Restriction Map of HAP4/YKL109W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HAP4/YKL109W on chromosome XI from coordinates 232227 to 233891.


StuI CviJI HaeIII | AciI | | MaeI MaeIII MseI AciI SfeI* | | | MnlI | MnlI |AhaIII* \ \ \ \ \ \ \ \ \\ ATGACCGCAAAGACTTTTCTACTACAGGCCTCCGCTAGTCGCCCTCGTAGTAACCATTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCGTTTCTGAAAAGATGATGTCCGGAGGCGATCAGCGGGAGCATCATTGGTAAAA / / / / // / / / AciI | | | |MnlI | | AhaIII* | | | MaeI | MaeIII | | AciI MnlI | HaeIII | CviJI | StuI SfeI* M T A K T F L L Q A S A S R P R S N H F * P Q R L F Y Y R P P L V A L V V T I L D R K D F S T T G L R * S P S * * P F * ----:----|----:----|----:----|----:----|----:----|----:----| X V A F V K R S C A E A L R G R L L W K X S R L S K E V V P R R * D G E Y Y G N H G C L S K * * L G G S T A R T T V M K KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI ||DinI ||NlaIV |||HhaI ||||HaeII ||||| Csp6I ||||| |RsaI ||||| || MboI ||||| || | DpnI ||||| || | |PvuI ||||| || | |McrI* TsoI SspI ||||| || | |BstKTI \ \ \\\\\ \\ \ \\ AAAAATGAGCATAATAATATTCCATTGGCGCCTGTACCGATCGCCCCAAATACCAACCAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACTCGTATTATTATAAGGTAACCGCGGACATGGCTAGCGGGGTTTATGGTTGGTA / / / ///// // // / | TsoI SspI ||||| || || MboI MseI ||||| || |DpnI ||||| || BstKTI ||||| || McrI* ||||| || PvuI ||||| |Csp6I ||||| RsaI ||||HgiCI* ||||KasI |||Hin6I |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII K N E H N N I P L A P V P I A P N T N H K M S I I I F H W R L Y R S P Q I P T I K * A * * Y S I G A C T D R P K Y Q P S ----:----|----:----|----:----|----:----|----:----|----:----| L F S C L L I G N A G T G I A G F V L W * F H A Y Y Y E M P A Q V S R G L Y W G F I L M I I N W Q R R Y R D G W I G V M ApoI TsoI TspEI |MaeI EcoRI ||MboII | TaqI FalI ||| AluI | AsuII FalI ||| CviJI BccI | | BccI AjuI ||| |MboII \ \ \ \ \ \\\ \\ CATAACAATAGTTCGCTGGAATTCGAAAACGATGGCAGTAAAAAGAAGAAGAAGTCTAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTGTTATCAAGCGACCTTAAGCTTTTGCTACCGTCATTTTTCTTCTTCTTCAGATCG / / // / / //// BccI | |BccI AjuI | |||MboII | AsuII FalI | |||CviJI | TaqI FalI | |||AluI EcoRI | ||MaeI TspEI | |SetI ApoI | MboII TsoI H N N S S L E F E N D G S K K K K K S S I T I V R W N S K T M A V K R R R S L A * Q * F A G I R K R W Q * K E E E V * L ----:----|----:----|----:----|----:----|----:----|----:----| * L L L E S S N S F S P L L F F F F D L D Y C Y N A P I R F R H C Y F S S S T * M V I T R Q F E F V I A T F L L L L R A FalI FalI BssKI SexAI EcoRII |PflMI |BsiYI* FalI ||ScrFI MboII FalI ||BseBI | MboI SetI AjuI |||SetI | | DpnI \ \ \\\\ \ \ \ TTGGTGGTTAGAACTTCAAAACATTGGGTTTTGCCCCCAAGACCAAGACCTGGTAGAAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACCAATCTTGAAGTTTTGTAACCCAAAACGGGGGTTCTGGTTCTGGACCATCTTCT / / // / / / // AjuI | || | | | |DpnI FalI | || | | | BstKTI FalI | || | | MboII | || | EcoRII | || | SexAI | || | BssKI | || BseBI | || ScrFI | |SetI | BsiYI* | PflMI FalI FalI L V V R T S K H W V L P P R P R P G R R W W L E L Q N I G F C P Q D Q D L V E D G G * N F K T L G F A P K T K T W * K I ----:----|----:----|----:----|----:----|----:----|----:----| K T T L V E F C Q T K G G L G L G P L L S P P * F K L V N P K A G L V L V Q Y F Q H N S S * F M P N Q G W S W S R T S S AsuI* FalI SspI |CviJI FalI | MseI |HaeIII BstKTI MboII | SetI BspMI | |AhaIII* |BmgT120I \ \ \ \ \ \ \\ \\ TCATCTTCTCACAACACTCTACCTGCCAACAACACCAATAATATTTTAAATGTTGGCCCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGAAGAGTGTTGTGAGATGGACGGTTGTTGTGGTTATTATAAAATTTACAACCGGGA / / / / / / // //// MboI MboII FalI SetI BspMI SspI |MseI |||MwoI FalI AhaIII* ||AsuI* |BmgT120I HaeIII CviJI S S S H N T L P A N N T N N I L N V G P H L L T T L Y L P T T P I I F * M L A L I F S Q H S T C Q Q H Q * Y F K C W P * ----:----|----:----|----:----|----:----|----:----|----:----| D D E * L V R G A L L V L L I K F T P G I M K E C C E V Q W C C W Y Y K L H Q G * R R V V S * R G V V G I I N * I N A R TaqI MwoI Tsp4CI* EcoP15I AsuII HindIII \ \ \ \ \ AACAGCAGGAACAGTAGTAATAATAATAATAATAATAACATCATTTCGAATAGGAAACAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCGTCCTTGTCATCATTATTATTATTATTATTATTGTAGTAAAGCTTATCCTTTGTT / / / / Tsp4CI* EcoP15I AsuII SetI TaqI N S R N S S N N N N N N N I I S N R K Q T A G T V V I I I I I I T S F R I G N K Q Q E Q * * * * * * * * H H F E * E T S ----:----|----:----|----:----|----:----|----:----|----:----| L L L F L L L L L L L L L M M E F L F C * C C S C Y Y Y Y Y Y Y Y C * K S Y S V V A P V T T I I I I I I V D N R I P F L AluI CviJI AluI Hpy178III* | SetI CviJI | TaqI | | MlyI | SetI MnlI | ClaI | | PleI \ \ \ \ \ \ \ \ GCTTCCAAAGAAAAGAGGAAAATACCAAGACATATCCAGACAATCGATGAAAAGCTAATA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGGTTTCTTTTCTCCTTTTATGGTTCTGTATAGGTCTGTTAGCTACTTTTCGATTAT / / / / / / / /// | | MnlI | ClaI | | ||TspDTI | HindIII | TaqI | | |PleI CviJI Hpy178III* | | MlyI AluI | CviJI | AluI SetI A S K E K R K I P R H I Q T I D E K L I L P K K R G K Y Q D I S R Q S M K S * * F Q R K E E N T K T Y P D N R * K A N K ----:----|----:----|----:----|----:----|----:----|----:----| A E L S F L F I G L C I W V I S S F S I L K W L F S S F V L V Y G S L R H F A L S G F F L P F Y W S M D L C D I F L * Y TspDTI | HinfI | | TaqI BdaI XmnI | | | TspEI SetI MnlI TaqI BdaI TspDTI MboII BseRI \ \ \ \ \ \ \ \ \ \ \ AACGACTCGAATTACCTCGCATTTTTGAAGTTCGATGACTTGGAAAATGAAAAGTTTCAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGAGCTTAATGGAGCGTAAAAACTTCAAGCTACTGAACCTTTTACTTTTCAAAGTA / / / / // / // / / | | TspEI MnlI |BdaI TspDTI |XmnI | TspDTI | | SetI |BdaI MboII BseRI | TaqI TaqI HinfI N D S N Y L A F L K F D D L E N E K F H T T R I T S H F * S S M T W K M K S F I R L E L P R I F E V R * L G K * K V S F ----:----|----:----|----:----|----:----|----:----|----:----| F S E F * R A N K F N S S K S F S F N * L R S S N G R M K S T R H S P F H F T E V V R I V E C K Q L E I V Q F I F L K M TspDTI | TspDTI MnlI | | BdaI | MnlI | | BdaI | | TspDTI BccI BccI \ \ \ \ \ \ \ \ TCTTCTGCCTCCTCCATTTCATCTCCATCTTATTCATCTCCATCTTTTTCAAGTTATAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGACGGAGGAGGTAAAGTAGAGGTAGAATAAGTAGAGGTAGAAAAAGTTCAATATCT / / / // / / | BdaI | |TspDTI BccI BccI | BdaI | MnlI TspDTI MnlI S S A S S I S S P S Y S S P S F S S Y R L L P P P F H L H L I H L H L F Q V I E F C L L H F I S I L F I S I F F K L * K ----:----|----:----|----:----|----:----|----:----|----:----| E E A E E M E D G D * E D G D K E L * L N K Q R R W K M E M K N M E M K K L N Y R R G G G N * R W R I * R W R K * T I S TseI TspDTI AluI | Hpy188I CviJI | |ApoI |BisI | |TspEI ||BlsI | |EcoRI ||SetI | || FatI |||CviRI* | || |BsgI |||| OliI BsrDI | || |CviAII |||| MslI | TseI | || ||BbvI |||| |TspDTI | |BisI | || ||| NlaIII |||| ||BbvI | ||BlsI \ \\ \\\ \ \\\\ \\\ \ \\\ AATAGAAAAAAATCAGAATTCATGGACGATGAAAGCTGCACCGATGTGGAAACCATTGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTTTTTTTAGTCTTAAGTACCTGCTACTTTCGACGTGGCTACACCTTTGGTAACGA / / // // / / //// // / / // TspDTI | || || BbvI | |||| |MslI | BsrDI |BisI | || |FatI | |||| |OliI BbvI BlsI | || CviAII | |||| TspDTI | |NlaIII | |||CviRI* | |EcoRI | |||TseI | |TspEI | ||BisI | |ApoI | |BlsI | BsgI | CviJI Hpy188I | AluI SetI N R K K S E F M D D E S C T D V E T I A I E K N Q N S W T M K A A P M W K P L L * K K I R I H G R * K L H R C G N H C C ----:----|----:----|----:----|----:----|----:----|----:----| F L F F D S N M S S S L Q V S T S V M A F Y F F I L I * P R H F S C R H P F W Q I S F F * F E H V I F A A G I H F G N S MboII | BccI | MboII | | TfiI Tsp4CI* | | HinfI Hpy166II \ \ \ \ \ GCTCACAACAGTCTGCTAACAAAAAACCATCATATAGATTCTTCTTCAAATGTTCACGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTGTTGTCAGACGATTGTTTTTTGGTAGTATATCTAAGAAGAAGTTTACAAGTGCGT / / / / / / / TseI Tsp4CI* | | | HinfI Hpy166II | | | TfiI | | BccI | MboII MboII A H N S L L T K N H H I D S S S N V H A L T T V C * Q K T I I * I L L Q M F T H S Q Q S A N K K P S Y R F F F K C S R T ----:----|----:----|----:----|----:----|----:----|----:----| A * L L R S V F F W * I S E E E F T * A Q E C C D A L L F G D Y L N K K L H E R S V V T Q * C F V M M Y I R R * I N V C Hin4I MboII Hin4I TaqII Hin4I MboII TspDTI Hin4I \ \ \ \ \ CCACCCACGAAAAAATCAAAGTTGAACGACTTTGATTTATTGTCCTTATCTTCCACATCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGGTGCTTTTTTAGTTTCAACTTGCTGAAACTAAATAACAGGAATAGAAGGTGTAGA / / / // / | Hin4I MboII || Hin4I | Hin4I || Hin4I TaqII |MboII TspDTI P P T K K S K L N D F D L L S L S S T S H P R K N Q S * T T L I Y C P Y L P H L T H E K I K V E R L * F I V L I F H I F ----:----|----:----|----:----|----:----|----:----|----:----| G G V F F D F N F S K S K N D K D E V D V V W S F I L T S R S Q N I T R I K W M W G R F F * L Q V V K I * Q G * R G C R BslFI | CfrI | | CviJI | | HaeIII | | | BetI* | | | |HpaII FatI | | | || AsuI* |CviAII | | | || AvaII || NlaIII | | | || |BmgT120I || |TspDTI | | | || || Tsp4CI* || || SetI | | | || || | HindII || || |ApoI BinI* | | | || ||NlaIV | Hpy166II || || |TspEI |TspDTI \ \ \ \\ \\\ \ \ \\ \\ \\ \\ TCATCGGCCACTCCGGTCCCACAGTTGACAAAAGATTTGAACATGAACCTAAATTTTCAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCCGGTGAGGCCAGGGTGTCAACTGTTTTCTAAACTTGTACTTGGATTTAAAAGTA / / / //// / / / /// // / | | CfrI |||| | Hpy166II | ||SetI || BinI* | HaeIII |||| | HindII | |FatI |TspDTI | CviJI |||| Tsp4CI* | CviAII TspEI BslFI |||AvaII | TspDTI ApoI |||AsuI* NlaIII ||BmgT120I ||NlaIV |BetI* HpaII S S A T P V P Q L T K D L N M N L N F H H R P L R S H S * Q K I * T * T * I F I I G H S G P T V D K R F E H E P K F S * ----:----|----:----|----:----|----:----|----:----|----:----| E D A V G T G C N V F S K F M F R F K * K M P W E P G V T S L L N S C S G L N E * R G S R D W L Q C F I Q V H V * I K M MboI XhoII | DpnI | |BstKTI | || TspDTI | || | BsiYI* | || | | CviJI TfiI | || | | |GsuI HinfI | || | | |MnlI | GsuI TfiI | || | | |Eco57MI | Eco57MI Hin4I HinfI \ \\ \ \ \\ \ \ \ \ AAGATCCCTCATAAGGCTTCATTCCCTGATTCTCCAGCAGATTTCTCTCCAGCAGATTCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGGGAGTATTCCGAAGTAAGGGACTAAGAGGTCGTCTAAAGAGAGGTCGTCTAAGT // / / // // / / || | | |CviJI |HinfI Hin4I HinfI || | | |MnlI |TfiI TfiI || | | Eco57MI Eco57MI || | | GsuI GsuI || | BsiYI* || TspDTI || XhoII || MboI |DpnI BstKTI K I P H K A S F P D S P A D F S P A D S R S L I R L H S L I L Q Q I S L Q Q I Q D P S * G F I P * F S S R F L S S R F S ----:----|----:----|----:----|----:----|----:----|----:----| L I G * L A E N G S E G A S K E G A S E Y S G E Y P K M G Q N E L L N R E L L N L D R M L S * E R I R W C I E R W C I * EcoP15I Hin4I CviRI* MnlI |BsmAI | EcoP15I TspEI | MseI | TspEI \\ \ \ \ \ \ \ \ GTCTCGTTGATTAGAAACCACTCCTTGCCTACTAATTTGCAAGTTAAGGACAAAATTGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGCAACTAATCTTTGGTGAGGAACGGATGATTAAACGTTCAATTCCTGTTTTAACTC / / / / / / / / / | | Hin4I EcoP15I | CviRI* | MnlI TspEI | BsmAI TspEI MseI EcoP15I V S L I R N H S L P T N L Q V K D K I E S R * L E T T P C L L I C K L R T K L R L V D * K P L L A Y * F A S * G Q N * G ----:----|----:----|----:----|----:----|----:----|----:----| T E N I L F W E K G V L K C T L S L I S L R T S * F G S R A * * N A L * P C F Q D R Q N S V V G Q R S I Q L N L V F N L MseI TaqI | ApoI |Hpy178III* | TspEI MseI || SmlI \ \ \ \\ \ GATTTGAACGAGATTAAATTCTTTAACGATTTCGAGAAACTTGAGTTTTTCAATAAGTAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACTTGCTCTAATTTAAGAAATTGCTAAAGCTCTTTGAACTCAAAAAGTTATTCATA / / / // / / | | MseI || SmlI Bce83I* | TspEI |Hpy178III* | ApoI TaqI MseI D L N E I K F F N D F E K L E F F N K Y I * T R L N S L T I S R N L S F S I S M F E R D * I L * R F R E T * V F Q * V C ----:----|----:----|----:----|----:----|----:----|----:----| S K F S I L N K L S K S F S S N K L L Y P N S R S * I R * R N R S V Q T K * Y T I Q V L N F E K V I E L F K L K E I L I MaeII | Hpy99I MboI | |MseI | DpnI | |SetI | |BstKTI | |TaiI | || Hpy178III* | ||HpaI | || | ApoI HindII | ||HindII | || | TspEI Bce83I* Hpy166II | ||Hpy166II | || | EcoRI \ \ \ \\\ \ \\ \ \ GCCAAAGTCAACACGAATAACGACGTTAACGAAAATAATGATCTCTGGAATTCTTACTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTCAGTTGTGCTTATTGCTGCAATTGCTTTTATTACTAGAGACCTTAAGAATGAAT / / / / // // / / / Hpy166II | | | |MseI || | | EcoRI HindII | | | Hpy166II || | | TspEI | | | HindII || | | ApoI | | | HpaI || | Hpy178III* | | MaeII || MboI | TaiI |DpnI | SetI BstKTI Hpy99I A K V N T N N D V N E N N D L W N S Y L P K S T R I T T L T K I M I S G I L T Y Q S Q H E * R R * R K * * S L E F L L T ----:----|----:----|----:----|----:----|----:----|----:----| A L T L V F L S T L S F L S R Q F E * K H W L * C S Y R R * R F Y H D R S N K S G F D V R I V V N V F I I I E P I R V * PflMI BsiYI* Tsp4CI* | Hpy166II | TspEI | |Hin4I Tsp4CI* SetI | TspRI | |Hin4I \ \ \ \ \ \\ CAGTCTATGGACGATACAACAGGTAAGAACAGTGGCAATTACCAACAAGTGGACAATGAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAGATACCTGCTATGTTGTCCATTCTTGTCACCGTTAATGGTTGTTCACCTGTTACTG / / / / / / / / Tsp4CI* SetI | Tsp4CI* | | | Hpy166II TspRI | | Hin4I | | Hin4I | BsiYI* | PflMI TspEI Q S M D D T T G K N S G N Y Q Q V D N D S L W T I Q Q V R T V A I T N K W T M T V Y G R Y N R * E Q W Q L P T S G Q * R ----:----|----:----|----:----|----:----|----:----|----:----| C D I S S V V P L F L P L * W C T S L S V T * P R Y L L Y S C H C N G V L P C H L R H V I C C T L V T A I V L L H V I V Hin4I Eco57I Hin4I Eco57MI TfiI | TspEI | MboII HinfI | |MnlI | | Tsp4CI* \ \ \\ \ \ \ GATAATATGTCTTTATTGAATCTGCCAATTTTGGAGGAAACCGTATCTTCAGGGCAAGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATACAGAAATAACTTAGACGGTTAAAACCTCCTTTGGCATAGAAGTCCCGTTCTA / / / / / / | | | | | Tsp4CI* | | | | MboII | | | Eco57MI | | | Eco57I | | | TspEI | | MnlI | HinfI | TfiI Hin4I Hin4I D N M S L L N L P I L E E T V S S G Q D I I C L Y * I C Q F W R K P Y L Q G K M * Y V F I E S A N F G G N R I F R A R * ----:----|----:----|----:----|----:----|----:----|----:----| S L I D K N F R G I K S S V T D E P C S R Y Y T K I S D A L K P P F R I K L A L I I H R * Q I Q W N Q L F G Y R * P L I BbvII* | MboII | |TspDTI | ||TspEI SetI | |||MboII Hpy166II | CviJI | |||| AjuI | TspDTI \ \ \ \\\\ \ \ \ GATAAGGTTGAGCCAGATGAAGAAGACATTTGGAATTATTTACCAAGTTCAAGTTCACAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCCAACTCGGTCTACTTCTTCTGTAAACCTTAATAAATGGTTCAAGTTCAAGTGTT / / // / / / / SetI CviJI || | TspEI | TspDTI || BbvII* Hpy166II || MboII |AjuI TspDTI MboII D K V E P D E E D I W N Y L P S S S S Q I R L S Q M K K T F G I I Y Q V Q V H N * G * A R * R R H L E L F T K F K F T T ----:----|----:----|----:----|----:----|----:----|----:----| S L T S G S S S S M Q F * K G L E L E C H Y P Q A L H L L C K S N N V L N L N V I L N L W I F F V N P I I * W T * T * L BseMII MaeII |BspCNI |PmaCI || TspEI |BsaAI || | Hin4II* TfiI |MboII || | |FokI HinfI || SetI || | ||DdeI |AjuI || TaiI || | |||Hpy188I BseGI \\ \\ \ \\ \ \\\\ \ CAAGAAGATTCATCACGTGCTTTGAAAAAAAATACTAATTCTGAGAAGGCGAACATCCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCTAAGTAGTGCACGAAACTTTTTTTTATGATTAAGACTCTTCCGCTTGTAGGTT / / //// // / // / / AjuI | |||MaeII |BspCNI | || DdeI BseGI | ||BsaAI BseMII | || FokI | ||PmaCI | |Hpy188I | |MboII | TspEI | TaiI Hin4II* | SetI HinfI TfiI Q E D S S R A L K K N T N S E K A N I Q K K I H H V L * K K I L I L R R R T S K R R F I T C F E K K Y * F * E G E H P S ----:----|----:----|----:----|----:----|----:----|----:----| C S S E D R A K F F F V L E S F A F M W V L L N M V H K S F F Y * N Q S P S C G L F I * * T S Q F F I S I R L L R V D L TspDTI | Hpy178III* | | MboI | | | DpnI | | | |BstKTI | | | ||Hpy178III* | | | ||| BdaI | | | ||| BdaI | | | ||| |BinI* | | | ||| || BseGI | | | ||| || | Hin6I | | | ||| || | |GlaI | | | ||| || | |Eco47III | | | ||| || | ||HhaI | | | ||| || | |||HaeII | | | ||| || | |||| HphI | | | ||| || | |||| TfiI Eco57I | | | ||| || | |||| FokI Eco57MI | | | ||| || | |||| HinfI | SetI | | | ||| || | |||| | BsaBI | MboII | | | ||| || | |||| | TspDTI \ \ \ \ \ \\\ \\ \ \\\\ \ \ GCAAAGAACGATGAAACCTATCTGTTTCTTCAGGATCAGGATGAAAGCGCTGATTCGCAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTCTTGCTACTTTGGATAGACAAAGAAGTCCTAGTCCTACTTTCGCGACTAAGCGTA / / / / /// /// // //// / /// | | MboII TspDTI ||| ||| || |||| | ||BsaBI | SetI ||| ||| || |||| | ||FokI Eco57MI ||| ||| || |||| | |HinfI Eco57I ||| ||| || |||| | |TfiI ||| ||| || |||| | TspDTI ||| ||| || |||| HphI ||| ||| || |||Hin6I ||| ||| || ||Eco47III ||| ||| || ||GlaI ||| ||| || |HhaI ||| ||| || HaeII ||| ||| |BseGI ||| ||| BinI* ||| ||Hpy178III* ||| |BdaI ||| |BdaI ||| MboI ||DpnI |BstKTI Hpy178III* A K N D E T Y L F L Q D Q D E S A D S H Q R T M K P I C F F R I R M K A L I R I K E R * N L S V S S G S G * K R * F A S ----:----|----:----|----:----|----:----|----:----|----:----| A F F S S V * R N R * S * S S L A S E C L L S R H F R D T E E P D P H F R Q N A C L V I F G I Q K K L I L I F A S I R M MslI |FatI BdaI ||CviAII BdaI ||| SfaNI | SetI ||| |NlaIII | | Hpy188I CviJI \\\ \\ \ \ \ \ CACCATGACGAGTTAGGTTCAGAAATCACTTTGGCTGACAATAAGTTTTCTTATTTGCCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTACTGCTCAATCCAAGTCTTTAGTGAAACCGACTGTTATTCAAAAGAATAAACGGG // // / / / / / || || | | SetI Hpy188I CviJI || || | BdaI || || | BdaI || || SfaNI || |FatI || CviAII |NlaIII MslI H H D E L G S E I T L A D N K F S Y L P T M T S * V Q K S L W L T I S F L I C P P * R V R F R N H F G * Q * V F L F A P ----:----|----:----|----:----|----:----|----:----|----:----| * W S S N P E S I V K A S L L N E * K G D G H R T L N L F * K P Q C Y T K K N A V M V L * T * F D S Q S V I L K R I Q G MboI BglII XhoII Ksp632I* | DpnI |XbaI | |BstKTI ||MaeI | || TspDTI ||Hpy178III* | || | MseI ||| SapI MboII | || | |AhaIII* ||| Ksp632I* MaeIII | || | || ApoI ||| BccI | MboII Tsp4CI* | || | || TspEI \\\ \ \ \ \ \ \\ \ \\ \ CCAACTCTAGAAGAGTTGATGGAAGAGCAGGACTGTAACAATGGCAGATCTTTTAAAAAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGAGATCTTCTCAACTACCTTCTCGTCCTGACATTGTTACCGTCTAGAAAATTTTTA /// / // / / //// // ||| BccI |MboII | MaeIII |||| |MseI ||XbaI Ksp632I* Tsp4CI* |||| AhaIII* |Hpy178III* SapI MboII |||XhoII |MaeI |||BglII Ksp632I* |||MboI ||TspDTI |DpnI BstKTI P T L E E L M E E Q D C N N G R S F K N Q L * K S * W K S R T V T M A D L L K I N S R R V D G R A G L * Q W Q I F * K F ----:----|----:----|----:----|----:----|----:----|----:----| G V R S S N I S S C S Q L L P L D K L F G L E L L T S P L A P S Y C H C I K * F W S * F L Q H F L L V T V I A S R K F I Tsp4CI* | MmeI AgeI | | Cfr10I FatI BetI* | | |HpaII |CviAII Cfr10I | | || Csp6I || NlaIII |HpaII | | || |RsaI \\ \ \\ \ \ \\ \\ TTCATGTTTTCCAACGATACCGGTATTGACGGTAGTGCCGGTACTGATGACGACTACACC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTACAAAAGGTTGCTATGGCCATAACTGCCATCACGGCCATGACTACTGCTGATGTGG // // // / / //// || |FatI |Cfr10I | MmeI |||Csp6I || CviAII |BetI* Tsp4CI* ||RsaI |NlaIII |AgeI |Cfr10I TspEI HpaII HpaII ApoI F M F S N D T G I D G S A G T D D D Y T S C F P T I P V L T V V P V L M T T T P H V F Q R Y R Y * R * C R Y * * R L H Q ----:----|----:----|----:----|----:----|----:----|----:----| K M N E L S V P I S P L A P V S S S * V N * T K W R Y R Y Q R Y H R Y Q H R S C E H K G V I G T N V T T G T S I V V V G MaeII | TaqI | SetI | TaiI ApoI | | Hpy99I Hpy188I TspEI | | | TaqI SetI MseI \ \ \ \ \ \ \ \ AAAGTTCTGAAATCCAAAAAAATTTCTACGTCGAAGTCGAACGCTAACCTTTATGACTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAAGACTTTAGGTTTTTTTAAAGATGCAGCTTCAGCTTGCGATTGGAAATACTGAAT / / // / / / / / Hpy188I | || | TaqI TaqI SetI MseI | || MaeII | |Hpy99I | TaiI | SetI TspEI ApoI K V L K S K K I S T S K S N A N L Y D L K F * N P K K F L R R S R T L T F M T * S S E I Q K N F Y V E V E R * P L * L K ----:----|----:----|----:----|----:----|----:----|----:----| L T R F D L F I E V D F D F A L R * S K W L E S I W F F K * T S T S R * G K H S F N Q F G F F N R R R L R V S V K I V * BcgI | MboI | BclI | | DpnI CviRI* | | |TspDTI TaqI | BdaI | | |BstKTI BdaI SfaNI | BdaI | | || TspDTI BdaI \ \ \ \ \ \\ \ \ AACGATAACAACAATGATGCAACTGCCACCAATGAACTTGATCAAAGCAGTTTCATCGAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTATTGTTGTTACTACGTTGACGGTGGTTACTTGAACTAGTTTCGTCAAAGTAGCTG / // / // / / / / / SfaNI |BdaI BcgI || | TspDTI | | TaqI |BdaI || BclI | Hpy99I CviRI* || MboI BdaI |DpnI BdaI BstKTI TspDTI N D N N N D A T A T N E L D Q S S F I D T I T T M M Q L P P M N L I K A V S S T R * Q Q * C N C H Q * T * S K Q F H R R ----:----|----:----|----:----|----:----|----:----|----:----| F S L L L S A V A V L S S S * L L K M S L R Y C C H H L Q W W H V Q D F C N * R V I V V I I C S G G I F K I L A T E D V MboII | MseI | |AhaIII* BcgI | || Csp6I Hpy99I | DrdI | || |RsaI | SetI | | TaqI | || |SetI \ \ \ \ \ \ \\ \\ GACCTTGACGAAGATGTCGATTTTTTAAAGGTACAAGTATTTTGA 1630 1640 1650 1660 ----:----|----:----|----:----|----:----|----: CTGGAACTGCTTCTACAGCTAAAAAATTTCCATGTTCATAAAACT / / / / / /// // SetI | DrdI | | ||| |Csp6I BcgI | | ||| RsaI | | ||SetI | | |MseI | | AhaIII* | MboII TaqI D L D E D V D F L K V Q V F * T L T K M S I F * R Y K Y F X P * R R C R F F K G T S I L X ----:----|----:----|----:----|----:----|----: S R S S S T S K K F T C T N Q R G Q R L H R N K L P V L I K V K V F I D I K * L Y L Y K S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AjuI 2 AluI 4 AluBI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BcgI 1 BclI 1 FbaI,Ksp22I BdaI 6 BetI* 2 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BssKI 1 BstSCI,StyD4I BstKTI 7 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 10 CviKI-1 CviRI* 3 HpyCH4V DdeI 1 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 7 MalI DrdI 1 AasI,DseDI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 4 EcoP15I 3 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI FalI 4 FatI 4 FokI 2 GlaI 2 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HindII 3 HincII HindIII 1 HinfI 7 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 4 Hpy99I 3 KasI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 1 MnlI 9 MseI 9 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NarI 1 Mly113I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I OliI 1 AleI PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PvuI 1 MvrI,Ple19I,BpvUI RsaI 3 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 18 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 3 TaqI 10 TaqII 1 TfiI 6 PfeI TseI 2 ApeKI TsoI 2 Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 18 TspEI 14 TasI,Tsp509I,Sse9I TspRI 1 TscAI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BceAI BciVI BfiI BglI BmeT110I BmtI BplI Bpu10I BsaXI BsePI BseSI BseYI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I CspCI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoRV EcoT22I Esp3I EspI* FauI FnuDII* FseI FspAI GsaI HgaI HgiAI* HgiJII* KpnI MauBI MfeI MluI Mph1103I MroNI MstI* NaeI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PacI PasI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SduI SecI* SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StyI SwaI TatI TauI Tsp45I TspGWI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769