TaqI | Ksp632I* | | Hpy99I | | | TspDTI | | | | AluI | | | | CviJI | | | | | SetI | | | | | | MboII | | | | | | |TspDTI | | | | | | || AciI DpnI | | | | | | || | DdeI |BstKTI | | | | | | || | Bpu10I || BinI* | | | | | | || | | CviJI \\ \ \ \ \ \ \ \ \\ \ \ \ GATCTCGTTGAGTTGTATTCTATGCTCGACGATGAAGAGAGCTTATTCATACCGCTAAGG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAGCAACTCAACATAAGATACGAGCTGCTACTTCTCTCGAATAAGTATGGCGATTCC // / / / / / / / / / / / / || | BinI* | | | | | | TspDTI | | CviJI || XhoII | | | | | | MboII | Bpu10I || MboI | | | | | CviJI | DdeI |DpnI | | | | | AluI AciI BstKTI | | | | SetI | | | TspDTI | | Ksp632I* | TaqI Hpy99I D L V E L Y S M L D D E E S L F I P L R I S L S C I L C S T M K R A Y S Y R * G S R * V V F Y A R R * R E L I H T A K A ----:----|----:----|----:----|----:----|----:----|----:----| S R T S N Y E I S S S S S L K N M G S L P D R Q T T N * A R R H L S S I * V A L I E N L Q I R H E V I F L A * E Y R * P ApoI Hpy178III* BccI TspEI MseI | BsmI \ \ \ \ \ CTTCTTTCTGTTGATGGAAACTTACTGAATTTTGAAGTTAAAAAGTTCTTGAATGCTTTG 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGAAAGACAACTACCTTTGAATGACTTAAAACTTCAATTTTTCAAGAACTTACGAAAC / / / / / BccI TspEI MseI | BsmI ApoI Hpy178III* L L S V D G N L L N F E V K K F L N A L F F L L M E T Y * I L K L K S S * M L W S F C * W K L T E F * S * K V L E C F G ----:----|----:----|----:----|----:----|----:----|----:----| S R E T S P F K S F K S T L F N K F A K A E K Q Q H F S V S N Q L * F T R S H K K K R N I S V * Q I K F N F L E Q I S Q MaeI | Hin4II* TfiI | | Eco57I HinfI MboII | | Eco57MI TspDTI \ \ \ \ \ \ GTATGGAGAAGAATCGTTCTACTAAATGCTAGTAATGAAGGAGATAAACTGCTTCAGCAT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CATACCTCTTCTTAGCAAGATGATTTACGATCATTACTTCCTCTATTTGACGAAGTCGTA / / // / / | MboII || Eco57MI TspDTI HinfI || Eco57I TfiI |MaeI Hin4II* V W R R I V L L N A S N E G D K L L Q H Y G E E S F Y * M L V M K E I N C F S I M E K N R S T K C * * * R R * T A S A Y ----:----|----:----|----:----|----:----|----:----|----:----| T H L L I T R S F A L L S P S L S S * C P I S F F R E V L H * Y H L L Y V A E A Y P S S D N * * I S T I F S I F Q K L M MaeII AflIII | SetI MboII | TaiI |TspDTI BfiI BsrI \ \ \\ \ \ ATAGTCAAACGTGTTTTTGATGAAGAACTACCCAAAAATAATGATTTCCCCTTGCCCAGT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TATCAGTTTGCACAAAAACTACTTCTTGATGGGTTTTTATTACTAAAGGGGAACGGGTCA / / / / / / | | AflIII TspDTI BfiI TspRI | MaeII MboII BsrI TaiI SetI I V K R V F D E E L P K N N D F P L P S * S N V F L M K N Y P K I M I S P C P V S Q T C F * * R T T Q K * * F P L A Q C ----:----|----:----|----:----|----:----|----:----|----:----| I T L R T K S S S S G L F L S K G K G L Y L * V H K Q H L V V W F Y H N G R A W Y D F T N K I F F * G F I I I E G Q G T MboI XhoII TspRI | DpnI | |BstKTI | || BinI* | || | MaeIII BspMI | || | Tsp45I MaeIII AcyI HgaI | NdeI \ \\ \ \ \ \ \ \ \ GTGGATCTTTTATGTGACAAATCGTTACTGACGCCAGAATACATAAGCGAAACATATGGC 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTAGAAAATACACTGTTTAGCAATGACTGCGGTCTTATGTATTCGCTTTGTATACCG // / / / / / / / / / || | BinI* Tsp45I | AcyI HgaI | | SetI || XhoII MaeIII MaeIII | NdeI || MboI BspMI |DpnI BstKTI V D L L C D K S L L T P E Y I S E T Y G W I F Y V T N R Y * R Q N T * A K H M A G S F M * Q I V T D A R I H K R N I W Q ----:----|----:----|----:----|----:----|----:----|----:----| T S R K H S L D N S V G S Y M L S V Y P H P D K I H C I T V S A L I C L R F M H H I K * T V F R * Q R W F V Y A F C I A MboI BclI | DpnI | |BstKTI | || Hpy188I | || | BsmI | || | | Ksp632I* | || | | |MaeII | || | | ||BsaAI SmlI | || | | ||| SetI Bce83I* | MboII SetI | || | | ||| TaiI | MboII | |TspDTI \ \ \\ \ \ \\\ \ \ \ \ \\ AGGTTTCCTATTGATCAGAATGCCATACGTGAAGAGATATATGAAGAAATATCTCAAGTG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAAGGATAACTAGTCTTACGGTATGCACTTCTCTATATACTTCTTTATAGAGTTCAC // / / / // / / / / || | | | || | MboII | SmlI || | | | || Bce83I* TspDTI || | | | |Ksp632I* MboII || | | | |MaeII || | | | BsaAI || | | TaiI || | | SetI || | BsmI || Hpy188I || BclI || MboI |DpnI BstKTI R F P I D Q N A I R E E I Y E E I S Q V G F L L I R M P Y V K R Y M K K Y L K W V S Y * S E C H T * R D I * R N I S S G ----:----|----:----|----:----|----:----|----:----|----:----| L N G I S * F A M R S S I Y S S I D * T C T E * Q D S H W V H L S I H L F I E L P K R N I L I G Y T F L Y I F F Y R L H AvaI XhoI SmlI BspCNI AclI |TaqI MaeII |BseMII | SetI DdeI |BmeT110I CviRI* | TaiI | Hpy188I ||Hpy178III* | TaqI SfeI* \ \ \ \ \\\ \ \ \ GAAACGTTGAACTCAGACAACTCACTCGAGATAAAGTTGCACTCGACTATTGGTTCTGTA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGCAACTTGAGTCTGTTGAGTGAGCTCTATTTCAACGTGAGCTGATAACCAAGACAT / / // // // / / / | MaeII |DdeI || || | TaqI SfeI* | AclI Hpy188I || || CviRI* TaiI || |Hpy178III* SetI || |SmlI || |XhoI || |AvaI || BmeT110I || TaqI |BseMII BspCNI E T L N S D N S L E I K L H S T I G S V K R * T Q T T H S R * S C T R L L V L * N V E L R Q L T R D K V A L D Y W F C S ----:----|----:----|----:----|----:----|----:----|----:----| S V N F E S L E S S I F N C E V I P E T P F T S S L C S V R S L T A S S * Q N Q F R Q V * V V * E L Y L Q V R S N T R Y SfeI* |Tsp4CI* || TspDTI BccI || |TspRI \ \\ \\ GCGAAAGAAAAAAACTATACCATCAACTATGAAACCAACACTGTAGAATACTAA 3430 3440 3450 3460 3470 ----:----|----:----|----:----|----:----|----:----|---- CGCTTTCTTTTTTTGATATGGTAGTTGATACTTTGGTTGTGACATCTTATGATT / / // / BccI | || SfeI* | |TspDTI | Tsp4CI* TspRI A K E K N Y T I N Y E T N T V E Y * R K K K T I P S T M K P T L * N T X E R K K L Y H Q L * N Q H C R I L X ----:----|----:----|----:----|----:----|----:----|---- A F S F F * V M L * S V L V T S Y * L S L F F S Y W * S H F W C Q L I S R F F F V I G D V I F G V S Y F V L # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 5 DraI AjuI 1 AlfI 2 AluI 8 AluBI AlwNI 1 CaiI ApoI 16 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 2 BpuEI BceAI 1 BciVI 2 BfuI BclI 3 FbaI,Ksp22I BdaI 2 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 7 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 4 BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 4 BspMI 2 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 13 BstXI 1 BtrI 1 BmgBI,AjiI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CspCI 2 CviAII 12 CviJI 17 CviKI-1 CviRI* 8 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 13 MalI DsaI* 3 BtgI,BstDSI EciI 1 Eco57I 3 AcuI Eco57MI 5 EcoNI 2 BstENI,XagI EcoP15I 1 EcoRI 3 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 1 FatI 12 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 2 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 2 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 7 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HinfI 17 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 15 Hpy188III Hpy188I 11 Hpy99I 2 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 8 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 19 MfeI 1 MunI MlyI 8 SchI MmeI 3 MnlI 16 MseI 24 Tru1I,Tru9I MslI 6 RseI,SmiMI NcoI 3 Bsp19I NdeI 1 FauNDI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PfoI 1 PleI 8 PpsI PsiI 3 AanI PsrI 1 RsaI 7 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 5 BmrFI,MspR9I,Bme1390I SecI* 7 BseDI,BssECI,BsaJI SetI 38 SfaNI 2 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 3 SmoI SpeI 1 BcuI,AhlI SplI* 1 Pfl23II,PspLI,BsiWI SspI 4 StuI 1 Eco147I,PceI,SseBI,AatI StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 6 TatI 2 TfiI 9 PfeI TseI 1 ApeKI TsoI 4 Tsp45I 2 NmuCI Tsp4CI* 16 HpyCH4III,TaaI,Bst4CI TspDTI 16 TspEI 40 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI TstI 1 VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 6 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AgeI AloI ApaI ApaLI AscI Asp718I AsuII AvrII BalI BbvCI BcgI BglI BmtI BplI BsaXI BsePI BseSI BseYI BsgI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI HaeII HgiAI* HgiCI* HgiJII* HindII HpaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* MwoI NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SrfI Sse232I* Sse8387I SwaI TaqII TauI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769