Restriction Map of YKL156C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YKL156C-A on chromosome XI from coordinates 159091 to 158975.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.9631

EMBOSS_001 Csp6I |RsaI || MboI || | DpnI SduI || | |BstKTI BssKI BseSI || | || AsuI* EcoRII | MseI || | || AvaII |SecI* | | MaeII || | || |BmgT120I ||ScrFI | | | SetI || | || || StyI ||BseBI | | | TaiI || | || || SecI* |||SetI | | | |MaeI || | || || | SetI PshAI \\\\ \ \ \ \\ \\ \ \\ \\ \ \ \ ATGTTCAAACAACCTGGGCACTTAACGTCTAGGAAGTACGATCTTGGACCTTGGACTAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAGTTTGTTGGACCCGTGAATTGCAGATCCTTCATGCTAGAACCTGGAACCTGATTA / /// / / / // // / /// / / | ||EcoRII | | MaeI || || | ||| | PshAI | ||BssKI | MaeII || || | ||| SecI* | ||SecI* MseI || || | ||| StyI | |BseSI TaiI || || | ||AvaII | |SduI SetI || || | ||AsuI* | BseBI || || | |BmgT120I | ScrFI || || | SetI SetI || || MboI || |DpnI || BstKTI |Csp6I RsaI M F K Q P G H L T S R K Y D L G P W T N C S N N L G T * R L G S T I L D L G L M V Q T T W A L N V * E V R S W T L D * C ----:----|----:----|----:----|----:----|----:----|----:----| X N L C G P C K V D L F Y S R P G Q V L X T * V V Q A S L T * S T R D Q V K S * H E F L R P V * R R P L V I K S R P S I BbvI | AjuI | | AlfI | | | Hpy188I | | | |MwoI | | | ||TaqII | | | ||| TseI | | | ||| AluI | | | ||| CviJI | | | ||| AlwNI | | | ||| |BisI | | | ||| |SfeI* MseI | | | ||| ||BlsI |TspEI | | | ||| ||SetI AjuI || Eco57I | | | ||| |||CviRI* |Hpy178III* || Eco57MI | | | ||| |||| PstI CviRI* || AlfI \\ \ \ \ \ \\\ \\\\ \ \ \\ \ GTCTTTAATTTGTGCTTTCTTGCTTCAGAAGCTGCAGTTGGGTGCAATAAATCTTGA 70 80 90 100 110 ----:----|----:----|----:----|----:----|----:----|----:-- CAGAAATTAAACACGAAAGAACGAAGTCTTCGACGTCAACCCACGTTATTTAGAACT // / / // ///// //// / / / / || | AjuI || ||||| |||| SfeI* | AjuI Hpy178III* || TspEI || ||||| |||CviRI* CviRI* AlfI |MseI || ||||| |||TseI Eco57MI || ||||| ||BisI Eco57I || ||||| |BlsI || ||||| |PstI || ||||| CviJI || ||||| AluI || ||||SetI || |||AlwNI || ||TaqII || |Hpy188I || MwoI |BbvI AlfI V F N L C F L A S E A A V G C N K S * S L I C A F L L Q K L Q L G A I N L X L * F V L S C F R S C S W V Q * I L X ----:----|----:----|----:----|----:----|----:----|----:-- T K L K H K R A E S A A T P H L L D Q H R * N T S E Q K L L Q L Q T C Y I K D K I Q A K K S * F S C N P A I F R S # Enzymes that cut Frequency Isoschizomers AjuI 1 AlfI 1 AluI 1 AluBI AlwNI 1 CaiI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseSI 1 BaeGI,BstSLI BssKI 1 BstSCI,StyD4I BstKTI 1 Csp6I 1 CviQI,RsaNI CviJI 1 CviKI-1 CviRI* 2 HpyCH4V DpnI 1 MalI Eco57I 1 AcuI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI Hpy178III* 1 Hpy188III Hpy188I 1 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI PshAI 1 BstPAI,BoxI PstI 1 RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 4 SfeI* 1 BstSFI,SfcI,BfmI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqII 1 TseI 1 ApeKI TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AloI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BseMII BsePI BseRI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeIII MauBI MboII McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqI TatI TauI TfiI TsoI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769