Restriction Map of KTI12/YKL110C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

KTI12/YKL110C on chromosome XI from coordinates 229880 to 228939.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MwoI FatI | BsrI |CviAII | TspRI || NlaIII | | BaeI || | PflMI BaeI | | |BciVI || | BsiYI* | Cac8I \ \ \\ \\ \ \ \ \ ATGCCACTGGTGCTTTTTACGGGATACCCATGTAGTGGTAAGACAACGCTTGCTAAACAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTGACCACGAAAAATGCCCTATGGGTACATCACCATTCTGTTGCGAACGATTTGTA / / // / / // / / | | |BaeI BciVI | |FatI BaeI Cac8I | | BsrI | BsiYI* | MwoI | CviAII TspRI | PflMI NlaIII M P L V L F T G Y P C S G K T T L A K H C H W C F L R D T H V V V R Q R L L N I A T G A F Y G I P M * W * D N A C * T F ----:----|----:----|----:----|----:----|----:----|----:----| X G S T S K V P Y G H L P L V V S A L C X A V P A K * P I G M Y H Y S L A Q * V H W Q H K K R S V W T T T L C R K S F M SfeI* | Tsp4CI* | |SfaNI | || MboI | || | DpnI | || | |TaqI | || | |ClaI Csp6I | || | |BstKTI MseI |RsaI | || | || CviRI* | BccI SspI \\ \ \\ \ \\ \ \ \ \ TTGGTACAACTACTACAGTCCAAGATCGATGCAACCCCATCATTAAGTAAATATTCCATA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACCATGTTGATGATGTCAGGTTCTAGCTACGTTGGGGTAGTAATTCATTTATAAGGTAT // // / // // / // / / |Csp6I || | || || CviRI* |BccI SspI SetI RsaI || | || |ClaI MseI || | || |TaqI || | || MboI || | |DpnI || | BstKTI || SfaNI |SfeI* Tsp4CI* L V Q L L Q S K I D A T P S L S K Y S I W Y N Y Y S P R S M Q P H H * V N I P * G T T T T V Q D R C N P I I K * I F H N ----:----|----:----|----:----|----:----|----:----|----:----| K T C S S C D L I S A V G D N L L Y E M N P V V V V T W S R H L G M M L Y I N W Q Y L * * L G L D I C G W * * T F I G Y MslI |Hpy188I || TfiI SetI || HinfI TspDTI Hpy188I MmeI \ \\ \ \ \ \ ACCTATCATTCAGATGAATCTTTAGGCATAAAACATTCAGATTATATAACTTCCCAAGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGATAGTAAGTCTACTTAGAAATCCGTATTTTGTAAGTCTAATATATTGAAGGGTTCTA / / / / / Hpy188I HinfI TspDTI Hpy188I MmeI MslI TfiI T Y H S D E S L G I K H S D Y I T S Q D P I I Q M N L * A * N I Q I I * L P K M L S F R * I F R H K T F R L Y N F P R * ----:----|----:----|----:----|----:----|----:----|----:----| V * * E S S D K P M F C E S * I V E W S L R D N L H I K L C L V N L N Y L K G L G I M * I F R * A Y F M * I I Y S G L I MnlI | TspEI | | BplI BtsI | | BplI TspRI | | | TspDTI | MboI | | | | SetI | BplI | | | | | Hpy188I | BplI | | | | | | MboI | BglII | | | | | | | DpnI | XhoII | | | | | | | |BstKTI | | DpnI | | | | | | | || AciI | | |BstKTI \ \ \ \ \ \ \ \\ \ \ \ \\ GAAAGAAAATTGAGGTCGGAGATCATCTCCGCAGTGAAAAGAGATCTATCTAAAAACAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTTTTAACTCCAGCCTCTAGTAGAGGCGTCACTTTTCTCTAGATAGATTTTTGTTC // // / // / / / // // / |BplI || | || MboI | AciI |BplI || XhoII |BplI || | |DpnI TspRI |BplI || BglII MnlI || | BstKTI BtsI || MboI || Hpy188I |DpnI |TspDTI BstKTI |SetI TspEI E R K L R S E I I S A V K R D L S K N K K E N * G R R S S P Q * K E I Y L K T R K K I E V G D H L R S E K R S I * K Q D ----:----|----:----|----:----|----:----|----:----|----:----| S L F N L D S I M E A T F L S R D L F L H F F I S T P S * R R L S F L D I * F C F S F Q P R L D D G C H F S I * R F V L MlyI PleI | BdaI | BdaI BetI* | | AccI |HpaII | | |Hpy166II || BdaI MnlI | | ||HinfI TspEI || BdaI BtsI TspRI \ \ \\\ \ \\ \ \ \ ATAGTCATTGTAGACTCGTTGAATTATATCAAGGGTTTCCGGTATCAACTTCACTGCGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TATCAGTAACATCTGAGCAACTTAATATAGTTCCCAAAGGCCATAGTTGAAGTGACGCTC // // / / // // / || || HinfI TspEI |BetI* |MnlI SetI || |AccI HpaII TspRI || Hpy166II BdaI BtsI |PleI BdaI MlyI BdaI BdaI I V I V D S L N Y I K G F R Y Q L H C E * S L * T R * I I S R V S G I N F T A R S H C R L V E L Y Q G F P V S T S L R G ----:----|----:----|----:----|----:----|----:----|----:----| I T M T S E N F * I L P K R Y * S * Q S S L * Q L S T S N Y * P N G T D V E S R Y D N Y V R Q I I D L T E P I L K V A L Tsp4CI* SetI | TspRI | ApoI HphI | | BsmAI | TspEI | Hpy166II TspEI | | Hpy166II \ \ \ \ \ \ \ \ GTGAAAAATTTGTCCACCACATTTTGTGTAATTCAAACACTGTGTCCACCAGAGACTATA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTTTTAAACAGGTGGTGTAAAACACATTAAGTTTGTGACACAGGTGGTCTCTGATAT // / / / / / / || Hpy166II | | | | BsmAI |HphI | | | Hpy166II TspEI | | Tsp4CI* ApoI | TspRI TspEI V K N L S T T F C V I Q T L C P P E T I * K I C P P H F V * F K H C V H Q R L Y E K F V H H I L C N S N T V S T R D Y I ----:----|----:----|----:----|----:----|----:----|----:----| T F F K D V V N Q T I * V S H G G S V I P S F N T W W M K H L E F V T D V L S * H F I Q G G C K T Y N L C Q T W W L S Y TfiI HinfI | MfeI NlaIV | TspEI StyI | AvaI | | TfiI TaqI SecI* | |BmeT110I | | HinfI \ \ \ \\ \ \ \ TTCGAGTGGAATAAGACTTCAAACCCGAACCCTTGGGAACCCGAGTTATTGAATCAATTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTCACCTTATTCTGAAGTTTGGGCTTGGGAACCCTTGGGCTCAATAACTTAGTTAAC / / / // / / TaqI | | |AvaI | TspEI | | BmeT110I | MfeI | NlaIV HinfI SecI* TfiI StyI F E W N K T S N P N P W E P E L L N Q L S S G I R L Q T R T L G N P S Y * I N * R V E * D F K P E P L G T R V I E S I D ----:----|----:----|----:----|----:----|----:----|----:----| N S H F L V E F G F G Q S G S N N F * N I R T S Y S K L G S G K P V R T I S D I E L P I L S * V R V R P F G L * Q I L Q BplI BplI |SapI SmlI BplI |Ksp632I* |MboII MlyI BplI BslFI ||Bce83I* CviJI || BccI PleI |HinfI | BseRI \\\ \ \\ \ \ \\ \ \ ATTCAACGATACGAAGAGCCTAACTCAAGCAACCGATGGGACTCTCCACTCTTTGCTATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTGCTATGCTTCTCGGATTGAGTTCGTTGGCTACCCTGAGAGGTGAGAAACGATAA // / / / / / / // / / / || | | CviJI | | | |PleI HinfI | BslFI || | Ksp632I* | | | BplI BseRI || | SapI | | | BplI || Bce83I* | | | MlyI |HinfI | | BccI |TfiI | SmlI BplI MboII BplI I Q R Y E E P N S S N R W D S P L F A I F N D T K S L T Q A T D G T L H S L L F S T I R R A * L K Q P M G L S T L C Y S ----:----|----:----|----:----|----:----|----:----|----:----| I * R Y S S G L E L L R H S E G S K A I S E V I R L A * S L C G I P S E V R Q * N L S V F L R V * A V S P V R W E K S N DdeI SauI* | Hpy178III* | | MnlI | | | BspCNI | | | |BseMII TaqI Hpy99I \ \ \ \\ \ \ CTTACTCCTCAGGACAACATAACTGACTACATCGACGATATTTGTAAAGTAGTCTTTCAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GAATGAGGAGTCCTGTTGTATTGACTGATGTAGCTGCTATAAACATTTCATCAGAAAGTT // / // / / || | |BseMII | TaqI || | BspCNI Hpy99I || MnlI |Hpy178III* SauI* DdeI L T P Q D N I T D Y I D D I C K V V F Q L L L R T T * L T T S T I F V K * S F K Y S S G Q H N * L H R R Y L * S S L S N ----:----|----:----|----:----|----:----|----:----|----:----| R V G * S L M V S * M S S I Q L T T K * E * E E P C C L Q S C R R Y K Y L L R E K S R L V V Y S V V D V I N T F Y D K L Tsp4CI* | Hpy166II | |TspGWI | ||TspRI | |||BinI* | |||| MboI | |||| | DpnI CviJI | |||| | |BstKTI CviJI \ \ \\\\ \ \\ \ ACTTCCAAATCGGCTAAAAACAGTGGACACAATGATCCGTTGAGTAAGGGCTTACAAAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGGTTTAGCCGATTTTTGTCACCTGTGTTACTAGGCAACTCATTCCCGAATGTTTTT / / / // / // / / | | | || | || MboI CviJI | | | || | |DpnI | | | || | BstKTI | | | || BinI* | | | |Hpy166II | | | TspGWI | | Tsp4CI* | TspRI CviJI T S K S A K N S G H N D P L S K G L Q K L P N R L K T V D T M I R * V R A Y K N F Q I G * K Q W T Q * S V E * G L T K T ----:----|----:----|----:----|----:----|----:----|----:----| V E L D A L F L P C L S G N L L P K C F F K W I P * F C H V C H D T S Y P S V F S G F R S F V T S V I I R Q T L A * L F DdeI | CviJI | |SecI* | |DsaI* | || Tsp4CI* | || |Csp6I | || ||HgaI | || ||RsaI | || ||| BspCNI | || ||| |BseMII | || ||| || CviJI | || ||| || | Cac8I | || ||| || | | FokI | || ||| || | | |DdeI | || ||| || | | ||TspDTI | || ||| || | | ||| BsmAI | || ||| || | | ||| Esp3I | || ||| || | | ||| | TspEI | || ||| || | | ||| | | BseGI | || ||| || | | ||| | | |BspCNI | || ||| || | | ||| | | ||BseMII | || ||| || | | ||| | | |||BssKI | || ||| || | | ||| | | |||EcoRII | || ||| || | | ||| | | |||| ScrFI | || ||| || | | ||| | | |||| BseBI | || ||| || | | ||| | | |||| | SetI | || ||| || | | ||| | | |||| | | Hpy178III* | || ||| || | | ||| | | |||| | | |TaqI \ \\ \\\ \\ \ \ \\\ \ \ \\\\ \ \ \\ CCGAACTCAGCCACGGTACTAAAGCCTGCGTCTCAGTCCAATTTCATCCAGGTTCTCGAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTGAGTCGGTGCCATGATTTCGGACGCAGAGTCAGGTTAAAGTAGGTCCAAGAGCTG // // // / / / / / / /// // / // || || || | | | | | | ||| || | |TaqI || || || | | | | | | ||| || | Hpy178III* || || || | | | | | | ||| || EcoRII || || || | | | | | | ||| || BssKI || || || | | | | | | ||| |BseBI || || || | | | | | | ||| |ScrFI || || || | | | | | | ||| SetI || || || | | | | | | ||BseMII || || || | | | | | | |BspCNI || || || | | | | | | |TspEI || || || | | | | | | BseGI || || || | | | | | Esp3I || || || | | | | | BsmAI || || || | | | | DdeI || || || | | | | FokI || || || | | | TspDTI || || || | | Cac8I || || || | CviJI || || || HgaI || || |BseMII || || |Csp6I || || BspCNI || || RsaI || |DsaI* || |SecI* || Tsp4CI* |CviJI DdeI P N S A T V L K P A S Q S N F I Q V L D R T Q P R Y * S L R L S P I S S R F S T E L S H G T K A C V S V Q F H P G S R H ----:----|----:----|----:----|----:----|----:----|----:----| G F E A V T S F G A D * D L K M W T R S V S S L W P V L A Q T E T W N * G P E R R V * G R Y * L R R R L G I E D L N E V FauI SpeI BdaI FalI TspDTI BdaI TaqI |MaeI BdaI FalI |CviJI BdaI \ \\ \ \ \\ \ ATCGAAACTAGTAAGATAATAAAAACCATAATGAACCACATCAAAAGCCTGACTTCTATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTTGATCATTCTATTATTTTTGGTATTACTTGGTGTAGTTTTCGGACTGAAGATAA / // / / / / / / TaqI |SpeI BdaI FalI | CviJI | FauI MaeI BdaI FalI TspDTI BdaI BdaI I E T S K I I K T I M N H I K S L T S I S K L V R * * K P * * T T S K A * L L L R N * * D N K N H N E P H Q K P D F Y W ----:----|----:----|----:----|----:----|----:----|----:----| M S V L L I I F V M I F W M L L R V E I C R F * Y S L L F W L S G C * F G S K * D F S T L Y Y F G Y H V V D F A Q S R N TspGWI | PleI FalI | Hin4II* FalI | |MlyI EcoRV AciI | MaeIII HinfI | || Hpy188I | BccI \ \ \ \ \ \\ \ \ \ GGCGGGGTAAGTAACGGAACAAGAGTCATTGTTTCCGAAGGGATTACCGATATCAATGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCCCCATTCATTGCCTTGTTCTCAGTAACAAAGGCTTCCCTAATGGCTATAGTTACTA // / // / / / / / |AciI MaeIII || | | Hpy188I | BccI FalI || | PleI EcoRV FalI || | MlyI || Hin4II* |TspGWI HinfI G G V S N G T R V I V S E G I T D I N D A G * V T E Q E S L F P K G L P I S M M R G K * R N K S H C F R R D Y R Y Q * * ----:----|----:----|----:----|----:----|----:----|----:----| P P T L L P V L T M T E S P I V S I L S Q R P L Y R F L L * Q K R L S * R Y * H A P Y T V S C S D N N G F P N G I D I I MaeIII | MaeII | | SetI | | TaiI | | |MaeIII | | ||Hpy99I | | ||| MaeII | | ||| | SetI | | ||| | TaiI | | ||| | | Hin6I | | ||| | | |GlaI | | ||| | | ||HhaI | | ||| | | |||MfeI AccI | | ||| | | |||TspEI MboII |Hpy166II | | ||| | | |||| CviRI* \ \\ \ \ \\\ \ \ \\\\ \ GATGGTTGCTTCTTCGTAGACTTGCCCATTGGTAACGTCGTTACGTTGGCGCAATTGCAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCAACGAAGAAGCATCTGAACGGGTAACCATTGCAGCAATGCAACCGCGTTAACGTC / // //// / // /// // MboII |AccI |||| | || ||| |CviRI* Hpy166II |||| | || ||| TspEI |||| | || ||| MfeI |||| | || ||Hin6I |||| | || |GlaI |||| | || HhaI |||| | |MaeII |||| | MaeIII |||| TaiI |||| SetI |||MaeII ||MaeIII |Hpy99I TaiI SetI D G C F F V D L P I G N V V T L A Q L Q M V A S S * T C P L V T S L R W R N C R W L L L R R L A H W * R R Y V G A I A E ----:----|----:----|----:----|----:----|----:----|----:----| S P Q K K T S K G M P L T T V N A C N C H H N S R R L S A W Q Y R R * T P A I A I T A E E Y V Q G N T V D N R Q R L Q L BsaBI |MboI || DpnI || |BstKTI || ||TaqII || ||Hpy178III* || ||| MboI || ||| | DpnI TspDTI TspEI MseI DdeI || ||| | |BstKTI \ \ \ \ \\ \\\ \ \\ AGATTGAAAAGGCAATTCATTAACTTCAACAAACTAAGAGATATAGATCAAGATAGGATC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAACTTTTCCGTTAAGTAATTGAAGTTGTTTGATTCTCTATATCTAGTTCTATCCTAG / / / / / // / / // / TspDTI | MseI DdeI | || | | || MboI TspEI | || | | |DpnI | || | | BstKTI | || | Hpy178III* | || MboI | |TaqII | |DpnI | BstKTI BsaBI R L K R Q F I N F N K L R D I D Q D R I D * K G N S L T S T N * E I * I K I G S I E K A I H * L Q Q T K R Y R S R * D R ----:----|----:----|----:----|----:----|----:----|----:----| L N F L C N M L K L L S L S I S * S L I S I S F A I * * S * C V L L Y L D L Y S S Q F P L E N V E V F * S I Y I L I P D AsuI* AvaII RsrII |BmgT120I || AciI || BinI* MseI TspEI \\ \ \ \ GGTCCGCTTTTCGCTGATTATCTTAACAAAAACTTGAATTGA 910 920 930 940 ----:----|----:----|----:----|----:----|-- CCAGGCGAAAAGCGACTAATAGAATTGTTTTTGAACTTAACT //// / / |||AciI MseI TspEI ||BinI* |RsrII |AvaII |AsuI* BmgT120I G P L F A D Y L N K N L N * V R F S L I I L T K T * I X S A F R * L S * Q K L E L X ----:----|----:----|----:----|----:----|-- P G S K A S * R L L F K F Q R D A K R Q N D * C F S S N T R K E S I I K V F V Q I S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 3 BspACI,SsiI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BccI 3 Bce83I* 1 BpuEI BciVI 1 BfuI BdaI 4 BetI* 1 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BmeT110I 1 BmgT120I 1 BplI 4 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 3 BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 6 BtsI 2 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 1 CviJI 6 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 6 MalI DsaI* 1 BtgI,BstDSI EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 1 FauI 1 SmuI FokI 1 GlaI 1 HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 6 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 4 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 2 MunI MlyI 3 SchI MmeI 1 MnlI 3 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI RsaI 2 AfaI RsrII 1 CspI,Rsr2I,CpoI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 6 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 5 TaqII 1 TfiI 3 PfeI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 5 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BalI BamHI BarI BbvCI BbvI BbvII* BceAI BcgI BclI BfiI BglI BisI BlsI BmtI Bpu10I BsaAI BsaXI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI EspI* Fnu4HI FnuDII* FseI FspAI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* Hin4I HindII HindIII HpaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII SacI SacII SalI SanDI ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TauI TseI TsoI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769