Restriction Map of MCD4/YKL165C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MCD4/YKL165C on chromosome XI from coordinates 140691 to 137932.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.30757

EMBOSS_001 Hpy99I | HgaI | |CviJI TspDTI \ \\ \ ATGTGGAACAAAACCAGAACGACGCTTCTGGCTGTTGGTGTCTTATTTCATTTATTTTAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACACCTTGTTTTGGTCTTGCTGCGAAGACCGACAACCACAGAATAAAGTAAATAAAATG / / / / Hpy99I | TspDTI SetI | HgaI CviJI M W N K T R T T L L A V G V L F H L F Y C G T K P E R R F W L L V S Y F I Y F T V E Q N Q N D A S G C W C L I S F I L P ----:----|----:----|----:----|----:----|----:----|----:----| X H F L V L V V S R A T P T K N * K N * X T S C F W F S A E P Q Q H R I E N I K H P V F G S R R K Q S N T D * K M * K V FatI TspDTI TspDTI Hin4I CviJI | EcoRV | AciI |CviAII | SduI SetI | | HphI | | BsrBI || NlaIII | HgiJII* \ \ \ \ \ \ \ \\ \ \ \ CTATGGTCTATTTTTGATATCTATTTCATTTCACCGCTCGTTCATGGTATGAGCCCATAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATACCAGATAAAAACTATAGATAAAGTAAAGTGGCGAGCAAGTACCATACTCGGGTATA / / / / // / // / / | | HphI TspDTI || | |FatI | CviJI | EcoRV || | | HgiJII* TspDTI || | | SduI || | CviAII || NlaIII |Hin4I BsrBI AciI L W S I F D I Y F I S P L V H G M S P Y Y G L F L I S I S F H R S F M V * A H I M V Y F * Y L F H F T A R S W Y E P I S ----:----|----:----|----:----|----:----|----:----|----:----| R H D I K S I * K M E G S T * P I L G Y G I T * K Q Y R N * K V A R E H Y S G M * P R N K I D I E N * R E N M T H A W I Hpy166II | MaeII TatI | |HphI |Csp6I | |BsaAI ||RsaI CviRI* | || SetI ||ScaI Hin4I | MnlI MmeI BccI | || TaiI \\\ \ \ \ \ \ \ \\ \ CAAAGTACTCCAACCCCTCCTGCAAAGAGATTGTTTTTGATTGTCGGTGATGGTTTACGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCATGAGGTTGGGGAGGACGTTTCTCTAACAAAAACTAACAGCCACTACCAAATGCA //// / / / / ///// |||Hin4I | MnlI MmeI BccI ||||MaeII ||TatI CviRI* |||BsaAI |Csp6I ||HphI ScaI |TaiI RsaI |SetI Hpy166II Q S T P T P P A K R L F L I V G D G L R K V L Q P L L Q R D C F * L S V M V Y V K Y S N P S C K E I V F D C R * W F T C ----:----|----:----|----:----|----:----|----:----|----:----| * L V G V G G A F L N N K I T P S P K R D F Y E L G E Q L S I T K S Q R H H N V L T S W G R R C L S Q K Q N D T I T * T BetI* BsiYI* BspMII* BsgI |HpaII |MaeIII |Hpy178III* |Tsp45I || BciVI || BseGI || | ApoI HgiCI* CviRI* FokI || | BsrI || | TspEI | NlaIV \ \ \\ \ \ \\ \ \ \ \ GCAGATACCACTTTTGATAAAGTCACTCATCCAGTATCCGGAAAAACAGAATTTCTGGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTATGGTGAAAACTATTTCAGTGAGTAGGTCATAGGCCTTTTTGTCTTAAAGACCGT / / // / / // / / / CviRI* BsgI || BsrI | || BciVI TspEI NlaIV FokI |Tsp45I | |BspMII* ApoI SetI |MaeIII | |BetI* BseGI | Hpy178III* | HpaII BsiYI* A D T T F D K V T H P V S G K T E F L A Q I P L L I K S L I Q Y P E K Q N F W H R Y H F * * S H S S S I R K N R I S G T ----:----|----:----|----:----|----:----|----:----|----:----| A S V V K S L T V * G T D P F V S N R A H L Y W K Q Y L * E D L I R F F L I E P C I G S K I F D S M W Y G S F C F K Q C MboI BglII XhoII SetI | DpnI TspDTI SetI | |BstKTI | Tsp4CI* \ \ \\ \ \ CCTTTTATTAGATCTTTGGTAATGAATAATGCCACCTACGGTATATCACATACCAGAATG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAATAATCTAGAAACCATTACTTATTACGGTGGATGCCATATAGTGTATGGTCTTAC / // / / / / / HgiCI* || XhoII | | Tsp4CI* BsmI || BglII | TspDTI || MboI SetI |DpnI BstKTI P F I R S L V M N N A T Y G I S H T R M L L L D L W * * I M P P T V Y H I P E C F Y * I F G N E * C H L R Y I T Y Q N A ----:----|----:----|----:----|----:----|----:----|----:----| G K I L D K T I F L A V * P I D C V L I V K * * I K P L S Y H W R R Y I V Y W F R K N S R Q Y H I I G G V T Y * M G S H BssKI EcoRII | ScrFI | BseBI | | FatI MwoI TfiI | | |CviAII | BseYI BsmI HinfI | | || NlaIII | | GsaI BceAI MmeI \ \ \ \ \\ \ \ \ \ \ \ CCAACTGAATCCCGTCCTGGTCATGTTGCTATGATTGCTGGGTTTTACGAAGATGTTAGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGACTTAGGGCAGGACCAGTACAACGATACTAACGACCCAAAATGCTTCTACAATCA / / // // / / / / / / HinfI | || |FatI MwoI | BseYI | MmeI MboII TfiI | || CviAII GsaI BceAI | |NlaIII | EcoRII | BssKI BseBI ScrFI P T E S R P G H V A M I A G F Y E D V S Q L N P V L V M L L * L L G F T K M L V N * I P S W S C C Y D C W V L R R C * C ----:----|----:----|----:----|----:----|----:----|----:----| G V S D R G P * T A I I A P N * S S T L A L Q I G D Q D H Q * S Q Q T K R L H * W S F G T R T M N S H N S P K V F I N T MboII | MaeIII TspEI | Tsp45I SetI | TaqI \ \ \ \ \ GCCGTCACAAAAGGTTGGAAGTCAAACCCTGTCAATTTCGATAGTTTTTTCAACCAATCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCAGTGTTTTCCAACCTTCAGTTTGGGACAGTTAAAGCTATCAAAAAAGTTGGTTAGA / / / / / | SetI | TaqI TspDTI Tsp45I TspEI MaeIII A V T K G W K S N P V N F D S F F N Q S P S Q K V G S Q T L S I S I V F S T N L R H K R L E V K P C Q F R * F F Q P I Y ----:----|----:----|----:----|----:----|----:----|----:----| A T V F P Q F D F G T L K S L K K L W D H R * L L N S T L G Q * N R Y N K * G I G D C F T P L * V R D I E I T K E V L R Hin6I |GlaI ||HhaI Hpy166II SetI |||HaeII TspDTI HphI | SetI | BccI |||| Hpy188I \ \ \ \ \ \ \\\\ \ ACTCATACTTATTCATTCGGTTCACCTGACATTTTACCTATGTTCAAAGATGGCGCTTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTATGAATAAGTAAGCCAAGTGGACTGTAAAATGGATACAAGTTTCTACCGCGAAGA / // / / //// / HphI |SetI SetI BccI |||| Hpy188I Hpy166II |||Hin6I ||GlaI |HhaI HaeII T H T Y S F G S P D I L P M F K D G A S L I L I H S V H L T F Y L C S K M A L L S Y L F I R F T * H F T Y V Q R W R F * ----:----|----:----|----:----|----:----|----:----|----:----| V * V * E N P E G S M K G I N L S P A E * E Y K N M R N V Q C K V * T * L H R K S M S I * E T * R V N * R H E F I A S R BseGI |MboI Hin4I |BclI Hin4I || DpnI Hin4I HindII || |BstKTI Hin4I Hpy166II || || MnlI | MboII | MslI || || FokI TaqI | | BcgI \ \ \\ \\ \ \ \ \ \ GACCCAAATAAAGTTGACACTTGGATGTATGATCATACTTTCGAGGATTTTACGCAATCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGTTTATTTCAACTGTGAACCTACATACTAGTATGAAAGCTCCTAAAATGCGTTAGA / / / / // // / // / / | | MslI | || |MnlI | |TaqI | BcgI | Hpy166II | || BclI | Hin4I MboII | HindII | || MboI | Hin4I Hin4I | |DpnI FokI Hin4I | BstKTI BseGI D P N K V D T W M Y D H T F E D F T Q S T Q I K L T L G C M I I L S R I L R N L P K * S * H L D V * S Y F R G F Y A I F ----:----|----:----|----:----|----:----|----:----|----:----| S G F L T S V Q I Y S * V K S S K V C D Q G L Y L Q C K S T H D Y K R P N * A I V W I F N V S P H I I M S E L I K R L R SfaNI | TaqI | | AluI MboI | | CviJI | DpnI | | BstXI | |BstKTI | | |BccI FokI | ||TspEI TspEI | | ||SetI BseGI | BcgI | ||| BinI* | AjuI \ \ \\\ \ \ \ \ \\\ \ \ \ TCCATCGAGCTGGATGCTTTTGTCTTTAGACACTTGGATCAATTATTCCACAATTCCACA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAGCTCGACCTACGAAAACAGAAATCTGTGAACCTAGTTAATAAGGTGTTAAGGTGT / / / / / / / // / // / // | | | BccI BseGI | FokI || | || AjuI |TspRI | | CviJI BcgI || | |BinI* TspEI | | AluI || | TspEI | SfaNI || MboI | TaqI |DpnI | SetI BstKTI BstXI S I E L D A F V F R H L D Q L F H N S T P S S W M L L S L D T W I N Y S T I P H H R A G C F C L * T L G S I I P Q F H T ----:----|----:----|----:----|----:----|----:----|----:----| E M S S S A K T K L C K S * N N W L E V K W R A P H K Q R * V S P D I I G C N W G D L Q I S K D K S V Q I L * E V I G C TspEI TspDTI TspRI | AjuI | Tsp4CI* \ \ \ \ \ CTGAACTCAACATTGGATTATGAAATTAGGCAAGACGGTAATGTATTCTTTCTACATCTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTGAGTTGTAACCTAATACTTTAATCCGTTCTGCCATTACATAAGAAAGATGTAGAT / / / / AjuI TspEI | Tsp4CI* TspDTI L N S T L D Y E I R Q D G N V F F L H L * T Q H W I M K L G K T V M Y S F Y I Y E L N I G L * N * A R R * C I L S T S T ----:----|----:----|----:----|----:----|----:----|----:----| S F E V N S * S I L C S P L T N K R C R V S S L M P N H F * A L R Y H I R E V D Q V * C Q I I F N P L V T I Y E K * M * MaeI SetI HpaII Tth111I \ \ \ \ CTAGGTTGCGATACTGCCGGACATTCTTATAGACCATATTCTGCCGAGTATTATGACAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCAACGCTATGACGGCCTGTAAGAATATCTGGTATAAGACGGCTCATAATACTGTTA // / / |MaeI HpaII Tth111I SetI L G C D T A G H S Y R P Y S A E Y Y D N * V A I L P D I L I D H I L P S I M T M R L R Y C R T F L * T I F C R V L * Q C ----:----|----:----|----:----|----:----|----:----|----:----| S P Q S V A P C E * L G Y E A S Y * S L V L N R Y Q R V N K Y V M N Q R T N H C * T A I S G S M R I S W I R G L I I V I NmeAIII | MboI | BclI Tth111I | | DpnI | HindII | | |BstKTI | Hpy166II AciI \ \ \\ \ \ \ GTCAAATATATTGATGATCAAATCCCTATCCTTATAGACAAAGTCAACAAGTTTTTTGCG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTATATAACTACTAGTTTAGGGATAGGAATATCTGTTTCAGTTGTTCAAAAAACGC / // / / / / NmeAIII || BclI | Hpy166II AciI || MboI | HindII |DpnI Tth111I BstKTI V K Y I D D Q I P I L I D K V N K F F A S N I L M I K S L S L * T K S T S F L R Q I Y * * S N P Y P Y R Q S Q Q V F C G ----:----|----:----|----:----|----:----|----:----|----:----| T L Y I S S * I G I R I S L T L L N K A H * I Y Q H D F G * G * L C L * C T K Q D F I N I I L D R D K Y V F D V L K K R CviRI* | MboI | | DpnI MboI | | |BstKTI | DpnI | | ||FokI | |FatI | | ||EcoP15I | |BstKTI | | |||FatI | ||CviAII | | ||||CviAII AciI | ||| NlaIII | | ||||| BinI* \ \ \\\ \ \ \ \\\\\ \ GACGACAAAACCGCATTTATTTTTACAGCAGATCATGGTATGAGTGCATTTGGATCACAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGTTTTGGCGTAAATAAAAATGTCGTCTAGTACCATACTCACGTAAACCTAGTGTA / //// // / // /// / AciI |||| |FatI CviRI* || ||| CviAII |||| CviAII || ||| FokI |||MboI || ||EcoP15I ||NlaIII || ||DraIII |DpnI || |NlaIII BstKTI || MboI |DpnI BstKTI D D K T A F I F T A D H G M S A F G S H T T K P H L F L Q Q I M V * V H L D H M R Q N R I Y F Y S R S W Y E C I W I T W ----:----|----:----|----:----|----:----|----:----|----:----| S S L V A N I K V A S * P I L A N P D C P R C F R M * K * L L D H Y S H M Q I V V V F G C K N K C C I M T H T C K S * M MaeIII Tsp45I AsuI* NlaIII AvaII DraIII DraII MnlI | Tsp4CI* PpuMI |FauI | | BseGI |BmgT120I || MwoI | | | HphI ||NlaIV || | AciI \ \ \ \ \\\ \\ \ \ GGTGACGGTCATCCTAACAACACAAGGACCCCTCTTGTTGCTTGGGGTGCGGGTTTGAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGCCAGTAGGATTGTTGTGTTCCTGGGGAGAACAACGAACCCCACGCCCAAACTTA / // / // / // / | || HphI |PpuMI | |FauI AciI | |BseGI |DraII | MwoI | Tsp4CI* |AvaII MnlI | Tsp45I |AsuI* | MaeIII BmgT120I BinI* NlaIV FatI G D G H P N N T R T P L V A W G A G L N V T V I L T T Q G P L L L L G V R V * I * R S S * Q H K D P S C C L G C G F E * ----:----|----:----|----:----|----:----|----:----|----:----| P S P * G L L V L V G R T A Q P A P K F H H R D D * C C L S G E Q Q K P H P N S T V T M R V V C P G R K N S P T R T Q I MmeI BsrI |AluI | TatI |CviJI | |Csp6I BetI* Hpy188I || SetI | ||RsaI |HpaII | BciVI TspEI || | TaqI \ \\\ \\ \ \ \ \\ \ \ AAACCAGTACATAATCCTTTTCCGGTATCCGACAACTATACTGAAAATTGGGAGCTTTCG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGTCATGTATTAGGAAAAGGCCATAGGCTGTTGATATGACTTTTAACCCTCGAAAGC / /// // / / / // / / BsrI ||TatI || | BciVI | || CviJI TaqI |Csp6I || Hpy188I | || AluI RsaI |BetI* | |SetI HpaII | MmeI TspEI K P V H N P F P V S D N Y T E N W E L S N Q Y I I L F R Y P T T I L K I G S F R T S T * S F S G I R Q L Y * K L G A F E ----:----|----:----|----:----|----:----|----:----|----:----| L G T C L G K G T D S L * V S F Q S S E Y V L V Y D K E P I R C S Y Q F N P A K F W Y M I R K R Y G V V I S F I P L K R MwoI MseI Cac8I BstAPI MseI \ \ \ \ AGCATTAAAAGAAATGATGTCAAGCAAGCAGATATTGCTTCTTTAATGTCATACTTGATT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTAATTTTCTTTACTACAGTTCGTTCGTCTATAACGAAGAAATTACAGTATGAACTAA / / / / MseI | BstAPI MseI | MwoI Cac8I S I K R N D V K Q A D I A S L M S Y L I A L K E M M S S K Q I L L L * C H T * L H * K K * C Q A S R Y C F F N V I L D W ----:----|----:----|----:----|----:----|----:----|----:----| L M L L F S T L C A S I A E K I D Y K I S C * F F H H * A L L Y Q K K L T M S S A N F S I I D L L C I N S R * H * V Q N BccI ApoI | TaqI Hpy166II TspEI MaeIII HphI | ClaI \ \ \ \ \ \ GGTGTGAACTATCCTAAAAATTCAGTTGGTGAGTTACCAATAGCATATATCGATGGAAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCACACTTGATAGGATTTTTAAGTCAACCACTCAATGGTTATCGTATATAGCTACCTTTT / / / / / / Hpy166II TspEI | HphI BccI ClaI ApoI MaeIII TaqI G V N Y P K N S V G E L P I A Y I D G K V * T I L K I Q L V S Y Q * H I S M E K C E L S * K F S W * V T N S I Y R W K R ----:----|----:----|----:----|----:----|----:----|----:----| P T F * G L F E T P S N G I A Y I S P F Q H S S D * F N L Q H T V L L M Y R H F T H V I R F I * N T L * W Y C I D I S F MaeIII Tsp45I | HindIII | | AluI | | CviJI | | | SetI | | | Cac8I | | | | AciI | | | | BisI | | | | |BlsI | | | | ||TauI TatI | | | | ||| TatI |Csp6I | | | | ||| Bsp1407I ||RsaI | | | | ||| |Csp6I ||ScaI | | | | ||| ||RsaI ||| DdeI \ \ \ \ \\\ \\\ \\\ \ GAAAGTGACAAGCTTGCCGCATTGTACAACAACGCAAGAAGCATTTTAGAGCAGTACTTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCACTGTTCGAACGGCGTAACATGTTGTTGCGTTCTTCGTAAAATCTCGTCATGAAT // / / //// /// /// / || | | |||AciI ||Bsp1407I ||| DdeI || | | ||BisI ||TatI ||TatI || | | |BlsI |Csp6I |Csp6I || | | TauI RsaI ScaI || | HindIII RsaI || | Cac8I || CviJI || AluI |SetI Tsp45I MaeIII E S D K L A A L Y N N A R S I L E Q Y L K V T S L P H C T T T Q E A F * S S T * K * Q A C R I V Q Q R K K H F R A V L S ----:----|----:----|----:----|----:----|----:----|----:----| S L S L S A A N Y L L A L L M K S C Y K L F H C A Q R M T C C R L F C K L A T S F T V L K G C Q V V V C S A N * L L V * MlyI TspEI PleI | FalI BdaI MnlI |SetI HinfI | FalI PsiI BdaI \ \\ \ \ \ \ \ GTCAAGCAAGATGAGGTAATAGACTCTCAATTTTTTTATAAGGAATACTTCAAGTTTGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCGTTCTACTCCATTATCTGAGAGTTAAAAAAATATTCCTTATGAAGTTCAAACAA / / // // / / / / MnlI | |PleI |FalI TspEI PsiI BdaI FalI | MlyI |FalI BdaI FalI SetI HinfI V K Q D E V I D S Q F F Y K E Y F K F V S S K M R * * T L N F F I R N T S S L L Q A R * G N R L S I F L * G I L Q V C * ----:----|----:----|----:----|----:----|----:----|----:----| T L C S S T I S E * N K * L S Y K L N T L * A L H P L L S E I K K Y P I S * T Q D L L I L Y Y V R L K K I L F V E L K N Ksp632I* MboII |DdeI | MseI FalI || BdaI | SetI Hin4II* FalI BsmAI || BdaI | |TspEI | Hpy188I \ \ \\ \ \ \\ \ \ GAAAAGTCTCATTCACATTACTTAGAAGAGATAGAAACCTTAATTCAGCGTATATCTGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCAGAGTAAGTGTAATGAATCTTCTCTATCTTTGGAATTAAGTCGCATATAGACTT / / // / / / / / BsmAI | |DdeI MboII | TspEI | Hpy188I | Ksp632I* SetI MseI Hin4II* BdaI BdaI E K S H S H Y L E E I E T L I Q R I S E K S L I H I T * K R * K P * F S V Y L K K V S F T L L R R D R N L N S A Y I * R ----:----|----:----|----:----|----:----|----:----|----:----| S F D * E C * K S S I S V K I * R I D S Q F T E N V N S L L S L F R L E A Y I Q F L R M * M V * F L Y F G * N L T Y R F MnlI | EcoNI | | BsiYI* Eco57I | | | TspEI Eco57MI | | | | MseI | HphI | | | | VspI CviRI* Hin4II* \ \ \ \ \ \ \ \ \ GGAGAAAACTATTTGGAACAAGAAGCAATCACCCTTACAGAGGAATTAATGCAGATAACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCTTTTGATAAACCTTGTTCTTCGTTAGTGGGAATGTCTCCTTAATTACGTCTATTGT / / / / / // / / | HphI | | EcoNI || | Hin4II* Eco57MI | BsiYI* || CviRI* Eco57I MnlI |VspI |MseI TspEI G E N Y L E Q E A I T L T E E L M Q I T E K T I W N K K Q S P L Q R N * C R * H R K L F G T R S N H P Y R G I N A D N I ----:----|----:----|----:----|----:----|----:----|----:----| P S F * K S C S A I V R V S S N I C I V L L F S N P V L L L * G * L P I L A S L S F V I Q F L F C D G K C L F * H L Y C SetI | TspEI | TspDTI | | BsiYI* | | | TfiI SetI | | | HinfI |Hpy166II | | | |PsrI MaeIII \\ \ \ \ \\ \ TTGGAAGGTTTACATTATTTGACAACCTATAATTGGAGATTCATTAGAACTATTGTTACA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTCCAAATGTAATAAACTGTTGGATATTAACCTCTAAGTAATCTTGATAACAATGT / / / // / / // SetI Hpy166II | || TspEI HinfI |TaqII | || PsrI TfiI MaeIII | |BsiYI* | TspDTI SetI L E G L H Y L T T Y N W R F I R T I V T W K V Y I I * Q P I I G D S L E L L L H G R F T L F D N L * L E I H * N Y C Y I ----:----|----:----|----:----|----:----|----:----|----:----| N S P K C * K V V * L Q L N M L V I T V M P L N V N N S L R Y N S I * * F * Q * Q F T * M I Q C G I I P S E N S S N N C MboI BdaI XhoII BdaI | DpnI |PsiI | |BstKTI || SspI TaqII PsrI | || BinI* || | TspDTI XmnI \ \ \ \\ \ \\ \ \ \ TTTGGGTTTGTTGGGTGGATCTTTTTTTCTTTTATAATATTTTTGAAATCATTCATATTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCCAAACAACCCACCTAGAAAAAAAGAAAATATTATAAAAACTTTAGTAAGTATAAT / // / / / / / / / PsrI || | | | | | TspDTI XmnI || | | | | SspI || | | | PsiI || | | BdaI || | | BdaI || | BinI* || XhoII || MboI |DpnI BstKTI F G F V G W I F F S F I I F L K S F I L L G L L G G S F F L L * Y F * N H S Y * W V C W V D L F F F Y N I F E I I H I R ----:----|----:----|----:----|----:----|----:----|----:----| N P N T P H I K K E K I I N K F D N M N M Q T Q Q T S R K K K * L I K S I M * I K P K N P P D K K R K Y Y K Q F * E Y * MseI | CviJI | |FatI | ||CviAII BdaI | ||| CviRI* BdaI MaeIII | ||| NlaIII |TspEI HgaI HphI Tsp45I | ||| | XcmI NlaIV \\ \ \ \ \ \\\ \ \ \ GAGAATGTAATTGATGACCAAAAAGCGTCACCATTAAGCCATGCAGTATTTGGTTCCATA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTACATTAACTACTGGTTTTTCGCAGTGGTAATTCGGTACGTCATAAACCAAGGTAT / / / / / // // / / BdaI TspEI HgaI | | || || XcmI NlaIV BdaI HphI | | || |CviRI* | | || |FatI | | || CviAII | | |NlaIII | | CviJI | MseI Tsp45I MaeIII E N V I D D Q K A S P L S H A V F G S I R M * L M T K K R H H * A M Q Y L V P * E C N * * P K S V T I K P C S I W F H R ----:----|----:----|----:----|----:----|----:----|----:----| S F T I S S W F A D G N L W A T N P E M L S H L Q H G F L T V M L G H L I Q N W L I Y N I V L F R * W * A M C Y K T G Y FatI AflIII BspLU11I* |CviAII || NspI || Csp6I ApoI || NlaIII TspEI TspEI TspGWI TspEI || |RsaI \ \ \ \ \\ \\ GGAATTTTACTAAATTGGATTTTGTTCTACCAACATTCTCCGTTCAATTTTTACATGTAC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTAAAATGATTTAACCTAAAACAAGATGGTTGTAAGAGGCAAGTTAAAAATGTACATG / / / / / //// TspEI TspEI TspGWI | | |||Csp6I ApoI | | ||RsaI | | ||SetI | | |BspLU11I* | | |AflIII | | |FatI | | CviAII | NlaIII | NspI TspEI G I L L N W I L F Y Q H S P F N F Y M Y E F Y * I G F C S T N I L R S I F T C T N F T K L D F V L P T F S V Q F L H V P ----:----|----:----|----:----|----:----|----:----|----:----| P I K S F Q I K N * W C E G N L K * M Y L F K V L N S K T R G V N E T * N K C T S N * * I P N Q E V L M R R E I K V H V TspGWI | BinI* | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | || Csp6I | | | || |RsaI | | | || || MaeII | | | || || | SetI AluI | | | || || | TaiI Hin4II* CviJI | | | || || | |FalI SetI | XcmI | SetI | | | || || | |FalI \ \ \ \ \ \ \ \ \\ \\ \ \\ CTTCTTTTCCCATTATACTTTTGGAGCTATATTTTTACAAATAGATCCGTACTACGTTCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGAAAAGGGTAATATGAAAACCTCGATATAAAAATGTTTATCTAGGCATGATGCAAGT / / / / / / // / // / / / | XcmI | CviJI | | || | || | | SetI Hin4II* | AluI | | || | || | MaeII SetI | | || | || TaiI | | || | || SetI | | || | || FalI | | || | || FalI | | || | |Csp6I | | || | RsaI | | || XhoII | | || MboI | | |DpnI | | BstKTI | BinI* TspGWI L L F P L Y F W S Y I F T N R S V L R S F F S H Y T F G A I F L Q I D P Y Y V Q S F P I I L L E L Y F Y K * I R T T F R ----:----|----:----|----:----|----:----|----:----|----:----| R R K G N Y K Q L * I K V F L D T S R E G E K G M I S K S S Y K * L Y I R V V N K K E W * V K P A I N K C I S G Y * T * Acc65I HgiCI* |Csp6I ||RsaI ||SetI ||NlaIV ||| KpnI ||| | SetI ||| | | FalI SetI ||| | | FalI | MboII ||| | | |StyI | | ApoI ||| | | |SecI* | | TspEI ||| | | ||BsiYI* | | EcoRI ||| | | ||| MnlI MseI \ \ \ \\\ \ \ \\\ \ \ GGTATCAAGGAATTCTTCAAAGGTACCTCTCCTTGGAAAAGAGTTTTAATAACAATCTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGTTCCTTAAGAAGTTTCCATGGAGAGGAACCTTTTCTCAAAATTATTGTTAGAGA / / / / /// / / / MboII EcoRI | | ||| | SecI* MseI TspEI | | ||| | MnlI ApoI | | ||| | StyI | | ||| BsiYI* | | ||HgiCI* | | ||Acc65I | | |Csp6I | | |FalI | | |FalI | | NlaIV | | RsaI | | SetI | KpnI SetI G I K E F F K G T S P W K R V L I T I S V S R N S S K V P L L G K E F * * Q S L Y Q G I L Q R Y L S L E K S F N N N L Y ----:----|----:----|----:----|----:----|----:----|----:----| P I L S N K L P V E G Q F L T K I V I E L Y * P I R * L Y R E K S F L K L L L R T D L F E E F T G R R P F S N * Y C D R MaeII | SetI | TaiI | |Hpy166II MnlI TspEI BccI | || TspEI \ \ \ \ \\ \ ATTATATCAGTTTATGAGGGAATTGTATATGGATTTTTCCATAGATGGACGTTTACGCTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAATATAGTCAAATACTCCCTTAACATATACCTAAAAAGGTATCTACCTGCAAATGCGAT / / / / / / MnlI TspEI BccI | | Hpy166II | MaeII TaiI SetI I I S V Y E G I V Y G F F H R W T F T L L Y Q F M R E L Y M D F S I D G R L R * Y I S L * G N C I W I F P * M D V Y A N ----:----|----:----|----:----|----:----|----:----|----:----| I I D T * S P I T Y P N K W L H V N V S * * I L K H P F Q I H I K G Y I S T * A N Y * N I L S N Y I S K E M S P R K R * TspGWI | AluI | CviJI | | SetI | | |HphI \ \ \\ ATTACAAATATATTGGCGTTTTACCCGTTTATTTGTGGGGTGAGAGAGCTATCCGTGAAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGTTTATATAACCGCAAAATGGGCAAATAAACACCCCACTCTCTCGATAGGCACTTA / / / / / TspEI | | | HphI | | CviJI | | AluI | SetI TspGWI I T N I L A F Y P F I C G V R E L S V N L Q I Y W R F T R L F V G * E S Y P * I Y K Y I G V L P V Y L W G E R A I R E Y ----:----|----:----|----:----|----:----|----:----|----:----| I V F I N A N * G N I Q P T L S S D T F L * L Y I P T K G T * K H P S L A I R S N C I Y Q R K V R K N T P H S L * G H I MboI | DpnI | |BstKTI MseI | || SpeI |MnlI | || BinI* ||HgaI | || |MaeI SetI |||TspEI \ \\ \\ \ \\\\ ATATTGTGGATCATAACTAGTGTTCTTTTATCTACATTTACCTTATTTGACGCTGTTAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TATAACACCTAGTATTGATCACAAGAAAATAGATGTAAATGGAATAAACTGCGACAATTT // / / // / / / || MboI | |SpeI SetI | MseI |DpnI | MaeI MnlI BstKTI BinI* I L W I I T S V L L S T F T L F D A V K Y C G S * L V F F Y L H L P Y L T L L K I V D H N * C S F I Y I Y L I * R C * N ----:----|----:----|----:----|----:----|----:----|----:----| I N H I M V L T R K D V N V K N S A T L Y I T S * L * H E K I * M * R I Q R Q * Y Q P D Y S T N K * R C K G * K V S N F TspRI | MwoI MseI | |BspCNI MaeI VspI DdeI | ||BseMII \ \ \ \ \\\ ATTGAGGACTTGAACCAGATACATCTAGCAGGGTTATTAATCATTCTCAGTGCCTTTTAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTCCTGAACTTGGTCTATGTAGATCGTCCCAATAATTAGTAAGAGTCACGGAAAATA / / / / / / // TspEI MaeI VspI | DdeI | |BseMII HgaI MseI TspRI | BspCNI MwoI I E D L N Q I H L A G L L I I L S A F Y L R T * T R Y I * Q G Y * S F S V P F M * G L E P D T S S R V I N H S Q C L L C ----:----|----:----|----:----|----:----|----:----|----:----| I S S K F W I C R A P N N I M R L A K * F Q P S S G S V D L L T I L * E * H R K N L V Q V L Y M * C P * * D N E T G K I PfoI BssKI MluI EcoRII AflIII ApoI | ScrFI ApoI | FnuDII* TspEI | BseBI TspEI | | Cac8I MwoI |BbvI \ \ \ \ \ \ \ \\ GCTCTTTACAAAATACATTCCAGGATAAATTCCTACACGCGTGCTATATTTGCCATTCAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGAAATGTTTTATGTAAGGTCCTATTTAAGGATGTGCGCACGATATAAACGGTAAGTT / / / / / / | EcoRII TspEI | | MwoI | BssKI ApoI | AflIII | PfoI | Cac8I BseBI | MluI ScrFI FnuDII* A L Y K I H S R I N S Y T R A I F A I Q L F T K Y I P G * I P T R V L Y L P F K S L Q N T F Q D K F L H A C Y I C H S N ----:----|----:----|----:----|----:----|----:----|----:----| A R * L I C E L I F E * V R A I N A M * H E K C F V N W S L N R C A H * I Q W E S K V F Y M G P Y I G V R T S Y K G N L TseI CviJI |BisI ||BlsI ||| FatI ||| |CviAII ||| || NlaIII ||| || |BglI AluI ||| || |MwoI CviJI StyI ||| || || AciI |DdeI SecI* ||| || || | MaeIII ||SetI \ \\\ \\ \\ \ \ \\\ ATTTCCTTGGTGGCTGCCATGTTGGCGGTTACTCATCGTTCAGTTATCTCTTTACAGCTA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGAACCACCGACGGTACAACCGCCAATGAGTAGCAAGTCAATAGAGAAATGTCGAT // / ///// /// / / / / |BbvI | ||||| ||FatI AciI MaeIII | CviJI TspEI | ||||| |CviAII | AluI ApoI | ||||| MwoI SetI | ||||| BglI | ||||NlaIII | |||TseI | ||BisI | |BlsI | CviJI SecI* StyI I S L V A A M L A V T H R S V I S L Q L F P W W L P C W R L L I V Q L S L Y S * F L G G C H V G G Y S S F S Y L F T A K ----:----|----:----|----:----|----:----|----:----|----:----| I E K T A A M N A T V * R E T I E K C S F K R P P Q W T P P * E D N L * R K V A N G Q H S G H Q R N S M T * N D R * L * PleI HinfI |MlyI MaeIII |MaeIII ||BccI BseGI BstEII |Tsp45I ||SetI |TspEI FokI \ \\ \\\ \\ \ AGACAAGGGTTACCAAGAGAGTCACAGGTCGCTGGATGGATAATTTTTTTTGTATCTCTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTCCCAATGGTTCTCTCAGTGTCCAGCGACCTACCTATTAAAAAAAACATAGAGAA / / / / / / / / / DdeI BstEII | | | BccI BseGI TspEI FokI MaeIII | | PleI | | MlyI | Tsp45I | MaeIII | SetI HinfI R Q G L P R E S Q V A G W I I F F V S L D K G Y Q E S H R S L D G * F F L Y L F T R V T K R V T G R W M D N F F C I S F ----:----|----:----|----:----|----:----|----:----|----:----| L C P N G L S D C T A P H I I K K T D R L V L T V L L T V P R Q I S L K K Q I E S L P * W S L * L D S S P Y N K K Y R K Hin4I MboI TspEI CviJI Hin4I BclI \ \ \ \ TTTGTAATGCCAATTTTACATTATAGGAAGCCCAACAATGATTACAAAGTGAGATTATTG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAACATTACGGTTAAAATGTAATATCCTTCGGGTTGTTACTAATGTTTCACTCTAATAAC / / / / TspEI CviJI Hin4I BstKTI Hin4I F V M P I L H Y R K P N N D Y K V R L L L * C Q F Y I I G S P T M I T K * D Y * C N A N F T L * E A Q Q * L Q S E I I D ----:----|----:----|----:----|----:----|----:----|----:----| K T I G I K C * L F G L L S * L T L N N K Q L A L K V N Y S A W C H N C L S I I K Y H W N * M I P L G V I I V F H S * Q TaqI SetI BseGI AsuII DpnI FokI Hin4I | Hin4II* | TfiI |BstKTI |MseI Hin4I | | BccI | HinfI \\ \\ \ \ \ \ \ \ ATCATTTATTTAACCTTCGCACCATCCTTTATCATTTTGACTATATCATTCGAATCCCTT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAAATAAATTGGAAGCGTGGTAGGAAATAGTAAAACTGATATAGTAAGCTTAGGGAA / / /// / / / / / | BclI ||FokI | Hin4II* BccI | HinfI | MboI |MseI BseGI | TfiI DpnI |SetI AsuII Hin4I TaqI Hin4I I I Y L T F A P S F I I L T I S F E S L S F I * P S H H P L S F * L Y H S N P F H L F N L R T I L Y H F D Y I I R I P F ----:----|----:----|----:----|----:----|----:----|----:----| I M * K V K A G D K I M K V I D N S D R S * K N L R R V M R * * K S * I M R I G D N I * G E C W G K D N Q S Y * E F G K Hpy166II | SpeI | |MaeI | || MaeIII | || | FatI | || | |CviAII | || | || NlaIII | || | || |Csp6I | || | || ||RsaI TspEI \ \\ \ \\ \\\ \ TTCTACTTCTTGTTCACTAGTTACATGGTACAATGGATTGAAATTGAGAACAAAATCAAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATGAAGAACAAGTGATCAATGTACCATGTTACCTAACTTTAACTCTTGTTTTAGTTT / // // // // / | || || || |Csp6I TspEI | || || || RsaI | || || |FatI | || || CviAII | || |MaeIII | || NlaIII | |SpeI | MaeI Hpy166II F Y F L F T S Y M V Q W I E I E N K I K S T S C S L V T W Y N G L K L R T K S K L L L V H * L H G T M D * N * E Q N Q R ----:----|----:----|----:----|----:----|----:----|----:----| K * K K N V L * M T C H I S I S F L I L K R S R T * * N C P V I S Q F Q S C F * E V E Q E S T V H Y L P N F N L V F D F BbvII* | TsoI | MboII | |TspDTI | || TspEI | || | MaeIII | || | | TspDTI | || | | | DdeI \ \\ \ \ \ \ GAAATGAAGACCCAAAAAGATGAAAATTGGTTACAAGTGCTAAGAGTTTCAGTAATCGGG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACTTCTGGGTTTTTCTACTTTTAACCAATGTTCACGATTCTCAAAGTCATTAGCCC // / // / |TspDTI | |MaeIII DdeI |BbvII* | TspDTI |MboII TspEI TsoI E M K T Q K D E N W L Q V L R V S V I G K * R P K K M K I G Y K C * E F Q * S G N E D P K R * K L V T S A K S F S N R V ----:----|----:----|----:----|----:----|----:----|----:----| S I F V W F S S F Q N C T S L T E T I P L F S S G F L H F N T V L A L L K L L R F H L G L F I F I P * L H * S N * Y D P MaeIII | BsrI | | MaeII | | | SetI | | | TaiI | | | | Hpy99I | | | | |MboII | | | | |TspDTI Ksp632I* BsmI BarI | | | | || TspDTI | BarI \ \ \ \ \ \ \\ \ \ \ TTCTTTTTACTTCAAGTCGCATTCTTTGGAACTGGTAACGTCGCTTCAATCTCTTCATTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAAAAATGAAGTTCAGCGTAAGAAACCTTGACCATTGCAGCGAAGTTAGAGAAGTAAA / / / //// // / / / BsmI BarI | |||| || | BarI Ksp632I* | |||| || TspDTI | |||| |MboII | |||| TspDTI | |||MaeII | ||MaeIII | |Hpy99I | TaiI | SetI BsrI F F L L Q V A F F G T G N V A S I S S F S F Y F K S H S L E L V T S L Q S L H F L F T S S R I L W N W * R R F N L F I F ----:----|----:----|----:----|----:----|----:----|----:----| N K K S * T A N K P V P L T A E I E E N T R K V E L R M R Q F Q Y R R K L R K M E K * K L D C E K S S T V D S * D R * K TspEI | BinI* | | MboI | | | DpnI | | | |BstKTI | | | || BccI | | | || | Hpy178III* | | | || | | Hin6I PleI | | | || | | |GlaI HinfI |MlyI | | | || | | ||HhaI \ \\ \ \ \ \\ \ \ \\\ TCATTGGAGTCTGTTTGTAGATTGTTGCCAATTTTTGATCCTTTCCTGATGGGCGCATTA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAACCTCAGACAAACATCTAACAACGGTTAAAAACTAGGAAAGGACTACCCGCGTAAT / / // // / / / /// HinfI PleI || || | | | ||Hin6I MlyI || || | | | |GlaI || || | | | HhaI || || | | Hpy178III* || || | BccI || || MboI || |DpnI || BstKTI |TspEI BinI* S L E S V C R L L P I F D P F L M G A L H W S L F V D C C Q F L I L S * W A H Y I G V C L * I V A N F * S F P D G R I I ----:----|----:----|----:----|----:----|----:----|----:----| E N S D T Q L N N G I K S G K R I P A N K M P T Q K Y I T A L K Q D K G S P R M * Q L R N T S Q Q W N K I R E Q H A C * Hpy166II | FatI | |CviAII | || NspI AccI | || NlaIII SetI | || |StyI |BssNAI | || |AvrII |Hpy166II | || |SecI* || ApoI TspEI TspEI CviJI | || ||MaeI || TspEI \ \ \ \ \\ \\\ \\ \ TTGATGTTGAAATTGATAATTCCCTACGGGCTATTGTCCACATGCCTAGGTATACTGAAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AACTACAACTTTAACTATTAAGGGATGCCCGATAACAGGTGTACGGATCCATATGACTTA / / / / / // /// // TspEI TspEI CviJI | | || ||| |AccI | | || ||| Hpy166II | | || ||| BssNAI | | || ||SecI* | | || ||AvrII | | || ||StyI | | || |MaeI | | || SetI | | |FatI | | CviAII | NlaIII | NspI Hpy166II L M L K L I I P Y G L L S T C L G I L N * C * N * * F P T G Y C P H A * V Y * I D V E I D N S L R A I V H M P R Y T E F ----:----|----:----|----:----|----:----|----:----|----:----| N I N F N I I G * P S N D V H R P I S F I S T S I S L E R R A I T W M G L Y V S Q H Q F Q Y N G V P * Q G C A * T Y Q I Hin4I Hin4I MseI MseI |FatI |AhaIII* VspI ||CviAII || MseI |TspEI ||| NlaIII \\ \ \\ \\\ \ TTAAAACTTAACTTCAAGGACTACACAATCTCATCATTAATTATTTCCATGAGTGATATT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTGAATTGAAGTTCCTGATGTGTTAGAGTAGTAATTAATAAAGGTACTCACTATAA /// / / // / // ||MseI MseI | || | |FatI |AhaIII* | || | CviAII TspEI | || NlaIII ApoI | |TspEI | Hin4I | Hin4I VspI MseI L K L N F K D Y T I S S L I I S M S D I * N L T S R T T Q S H H * L F P * V I F K T * L Q G L H N L I I N Y F H E * Y S ----:----|----:----|----:----|----:----|----:----|----:----| K F S L K L S * V I E D N I I E M L S I N L V * S * P S C L R M M L * K W S H Y * F K V E L V V C D * * * N N G H T I N Hin4I Hin4I | SetI | | TstI | | MseI ApoI | | BsaXI TspEI | | |MmeI BsaXI | XmnI | | ||MnlI TspGWI | TstI \ \ \ \ \\\ \ \ \ CTGTCGTTGAATTTTTTCTACCTTTTAAGAACGGAGGGGTCGTGGTTGGATATTGGCATA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGCAACTTAAAAAAGATGGAAAATTCTTGCCTCCCCAGCACCAACCTATAACCGTAT / // / / // / / Hin4I || | | |MseI TspGWI BsaXI Hin4I || | | MnlI TstI TspEI || | MmeI XmnI || BsaXI ApoI |TstI SetI L S L N F F Y L L R T E G S W L D I G I C R * I F S T F * E R R G R G W I L A * V V E F F L P F K N G G V V V G Y W H N ----:----|----:----|----:----|----:----|----:----|----:----| R D N F K K * R K L V S P D H N S I P M E T T S N K R G K L F P P T T T P Y Q C Q R Q I K E V K * S R L P R P Q I N A Y XcmI TsoI | BinI* | | MboI TaqII | | | DpnI | TatI | | | |BstKTI FatI | |Csp6I | | | || TspDTI |CviAII | ||RsaI | | | || | MmeI || NlaIII | ||ScaI \ \ \ \\ \ \ \\ \ \ \\\ ACCATTTCCAACTATTGTTTGGCGATCCTATCATCTTTGTTCATGCTTATTTTGGAAGTA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAAAGGTTGATAACAAACCGCTAGGATAGTAGAAACAAGTACGAATAAAACCTTCAT // / // // / / // / // |XcmI | || || MmeI | |FatI TaqII |Csp6I TsoI | || |TspDTI | CviAII ScaI | || MboI NlaIII RsaI | |DpnI | BstKTI BinI* T I S N Y C L A I L S S L F M L I L E V P F P T I V W R S Y H L C S C L F W K Y H F Q L L F G D P I I F V H A Y F G S T ----:----|----:----|----:----|----:----|----:----|----:----| V M E L * Q K A I R D D K N M S I K S T L W K W S N N P S G I M K T * A * K P L G N G V I T Q R D * * R Q E H K N Q F Y FatI |CviAII || NlaIII \\ \ CTCGGTCATGTGTTGCTAAAAAATGTCATCATACAGGATAAAACCAAAAAAACACAATAG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCCAGTACACAACGATTTTTTACAGTAGTATGTCCTATTTTGGTTTTTTTGTGTTATC / / // TatI | |FatI | CviAII NlaIII L G H V L L K N V I I Q D K T K K T Q * S V M C C * K M S S Y R I K P K K H N X R S C V A K K C H H T G * N Q K N T I X ----:----|----:----|----:----|----:----|----:----|----:----| S P * T N S F F T M M C S L V L F V C Y V R D H T A L F H * * V P Y F W F F V I E T M H Q * F I D D Y L I F G F F C L L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AflIII 2 AhaIII* 1 DraI AjuI 1 AluI 6 AluBI ApoI 8 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 8 BceAI 1 BcgI 1 BciVI 2 BfuI BclI 3 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BglI 1 BglII 1 BinI* 7 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 1 BseYI 1 BsgI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspLU11I* 1 PscI,PciI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 12 BstXI 1 Cac8I 3 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CviAII 12 CviJI 12 CviKI-1 CviRI* 5 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 12 MalI DraII 1 EcoO109I DraIII 1 AdeI Eco57I 1 AcuI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 12 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 2 GsaI 1 HaeII 1 BstH2I HgaI 3 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 4 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 6 HpaII 3 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 3 Hpy99I 2 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 13 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MluI 1 MlyI 3 SchI MmeI 5 MnlI 9 MseI 13 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NmeAIII 1 NspI 2 BstNSI,XceI PfoI 1 PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsiI 2 AanI PsrI 1 RsaI 9 AfaI ScaI 3 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 30 SfaNI 1 LweI SpeI 2 BcuI,AhlI SspI 1 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 6 TaqII 2 TatI 5 TauI 1 TfiI 3 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 6 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 31 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 2 TscAI TstI 1 Tth111I 2 PflFI,PsyI,AspI VspI 3 PshBI,AseI XcmI 3 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AgeI AlfI AloI AlwNI ApaI ApaLI AscI AvaI BaeI BalI BamHI BbvCI Bce83I* BfiI BmeT110I BmtI BplI Bpu10I BsaBI BsePI BseRI BseSI BsiI* BslFI BsmFI Bsp120I BspHI BspMI BspOI BsrDI BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoT22I EgeI EheI Esp3I EspI* FaqI FseI FspAI GsuI HaeIII HgiAI* HpaI KasI MauBI McrI* MfeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NotI NruI NsiI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769