Restriction Map of YKR070W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YKR070W on chromosome XI from coordinates 573574 to 574632.


BsmI CviRI* | TaqI Tsp4CI* | | BccI \ \ \ \ ATGATTGGCAAACGGTTTTTCCAAACAACAAGTAAAAAGATTGCTTTTGCATTCGATATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAACCGTTTGCCAAAAAGGTTTGTTGTTCATTTTTCTAACGAAAACGTAAGCTATAA / / / // Tsp4CI* | | |BccI | | TaqI | CviRI* BsmI M I G K R F F Q T T S K K I A F A F D I * L A N G F S K Q Q V K R L L L H S I L D W Q T V F P N N K * K D C F C I R Y * ----:----|----:----|----:----|----:----|----:----|----:----| X I P L R N K W V V L L F I A K A N S I X S Q C V T K G F L L Y F S Q K Q M R Y H N A F P K E L C C T F L N S K C E I N CviJI | MfeI | TspEI | | PflMI | | BsiYI* | | | HgiCI* | | | | NlaIV | | | | | Cac8I | | | | | | MwoI | | | | | | | Hpy99I | | | | | | | | HgaI | | | | | | | | | AluI | | | | | | | | | CviJI | | | | | | | | | | SetI \ \ \ \ \ \ \ \ \ \ \ GATGGTGTGTTGTTCAGGGGCAAAAAGCCAATTGCTGGTGCCAGCGACGCATTGAAGCTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCACACAACAAGTCCCCGTTTTTCGGTTAACGACCACGGTCGCTGCGTAACTTCGAC / / / / //// / / / | | TspEI | |||Hpy99I | | HgaI | | MfeI | ||MwoI | CviJI | BsiYI* | |Cac8I | AluI | PflMI | HgiCI* SetI CviJI NlaIV D G V L F R G K K P I A G A S D A L K L M V C C S G A K S Q L L V P A T H * S C W C V V Q G Q K A N C W C Q R R I E A V ----:----|----:----|----:----|----:----|----:----|----:----| S P T N N L P L F G I A P A L S A N F S Q H H T T * P C F A L Q Q H W R R M S A I T H Q E P A F L W N S T G A V C Q L Q ApoI TspEI MnlI Hpy188I \ \ \ TTGAACCGAAATAAAATTCCATATATTTTACTCACTAATGGTGGAGGGTTCTCTGAAAGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGGCTTTATTTTAAGGTATATAAAATGAGTGATTACCACCTCCCAAGAGACTTTCC / / / / / TspEI MnlI | | BseSI ApoI | | SduI | BplI | BplI Hpy188I L N R N K I P Y I L L T N G G G F S E R * T E I K F H I F Y S L M V E G S L K G E P K * N S I Y F T H * W W R V L * K G ----:----|----:----|----:----|----:----|----:----|----:----| N F R F L I G Y I K S V L P P P N E S L T S G F Y F E M Y K V * * H H L T R Q F Q V S I F N W I N * E S I T S P E R F P AvaI XhoI SmlI MaeII TspGWI |BplI BplI Hpy178III* |BplI BplI |TaqI || HphI | SduI |BmeT110I || SetI CviRI* | BseSI || TspEI || TaiI | TspEI \ \ \\ \ \\ \ \ \ GCACGGACAGAGTTTATCTCGAGTAAATTGGACGTTGATGTATCACCCTTGCAAATTATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGCCTGTCTCAAATAGAGCTCATTTAACCTGCAACTACATAGTGGGAACGTTTAATAA / /// // / / / / | ||SmlI || | MaeII | TspEI | ||XhoI || | HphI CviRI* | ||AvaI || TaiI | || || SetI | || |TspEI | || BplI | || BplI | |BmeT110I | |TaqI | Hpy178III* TspGWI A R T E F I S S K L D V D V S P L Q I I H G Q S L S R V N W T L M Y H P C K L F T D R V Y L E * I G R * C I T L A N Y S ----:----|----:----|----:----|----:----|----:----|----:----| A R V S N I E L L N S T S T D G K C I I P V S L T * R S Y I P R Q H I V R A F * C P C L K D R T F Q V N I Y * G Q L N N MboI XhoII | DpnI | |BstKTI | || CfrI MseI | || | CviJI |HpaI | || | BinI* |HindII | || | HaeIII |Hpy166II | || | | TspGWI || SspI | || | | | Csp6I BslFI || BceAI | || | | | |RsaI \ \\ \ \ \\ \ \ \ \\ CAAAGTCATACTCCTTACAAGTCCCTTGTTAACAAATATTCAAGGATCTTGGCCGTTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCAGTATGAGGAATGTTCAGGGAACAATTGTTTATAAGTTCCTAGAACCGGCAACCA / // / / // / //// / BslFI |MseI | BceAI || | |||| RsaI | SspI || | |||TspGWI Hpy166II || | ||CfrI HindII || | |BinI* HpaI || | HaeIII || | CviJI || XhoII || MboI |DpnI BstKTI Q S H T P Y K S L V N K Y S R I L A V G K V I L L T S P L L T N I Q G S W P L V K S Y S L Q V P C * Q I F K D L G R W Y ----:----|----:----|----:----|----:----|----:----|----:----| * L * V G * L D R T L L Y E L I K A T P E F D Y E K C T G Q * C I N L S R P R Q L T M S R V L G K N V F I * P D Q G N T Hpy178III* Hpy166II Hin4II* | HphI | SetI | Hin4II* | | TspGWI | |MnlI | | CviRI* CviJI | | | Hpy166II \ \\ \ \ \ \ \ \ \ \ ACACCTTCCGTGAGAGGCGTTGCAGAAGGCTACGGATTTCAAGATGTTGTTCACCAAACG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGAAGGCACTCTCCGCAACGTCTTCCGATGCCTAAAGTTCTACAACAAGTGGTTTGC // / / / / / / / / || MnlI | | CviRI* CviJI | | Hpy166II |SetI | Hin4II* | TspGWI Hpy166II Hin4II* Hpy178III* Csp6I HphI T P S V R G V A E G Y G F Q D V V H Q T H L P * E A L Q K A T D F K M L F T K R T F R E R R C R R L R I S R C C S P N G ----:----|----:----|----:----|----:----|----:----|----:----| V G E T L P T A S P * P N * S T T * W V Y V K R S L R Q L L S R I E L H Q E G F C R G H S A N C F A V S K L I N N V L R BsrDI | CviRI* | | BslFI | | | PflMI Hpy188I | | | BsiYI* | BccI TspGWI | | | | CviJI | Bce83I* \ \ \ \ \ \ \ \ GATATTGTAAGATACAATAGGGACATTGCACCATTTAGTGGGCTATCTGATGAACAAGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAACATTCTATGTTATCCCTGTAACGTGGTAAATCACCCGATAGACTACTTGTTCAC / / / / / / / / / TspGWI BsrDI | | | | | | BccI | | | | | Bce83I* | | | | Hpy188I | | | CviJI | | BslFI | BsiYI* | PflMI CviRI* D I V R Y N R D I A P F S G L S D E Q V I L * D T I G T L H H L V G Y L M N K * Y C K I Q * G H C T I * W A I * * T S D ----:----|----:----|----:----|----:----|----:----|----:----| S I T L Y L L S M A G N L P S D S S C T P Y Q L I C Y P C Q V M * H A I Q H V L I N Y S V I P V N C W K T P * R I F L H BceAI TatI |DdeI TspDTI ||SfaNI |Csp6I ||| ApoI ||RsaI ||| TspEI ||ScaI Hpy178III* ||| | TaqI ||| SmlI | MseI ||| | |TsoI \\\ \ \ \ \\\ \ \\ ATGGAGTACTCAAGGGATATTCCAGATTTAACCACTAAGAAATTCGATGCCGTCTTGGTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCATGAGTTCCCTATAAGGTCTAAATTGGTGATTCTTTAAGCTACGGCAGAACCAT / /// / / / / / / // / | ||| SmlI | MseI | | | || TaqI | ||TatI Hpy178III* | | | |TspEI | |Csp6I | | | |ApoI | ScaI | | | TsoI | RsaI | | SfaNI TspDTI | DdeI BceAI M E Y S R D I P D L T T K K F D A V L V W S T Q G I F Q I * P L R N S M P S W Y G V L K G Y S R F N H * E I R C R L G I ----:----|----:----|----:----|----:----|----:----|----:----| I S Y E L S I G S K V V L F N S A T K T S P T S L P Y E L N L W * S I R H R R P H L V * P I N W I * G S L F E I G D Q Y BinI* |MseI || MboI || | DpnI || | |BbvI || | |BstKTI || | || FatI || | || BspHI || | || |CviAII || | || |Hpy178III* || | || || NlaIII || | || || | MnlI DdeI || | || || | | TseI | Hpy188I || | || || | | CviJI | | CviRI* || | || || | | |BisI | | | BspCNI || | || || | | ||BlsI SfaNI | | | |BseMII \\ \ \\ \\ \ \ \\\ \ \ \ \ \\ TTTAACGATCCTCATGATTGGGCTGCCGATATACAAATCATCTCAGATGCAATCAACAGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGCTAGGAGTACTAACCCGACGGCTATATGTTTAGTAGAGTCTACGTTAGTTGTCG / / // / // // / //// / // / // | | || | || || | |||TseI | || | |BseMII | | || | || || | ||BisI | || | BspCNI | | || | || || | |BlsI | || CviRI* | | || | || || | CviJI | |DdeI | | || | || || MnlI | Hpy188I | | || | || |BspHI SfaNI | | || | || |FatI | | || | || Hpy178III* | | || | || CviAII | | || | |BbvI | | || | NlaIII | | || MboI | | |DpnI | | BstKTI | MseI BinI* F N D P H D W A A D I Q I I S D A I N S L T I L M I G L P I Y K S S Q M Q S T A * R S S * L G C R Y T N H L R C N Q Q R ----:----|----:----|----:----|----:----|----:----|----:----| N L S G * S Q A A S I C I M E S A I L L I * R D E H N P Q R Y V F * R L H L * C K V I R M I P S G I Y L D D * I C D V A SmlI Bce83I* MseI FokI | SetI Hin4II* |BseGI |SetI FokI | | BseGI | BccI \\ \\ \ \ \ \ \ \ GAAAATGGGATGTTAAATACCTTGAGAAACGAAAAGAGTGGCAAACCTTCCATCCCCATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACCCTACAATTTATGGAACTCTTTGCTTTTCTCACCGTTTGGAAGGTAGGGGTAA / / / / // / / / / | | SetI FokI || | BseGI | BccI | MseI SmlI || SetI Hin4II* BseGI |FokI Bce83I* E N G M L N T L R N E K S G K P S I P I K M G C * I P * E T K R V A N L P S P F K W D V K Y L E K R K E W Q T F H P H L ----:----|----:----|----:----|----:----|----:----|----:----| S F P I N F V K L F S F L P L G E M G M R F H S T L Y R S F R F S H C V K W G W F I P H * I G Q S V F L T A F R G D G N TstI TaqI AsuII Tsp4CI* | BssKI | AsuI* | EcoRII | |BmgT120I PsiI | | ScrFI | ||CviJI |TstI | | BseBI | ||HaeIII ||TspEI \ \ \ \ \\\ \\\ TACTTTTCGAACCAGGATTTACTGTGGGCCAATCCTTATAAATTGAATAGATTTGGACAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAAAAGCTTGGTCCTAAATGACACCCGGTTAGGAATATTTAACTTATCTAAACCTGTT / / / / / // / / / / TstI | | | | || | PsiI TspEI SetI | | | | || TstI | | | | |AsuI* | | | | BmgT120I | | | | HaeIII | | | | CviJI | | | Tsp4CI* | | EcoRII | | BssKI | BseBI | ScrFI AsuII TaqI Y F S N Q D L L W A N P Y K L N R F G Q T F R T R I Y C G P I L I N * I D L D K L F E P G F T V G Q S L * I E * I W T R ----:----|----:----|----:----|----:----|----:----|----:----| * K E F W S K S H A L G * L N F L N P C K S K S G P N V T P W D K Y I S Y I Q V V K R V L I * Q P G I R I F Q I S K S L AvaI XhoI SmlI SpeI Hpy178III* HgiCI* Hin4II* |TaqI Hpy166II | SetI |MaeI |BmeT110I | CviRI* | NlaIV AciI ||Hin4II* CviJI || MseI | |HphI \ \ \ \\\ \ \\ \ \ \\ GGTGCCTTCCGCTTACTAGTTAGAAGGCTTTATCTCGAGTTAAATGGTGAACCCTTGCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGAAGGCGAATGATCAATCTTCCGAAATAGAGCTCAATTTACCACTTGGGAACGTT / / / / / // / /// / / / | | | | | |SpeI CviJI ||| MseI | CviRI* | | | | | MaeI ||SmlI | HphI | | | | Hin4II* ||XhoI Hpy166II | | | Hin4II* ||AvaI | | AciI |BmeT110I | HgiCI* |TaqI NlaIV Hpy178III* G A F R L L V R R L Y L E L N G E P L Q V P S A Y * L E G F I S S * M V N P C K C L P L T S * K A L S R V K W * T L A R ----:----|----:----|----:----|----:----|----:----|----:----| P A K R K S T L L S * R S N F P S G K C L H R G S V L * F A K D R T L H H V R A T G E A * * N S P K I E L * I T F G Q L BdaI BdaI FatI | HindII |CviAII BdaI CviJI | Hpy166II || NlaIII BdaI \ \ \ \\ \ \ GATTATACTTTGGGTAAGCCTACAAAGTTGACTTATGATTTCGCTCATCATGTTCTCATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATATGAAACCCATTCGGATGTTTCAACTGAATACTAAAGCGAGTAGTACAAGAGTAA / / / / // / | BdaI Hpy166II | |FatI BdaI | BdaI HindII | | BdaI CviJI | CviAII NlaIII D Y T L G K P T K L T Y D F A H H V L I I I L W V S L Q S * L M I S L I M F S L L Y F G * A Y K V D L * F R S S C S H * ----:----|----:----|----:----|----:----|----:----|----:----| S * V K P L G V F N V * S K A * * T R M L N Y K P Y A * L T S K H N R E D H E * I I S Q T L R C L Q S I I E S M M N E N FauI | DdeI CviJI MwoI | | AciI HaeIII BstAPI DdeI \ \ \ \ \ \ GATTGGGAAAAAAGACTAAGCGGGAAAATAGGCCAATCTGTGAAGCAAAAACTGCCACTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACCCTTTTTTCTGATTCGCCCTTTTATCCGGTTAGACACTTCGTTTTTGACGGTGAG / / / / / / | | AciI HaeIII BstAPI BsiYI* | DdeI CviJI MwoI FauI D W E K R L S G K I G Q S V K Q K L P L I G K K D * A G K * A N L * S K N C H S L G K K T K R E N R P I C E A K T A T L ----:----|----:----|----:----|----:----|----:----|----:----| S Q S F L S L P F I P W D T F C F S G S Q N P F F V L R S F L G I Q S A F V A V I P F F S * A P F Y A L R H L L F Q W E Hin4II* | FatI | |CviAII | || AciI BsiYI* SetI | || NlaIII SetI \ \ \ \\ \ \ TTAGGCACGAAACCTTCAACTTCTCCATTCCATGCGGTTTTTATGGTAGGTGATAATCCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCGTGCTTTGGAAGTTGAAGAGGTAAGGTACGCCAAAAATACCATCCACTATTAGGA / / / / // / / / DdeI SetI Hin4II* | || AciI SetI HphI | |FatI | CviAII NlaIII L G T K P S T S P F H A V F M V G D N P * A R N L Q L L H S M R F L W * V I I L R H E T F N F S I P C G F Y G R * * S C ----:----|----:----|----:----|----:----|----:----|----:----| K P V F G E V E G N W A T K I T P S L G R L C S V K L K E M G H P K * P L H Y D * A R F R * S R W E M R N K H Y T I I R AluI CviJI Ecl136II | SetI | SduI | SacI | HgiAI* HphI | HgiJII* BbvII* CviRI* | | TspEI | SetI | MaeIII | | | AjuI | HphI | Tsp45I MmeI | | | | Tsp4CI* Tsp4CI* | AjuI \ \ \ \ \ \ \ \ \ \ \ GCAAGTGACATCATTGGAGCTCAAAATTACGGTTGGAACAGTTGTTTGGTGAAGACAGGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCACTGTAGTAACCTCGAGTTTTAATGCCAACCTTGTCAACAAACCACTTCTGTCCA / / / / / / / / / // / CviRI* | MmeI | | AjuI | Tsp4CI* Tsp4CI* || HphI Tsp45I | Ecl136II TspEI |SetI MaeIII | CviJI AjuI | AluI HgiJII* HgiAI* SacI SduI SetI A S D I I G A Q N Y G W N S C L V K T G Q V T S L E L K I T V G T V V W * R Q V K * H H W S S K L R L E Q L F G E D R C ----:----|----:----|----:----|----:----|----:----|----:----| A L S M M P A * F * P Q F L Q K T F V P Q L H C * Q L E F N R N S C N N P S S L C T V D N S S L I V T P V T T Q H L C T SetI |MboI || DpnI || |BstKTI MseI || ||Hpy178III* | FalI || ||| SfaNI MboII | FalI || ||| | FalI |Hin4II* SetI | HphI CviJI || ||| | FalI \\ \ \ \ \ \\ \\\ \ \ GTGTATAACGAAGGTGATGACTTAAAGGAATGTAAGCCTACCTTGATCGTGAATGATGTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CACATATTGCTTCCACTACTGAATTTCCTTACATTCGGATGGAACTAGCACTTACTACAT // / / / / / // / / / / |Hin4II* SetI | HphI | SetI || | | FalI SfaNI BbvII* | MseI CviJI || | | FalI MboII FalI || | Hpy178III* FalI || MboI |DpnI BstKTI V Y N E G D D L K E C K P T L I V N D V C I T K V M T * R N V S L P * S * M M Y V * R R * * L K G M * A Y L D R E * C I ----:----|----:----|----:----|----:----|----:----|----:----| T Y L S P S S K F S H L G V K I T F S T H T Y R L H H S L P I Y A * R S R S H H H I V F T I V * L F T L R G Q D H I I Y Csp6I AclI |RsaI MaeII || FatI AciI | SetI || |CviAII | MaeIII | TaiI || || NlaIII \ \ \ \ \\ \\ \ TTTGATGCGGTTACTAAAACGTTAGAAAAGTACGCATGA 1030 1040 1050 ----:----|----:----|----:----|----:---- AAACTACGCCAATGATTTTGCAATCTTTTCATGCGTACT / / / / // / // AciI | | MaeII || | |FatI | | AclI || | CviAII | TaiI || NlaIII | SetI |Csp6I MaeIII RsaI F D A V T K T L E K Y A * L M R L L K R * K S T H X * C G Y * N V R K V R M X ----:----|----:----|----:----|----:---- N S A T V L V N S F Y A H I Q H P * * F T L F T R M K I R N S F R * F L V C S # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AclI 1 Psp1406I AjuI 1 AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 2 BdaI 2 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 2 BmgT120I 1 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 3 Cac8I 1 BstC8I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 12 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI Ecl136II 1 EcoICRI EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 4 FauI 1 SmuI FokI 2 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4II* 7 HpyAV HindII 2 HincII HpaI 1 KspAI HphI 6 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 3 Hpy99I 1 MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MfeI 1 MunI MmeI 1 MnlI 3 MseI 6 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PflMI 2 BasI,AccB7I,Van91I PsiI 1 AanI RsaI 3 AfaI SacI 1 Psp124BI,SstI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SetI 13 SfaNI 3 LweI SmlI 4 SmoI SpeI 1 BcuI,AhlI SspI 1 TaiI 2 TaqI 5 TatI 1 TseI 1 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 4 TstI 1 XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaII AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BclI BetI* BfiI BglI BglII BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseYI BsgI BsiI* BsmAI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco47III Eco57I Eco57MI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HhaI Hin4I Hin6I HindIII HinfI HinP1I HpaII HspAI KasI KpnI Ksp632I* MauBI McrI* MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* SchI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TauI TfiI TspMI TspRI Tth111I VspI XbaI XcmI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769