Restriction Map of YKR075W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YKR075W-A on chromosome XI from coordinates 580212 to 580481.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.24725

HphI SfeI* BseRI | TspEI BsrDI | FokI MseI |BseGI \ \ \ \ \ \ \\ ATGTCTTCTAATTTCACCAAAGCGTTGTCATTGCTCTCTATAGAAGCGTTAATCTCATCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAAGATTAAAGTGGTTTCGCAACAGTAACGAGAGATATCTTCGCAATTAGAGTAGG / / / / / /// / HphI TspEI BsrDI | FokI ||BseGI SetI SfeI* |BseRI MseI M S S N F T K A L S L L S I E A L I S S C L L I S P K R C H C S L * K R * S H P V F * F H Q S V V I A L Y R S V N L I H ----:----|----:----|----:----|----:----|----:----|----:----| X D E L K V L A N D N S E I S A N I E D X T K * N * W L T T M A R * L L T L R M H R R I E G F R Q * Q E R Y F R * D * G SetI |SecI* || MaeIII || BstEII || | MnlI || | TspGWI || | | BseYI || | | |MnlI || | | || BsmI MseI || | | || GsaI |AhaIII* \\ \ \ \\ \ \\ ACCTCCTCGGTTACCCAGCATTCCGTATTTTTCTTTAAAGCAGATTTTAGATTTTTTGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGAGCCAATGGGTCGTAAGGCATAAAAAGAAATTTCGTCTAAAATCTAAAAAACAA /// / / / // ||| | | BseYI |MseI ||| | BsmI AhaIII* ||| BstEII ||| MaeIII ||| MnlI ||| GsaI ||MnlI |TspGWI SecI* T S S V T Q H S V F F F K A D F R F F V P P R L P S I P Y F S L K Q I L D F L F L L G Y P A F R I F L * S R F * I F C L ----:----|----:----|----:----|----:----|----:----|----:----| V E E T V W C E T N K K L A S K L N K T W R R P * G A N R I K R * L L N * I K Q G G R N G L M G Y K E K F C I K S K K N Hpy178III* | AsuI* | AvaII | |BmgT120I | ||Cfr10I TspEI | |||HpaII TspDTI \ \ \\\\ \ TGTTTCTGGTCAATTTGGTTCTGGACCGGCGATATTTCGTTTTCATTACTATCTATGTTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAAGACCAGTTAAACCAAGACCTGGCCGCTATAAAGCAAAAGTAATGATAGATACAAT / / // /// TspEI | || ||TspDTI | || |Cfr10I | || HpaII | |AvaII | |AsuI* | BmgT120I Hpy178III* C F W S I W F W T G D I S F S L L S M L V S G Q F G S G P A I F R F H Y Y L C * F L V N L V L D R R Y F V F I T I Y V S ----:----|----:----|----:----|----:----|----:----|----:----| Q K Q D I Q N Q V P S I E N E N S D I N K N R T L K T R S R R Y K T K M V I * T T E P * N P E P G A I N R K * * * R H * Hpy178III* | AsuI* | AvaII | |BmgT120I | || Tsp4CI* | || |Csp6I MaeIII BccI PflMI | || ||RsaI Tsp4CI* BsrI BsiYI* Tsp4CI* \ \\ \\\ \ \ \ \ GTCAAATCTGGACCGTACAACACCGTTACATCGGTTTCTTTGTTCCAGTTGATGGACAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTAGACCTGGCATGTTGTGGCAATGTAGCCAAAGAAACAAGGTCAACTACCTGTCA / // // / / / / / / / | || |Csp6I | MaeIII | | | | Tsp4CI* | || RsaI Tsp4CI* | | | TspRI | |Tsp4CI* | | BsiYI* | |AvaII | | PflMI | |AsuI* | BccI | BmgT120I BsrI Hpy178III* V K S G P Y N T V T S V S L F Q L M D S S N L D R T T P L H R F L C S S * W T V Q I W T V Q H R Y I G F F V P V D G Q W ----:----|----:----|----:----|----:----|----:----|----:----| T L D P G Y L V T V D T E K N W N I S L L * I Q V T C C R * M P K K T G T S P C D F R S R V V G N C R N R Q E L Q H V T TspRI Hpy166II \ \ GGATTGGATTTGGAGTTCTGTAAACCATAG 250 260 270 ----:----|----:----|----:----| CCTAACCTAAACCTCAAGACATTTGGTATC / Hpy166II G L D L E F C K P * D W I W S S V N H X I G F G V L * T I X ----:----|----:----|----:----| P N S K S N Q L G Y H I P N P T R Y V M S Q I Q L E T F W L # Enzymes that cut Frequency Isoschizomers AhaIII* 1 DraI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BccI 1 BmgT120I 2 BseGI 1 BstF5I,BtsCI BseRI 1 BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BstEII 1 BstPI,Eco91I,EcoO65I,PspEI Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI FokI 1 GsaI 1 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III MaeIII 2 MnlI 2 MseI 2 Tru1I,Tru9I PflMI 1 BasI,AccB7I,Van91I RsaI 1 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 1 SfeI* 1 BstSFI,SfcI,BfmI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BsgI BsiI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I CfrI ClaI CspCI CviAII CviJI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI MboI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TfiI TseI TsoI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769