Restriction Map of YKL225W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YKL225W on chromosome XI from coordinates 451 to 798.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.9644

FatI NcoI StyI SecI* DsaI* |BfiI |PflMI |CviAII |BsiYI* || AsuI* MaeII || NlaIII |BsaAI || |CviJI |SnaBI || |HaeIII || SetI || |BmgT120I || TaiI || || BsrI \\ \ \\ \\ \ ATGCTACGTATATACCACTCTCAACTTACCCTACTCTCACATTCCACTCCATGGCCCAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGATGCATATATGGTGAGAGTTGAATGGGATGAGAGTGTAAGGTGAGGTACCGGGTCA / // / / ///// | |MaeII | | ||||AsuI* | SnaBI | | |||BmgT120I | BsaAI | | ||HaeIII TaiI | | ||CviJI SetI | | ||BsrI | | |DsaI* | | |SecI* | | |StyI | | |NcoI | | |FatI | | CviAII | NlaIII | BfiI BsiYI* PflMI M L R I Y H S Q L T L L S H S T P W P S C Y V Y T T L N L P Y S H I P L H G P V A T Y I P L S T Y P T L T F H S M A Q S ----:----|----:----|----:----|----:----|----:----|----:----| X S R I Y W E * S V R S E C E V G H G L X A V Y I G S E V * G V R V N W E M A W H * T Y V V R L K G * E * M G S W P G T DdeI BbvCI Bpu10I | AciI | NspBII* BsmAI Csp6I | |BceAI | SfaNI |RsaI CviRI* | || MnlI \ \ \\ \ \ \\ \ CTCACTAAATCAGTACGATGCACTCACATCATTATTCACGGCACTTGCCTCAGCGGTTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTGATTTAGTCATGCTACGTGAGTGTAGTAATAAGTGCCGTGAACGGAGTCGCCAAAT / / // / // /// / | | || CviRI* || ||| BspCNI | | |Csp6I || ||MnlI | | RsaI || |BceAI | SfaNI || AciI BsmAI |NspBII* Bpu10I BbvCI DdeI L T K S V R C T H I I I H G T C L S G L S L N Q Y D A L T S L F T A L A S A V Y H * I S T M H S H H Y S R H L P Q R F I ----:----|----:----|----:----|----:----|----:----|----:----| R V L D T R H V * M M I * P V Q R L P K D * * I L V I C E C * * E R C K G * R N E S F * Y S A S V D N N V A S A E A T * BspCNI |BseMII || CviRI* || |TspEI MseI \\ \\ \ TACCCTGTGCAATTTACCCATAAAACCCACGATTATCCACATTTTAATATCTATATCTCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGGACACGTTAAATGGGTATTTTGGGTGCTAATAGGTGTAAAATTATAGATATAGAGT / / / / BseMII | TspEI MseI CviRI* Y P V Q F T H K T H D Y P H F N I Y I S T L C N L P I K P T I I H I L I S I S H P C A I Y P * N P R L S T F * Y L Y L I ----:----|----:----|----:----|----:----|----:----|----:----| Y G T C N V W L V W S * G C K L I * I E I G Q A I * G Y F G R N D V N * Y R Y R V R H L K G M F G V I I W M K I D I D * AciI NspBII* MseI |BisI | MwoI ||BlsI | | CviRI* |||TauI | | | EcoT22I |||CviJI | | | | TstI ||||NlaIV SspI | | | | BsaXI \\\\\ \ \ \ \ \ \ TTCAGCGGCTCCAAATATTGTATAACTGCTCTTAATGCATACATTATACCACTTTTACTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCGCCGAGGTTTATAACATATTGACGAGAATTACGTATGTAATATGGTGAAAATGAG ///// / / ///// ||||NlaIV SspI | ||||BsaXI |||CviJI | |||CviRI* ||BisI | ||TstI ||AciI | |EcoT22I |BlsI | MseI NspBII* MwoI TauI F S G S K Y C I T A L N A Y I I P L L L S A A P N I V * L L L M H T L Y H F Y S Q R L Q I L Y N C S * C I H Y T T F T P ----:----|----:----|----:----|----:----|----:----|----:----| N L P E L Y Q I V A R L A Y M I G S K S M * R S W I N Y L Q E * H M C * V V K V E A A G F I T Y S S K I C V N Y W K * E BsaXI | TstI | | TspEI TsoI HphI \ \ \ \ \ CATATACTAACCATTCAATTTATACACACTTATTTCAATATACCCACAAAATCACCACTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTATATGATTGGTAAGTTAAATATGTGTGAATAAAGTTATATGGGTGTTTTAGTGGTGAT / / / / BsaXI | TsoI HphI TstI TspEI H I L T I Q F I H T Y F N I P T K S P L I Y * P F N L Y T L I S I Y P Q N H H * Y T N H S I Y T H L F Q Y T H K I T T K ----:----|----:----|----:----|----:----|----:----|----:----| W I S V M * N I C V * K L I G V F D G S G Y V L W E I * V C K N * Y V W L I V V M Y * G N L K Y V S I E I Y G C F * W * SspI TspEI SetI MboII Ksp632I* \ \ \ \ AAATTACCTAAACATAAAAATATTCTACTCTTCAACAATAATACATAA 310 320 330 340 ----:----|----:----|----:----|----:----|----:--- TTTAATGGATTTGTATTTTTATAAGATGAGAAGTTGTTATTATGTATT / // / TspEI |SspI Ksp632I* SetI MboII K L P K H K N I L L F N N N T * N Y L N I K I F Y S S T I I H X I T * T * K Y S T L Q Q * Y I X ----:----|----:----|----:----|----:----|----:--- F N G L C L F I R S K L L L V Y L I V * V Y F Y E V R * C Y Y M F * R F M F I N * E E V I I C L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvCI 1 BceAI 1 BfiI 1 BmrI,BmuI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseMII 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BsrI 1 BseNI,Bse1I,BsrSI Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 2 CviKI-1 CviRI* 3 HpyCH4V DdeI 1 BstDEI,HpyF3I DsaI* 1 BtgI,BstDSI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HphI 1 AsuHPI Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 1 HpyCH4IV MboII 1 MnlI 1 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PflMI 1 BasI,AccB7I,Van91I RsaI 1 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 2 SfaNI 1 LweI SnaBI 1 Eco105I,BstSNI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TauI 1 TsoI 1 TspEI 3 TasI,Tsp509I,Sse9I TstI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BglI BglII BinI* BmeT110I BmtI BplI BsaBI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII Hpy166II Hpy178III*Hpy188I Hpy8I Hpy99I HspAI KasI KpnI MaeI MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MroNI MslI MstI* MvaI NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqI TaqII TatI TfiI TseI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769