Restriction Map of GFA1/YKL104C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GFA1/YKL104C on chromosome XI from coordinates 245373 to 243220.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21536

EMBOSS_001 MaeI | BinI* | | MnlI | | MboI | | XhoII | | |Hin4I | | ||DpnI | | |||BstKTI CviRI* | | ||||Hpy178III* TsoI MaeIII |TspEI | | ||||| TspEI TaqI \ \ \\ \ \ \\\\\ \ \ ATGTGTGGTATCTTTGGTTACTGCAATTATCTAGTGGAAAGATCCAGAGGAGAAATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACACACCATAGAAACCAATGACGTTAATAGATCACCTTTCTAGGTCTCCTCTTTAATAG / / / / / / / // / / / / TsoI | | | | | | || | Hpy178III* | BseRI | | | | | | || XhoII TspEI | | | | | | || MboI | | | | | | |DpnI | | | | | | BstKTI | | | | | MnlI | | | | BinI* | | | | Hin4I | | | MaeI | | TspEI | CviRI* MaeIII M C G I F G Y C N Y L V E R S R G E I I C V V S L V T A I I * W K D P E E K L S V W Y L W L L Q L S S G K I Q R R N Y R ----:----|----:----|----:----|----:----|----:----|----:----| X H P I K P * Q L * R T S L D L P S I I X T H Y R Q N S C N D L P F I W L L F * H T T D K T V A I I * H F S G S S F N D BseRI | DdeI | |BccI Hin4I CspCI AgeI | |SetI | BseGI | CviJI BetI* | |OliI | |Hpy166II | | TfiI Cfr10I | |MslI | || FokI MnlI | | HinfI |HpaII \ \\ \ \\ \ \ \ \ \ \\ GACACCTTAGTGGATGGTTTACAAAGATTAGAATATAGAGGCTATGATTCCACCGGTATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGGAATCACCTACCAAATGTTTCTAATCTTATATCTCCGATACTAAGGTGGCCATAA / / /// / / // / / / // | | ||DdeI | Hpy166II |MnlI | CviJI HinfI |Cfr10I | | |Hin4I BseGI FokI CspCI TfiI |BetI* | | |BccI |AgeI | | MslI HpaII | | OliI | SetI TaqI D T L V D G L Q R L E Y R G Y D S T G I T P * W M V Y K D * N I E A M I P P V L H L S G W F T K I R I * R L * F H R Y C ----:----|----:----|----:----|----:----|----:----|----:----| S V K T S P K C L N S Y L P * S E V P I R C R L P H N V F I L I Y L S H N W R Y V G * H I T * L S * F I S A I I G G T N MaeIII Tsp45I | CspCI | | AluI | | CviJI | | | SetI | | | TspDTI BccI | | | |TfiI | TaqI | | | |HphI | ClaI | | | |HinfI \ \ \ \ \ \\ GCTATCGATGGTGACGAAGCTGATTCTACTTTCATCTATAAGCAAATCGGTAAAGTGAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAGCTACCACTGCTTCGACTAAGATGAAAGTAGATATTCGTTTAGCCATTTCACTCA / / / / / / / / BccI ClaI | | | | | HinfI TaqI | | | | | TfiI | | | | HphI | | | TspDTI | | | CviJI | | | AluI | | SetI | Tsp45I | MaeIII CspCI A I D G D E A D S T F I Y K Q I G K V S L S M V T K L I L L S S I S K S V K * V Y R W * R S * F Y F H L * A N R * S E C ----:----|----:----|----:----|----:----|----:----|----:----| A I S P S S A S E V K M * L C I P L T L Q * R H H R L Q N * K * R Y A F R Y L S S D I T V F S I R S E D I L L D T F H T MaeII Esp3I |MaeIII BsmAI || SetI MnlI DdeI BseRI Hpy188I || TaiI BsmAI \ \ \ \ \\ \ \ GCTTTGAAAGAGGAGATTACTAAGCAAAATCCGAACAGAGACGTTACTTTTGTCTCTCAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACTTTCTCCTCTAATGATTCGTTTTAGGCTTGTCTCTGCAATGAAAACAGAGAGTA / / / / / / / MnlI BseRI | | | | MaeIII DdeI | | | MaeII | | TaiI | | SetI | BsmAI | Esp3I Hpy188I A L K E E I T K Q N P N R D V T F V S H L * K R R L L S K I R T E T L L L S L I F E R G D Y * A K S E Q R R Y F C L S L ----:----|----:----|----:----|----:----|----:----|----:----| A K F S S I V L C F G F L S T V K T E * H K S L P S * * A F D S C L R * K Q R E S Q F L L N S L L I R V S V N S K D R M HphI Tsp4CI* |MseI Hin6I |SalI ||HpaI |GlaI ||TaqI ||HindII |MstI* ||AccI ||Hpy166II ||HhaI ||McrI* ||| MaeIII ||| BccI |||HindII ||| Tsp45I ||| | MaeI CviJI |||Hpy166II ||| Tsp4CI* \\\ \ \ \ \\\\ \\\ \ TGTGGTATTGCGCATACTAGATGGGCTACTCACGGTCGACCAGAACAAGTTAACTGTCAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATAACGCGTATGATCTACCCGATGAGTGCCAGCTGGTCTTGTTCAATTGACAGTG / /// / / / // /// / // / / BsmAI ||| | MaeI CviJI || ||SalI | || | Tsp45I ||| BccI || |AccI | || | MaeIII ||Hin6I || |TaqI | || Tsp4CI* |MstI* || Hpy166II | |MseI |GlaI || HindII | Hpy166II HhaI |McrI* | HindII Tsp4CI* | HpaI HphI C G I A H T R W A T H G R P E Q V N C H V V L R I L D G L L T V D Q N K L T V T W Y C A Y * M G Y S R S T R T S * L S P ----:----|----:----|----:----|----:----|----:----|----:----| Q P I A C V L H A V * P R G S C T L Q * N H Y Q A Y * I P * E R D V L V L * S D T T N R M S S P S S V T S W F L N V T V MboI BglII TspEI XhoII |BbvII* | DpnI || TspDTI | |BstKTI || | PflMI | ||MnlI || | BsiYI* ApoI | |||Hpy188I || | |MboII TspEI \ \\\\ \\ \ \\ \ CCTCAAAGATCTGACCCAGAAGACCAATTTGTGGTCGTTCATAATGGTATCATCACAAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGTTTCTAGACTGGGTCTTCTGGTTAAACACCAGCAAGTATTACCATAGTAGTGTTTA //// // // |||Hpy188I || |BbvII* |||XhoII || |MboII |||BglII || TspEI |||MboI |BsiYI* ||MnlI |PflMI |DpnI TspDTI BstKTI P Q R S D P E D Q F V V V H N G I I T N L K D L T Q K T N L W S F I M V S S Q I S K I * P R R P I C G R S * W Y H H K F ----:----|----:----|----:----|----:----|----:----|----:----| G * L D S G S S W N T T T * L P I M V F G E F I Q G L L G I Q P R E Y H Y * * L R L S R V W F V L K H D N M I T D D C I Eco57I HinfI Eco57MI | BbvII* | SetI | | MseI | | PsiI | | |TspEI | | | ApoI | | ||MboII | | | TspEI MlyI | | ||| MseI | | | | TaqI PleI | | ||| PacI | | | | AsuII BcgI \ \ \ \\\ \ \ \ \ \ \ \ TTTAGAGAACTGAAGACTCTTTTAATTAACAAAGGTTATAAATTCGAAAGTGATACCGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAATCTCTTGACTTCTGAGAAAATTAATTGTTTCCAATATTTAAGCTTTCACTATGGCTA / // / // /// / / / / / TspEI |PleI | || ||| SetI PsiI | | BcgI ApoI MlyI | || ||Eco57MI | AsuII | || ||Eco57I | TaqI | || |MseI TspEI | || TspEI ApoI | |PacI | |MseI | BbvII* | MboII HinfI F R E L K T L L I N K G Y K F E S D T D L E N * R L F * L T K V I N S K V I P I * R T E D S F N * Q R L * I R K * Y R Y ----:----|----:----|----:----|----:----|----:----|----:----| K L S S F V R K I L L P * L N S L S V S N * L V S S E K L * C L N Y I R F H Y R K S F Q L S K * N V F T I F E F T I G I BcgI ApoI FatI |CviRI* TspEI |CviAII \\ \ \\ ACCGAGTGTATTGCTAAACTATATTTGCATTTATACAATACAAATTTACAAAATGGGCAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCTCACATAACGATTTGATATAAACGTAAATATGTTATGTTTAAATGTTTTACCCGTA / / / / / | CviRI* TspEI | CviAII BcgI ApoI NlaIII T E C I A K L Y L H L Y N T N L Q N G H P S V L L N Y I C I Y T I Q I Y K M G M R V Y C * T I F A F I Q Y K F T K W A * ----:----|----:----|----:----|----:----|----:----|----:----| V S H I A L S Y K C K Y L V F K C F P C Y R T Y Q * V I N A N I C Y L N V F H A G L T N S F * I Q M * V I C I * L I P M AluI TsoI CviJI | Hin4II* NlaIII TspEI |MaeI | |TspDTI | DdeI | MseI ||SetI | || MaeI SetI \ \ \ \ \\\ \ \\ \ \ GACTTAGATTTCCACGAATTAACCAAGCTAGTTCTTTTAGAACTAGAAGGTTCATACGGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAATCTAAAGGTGCTTAATTGGTTCGATCAAGAAAATCTTGATCTTCCAAGTATGCCC / / // / / / / / / / FatI DdeI || | | | TsoI | | SetI || | | MaeI | MaeI || | CviJI Hin4II* || | AluI TspDTI || SetI |MseI TspEI D L D F H E L T K L V L L E L E G S Y G T * I S T N * P S * F F * N * K V H T G L R F P R I N Q A S S F R T R R F I R V ----:----|----:----|----:----|----:----|----:----|----:----| S K S K W S N V L S T R K S S S P E Y P H S L N G R I L W A L E K L V L L N M R V * I E V F * G L * N K * F * F T * V P AsuI* AvaII DraII PpuMI SanDI |BdaI |BdaI SetI |NlaIV MaeIII | BslFI |BmgT120I Tsp45I MnlI | | MaeI ||NlaIV \ \ \ \ \ \\\ TTATTATGTAAATCTTGTCACTATCCTAATGAGGTTATCGCCACTAGAAAAGGGTCCCCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATACATTTAGAACAGTGATAGGATTACTCCAATAGCGGTGATCTTTTCCCAGGGGA / / / / / / /// | MnlI SetI | MaeI | ||SanDI Tsp45I BslFI | ||PpuMI MaeIII | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | |NlaIV | NlaIV BdaI BdaI L L C K S C H Y P N E V I A T R K G S P Y Y V N L V T I L M R L S P L E K G P L I M * I L S L S * * G Y R H * K R V P F ----:----|----:----|----:----|----:----|----:----|----:----| N N H L D Q * * G L S T I A V L F P D G T I I Y I K D S D * H P * R W * F L T G * * T F R T V I R I L N D G S S F P G R SalI |TaqI Hpy188I |AccI BseGI | BdaI ||HindII |ApoI | BdaI ||Hpy166II |TspEI \ \ \\\ \\ TTACTGATTGGTGTCAAATCTGAAAAAAAACTAAAAGTCGACTTCGTGGATGTGGAATTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AATGACTAACCACAGTTTAGACTTTTTTTTGATTTTCAGCTGAAGCACCTACACCTTAAA / / /// / / | BdaI ||SalI BseGI TspEI | BdaI |AccI ApoI Hpy188I |TaqI Hpy166II HindII L L I G V K S E K K L K V D F V D V E F Y * L V S N L K K N * K S T S W M W N F T D W C Q I * K K T K S R L R G C G I S ----:----|----:----|----:----|----:----|----:----|----:----| K S I P T L D S F F S F T S K T S T S N K V S Q H * I Q F F V L L R S R P H P I * Q N T D F R F F F * F D V E H I H F K MboII | HindII | Hpy166II | | BetI* | | |HpaII FokI | | || ApoI Hpy178III* | | || TspEI CviJI \ \ \ \\ \ \ CCCGAAGAAAACGCTGGTCAACCGGAAATTCCATTGAAATCTAACAACAAATCATTTGGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCTTCTTTTGCGACCAGTTGGCCTTTAAGGTAACTTTAGATTGTTGTTTAGTAAACCG / / / / // / / | FokI | | || TspEI CviJI Hpy178III* | | || ApoI | | |BetI* | | HpaII | Hpy166II | HindII MboII P E E N A G Q P E I P L K S N N K S F G P K K T L V N R K F H * N L T T N H L A R R K R W S T G N S I E I * Q Q I I W L ----:----|----:----|----:----|----:----|----:----|----:----| G S S F A P * G S I G N F D L L L D N P E R L F R Q D V P F E M S I * C C I M Q G F F V S T L R F N W Q F R V V F * K A AsuI* Bsp120I |AsuI* |BmgT120I ||CviJI ||NlaIV AluI ||HaeIII CviJI ||BmgT120I |BsiI* ||| ApaI ||SetI AluI ||| SduI |||Hpy178III* CviJI ||| BseSI |||| ApoI | SetI MfeI ||| HgiJII* |||| TspEI | | NlaIV TspEI TspEI \\\ \ \\\\ \ \ \ \ \ \ TTGGGCCCAAAGAAAGCTCGTGAATTTGAAGCTGGTTCCCAAAATGCCAATTTACTACCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCGGGTTTCTTTCGAGCACTTAAACTTCGACCAAGGGTTTTACGGTTAAATGATGGT / /// / / / / / / / / | ||| | | | | | | NlaIV TspEI | ||| | | | | | CviJI | ||| | | | | | AluI | ||| | | | | SetI | ||| | | | TspEI | ||| | | | ApoI | ||| | | Hpy178III* | ||| | | BsiI* | ||| | CviJI | ||| | AluI | ||| SetI | ||Bsp120I | ||AsuI* | |BmgT120I | |AsuI* | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI L G P K K A R E F E A G S Q N A N L L P W A Q R K L V N L K L V P K M P I Y Y Q G P K E S S * I * S W F P K C Q F T T N ----:----|----:----|----:----|----:----|----:----|----:----| K P G F F A R S N S A P E W F A L K S G S P G L S L E H I Q L Q N G F H W N V V Q A W L F S T F K F S T G L I G I * * W BssKI EcoRII ApoI |SecI* TspEI ||ScrFI | BplI ||BseBI AciI | BplI ||| Bce83I* BisI | | MseI ||| |CviJI BccI |BlsI | | |BsmAI ||| || BplI | Hpy188I ||TauI | | || SmlI TspDTI ||| || BplI | | CspCI \\\ \ \ \\ \ \ \\\ \\ \ \ \ \ ATTGCCGCCAATGAATTTAACTTGAGACATTCTCAATCCAGGGCTTTCCTATCAGAAGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGGCGGTTACTTAAATTGAACTCTGTAAGAGTTAGGTCCCGAAAGGATAGTCTTCTA ///// / / / / // / // // ||||| BplI | | | |SmlI | |CviJI |CspCI ||||| BplI | | | TspDTI | EcoRII Hpy188I ||||AciI | | BsmAI | BssKI BccI |||BisI | MseI | SecI* ||BlsI TspEI | BplI |TauI ApoI | BplI TspEI Bce83I* MfeI BseBI ScrFI I A A N E F N L R H S Q S R A F L S E D L P P M N L T * D I L N P G L S Y Q K M C R Q * I * L E T F S I Q G F P I R R W ----:----|----:----|----:----|----:----|----:----|----:----| I A A L S N L K L C E * D L A K R D S S L Q R W H I * S S V N E I W P K G I L L N G G I F K V Q S M R L G P S E * * F I ApoI TspEI | MboII MboI | | SfaNI XhoII | | |Hin4I | DpnI | | |Hin4I | |BstKTI | | || MmeI | || MboII | | || CspCI | || | BinI* | | || | Hpy188I | || | | AgeI | | || | | AciI | || | | BetI* | | || | | |BisI | || | | SgrAI | | || | | ||BlsI FokI Hin4I | || | | Cfr10I | | || | | ||BseGI | SfaNI Hin4I | || | | |HpaII | | || | | |||TauI | |MseI Hin4II* \ \\ \ \ \\ \ \ \\ \ \ \\\\ \ \\ \ GGATCTCCAACACCGGTGGAATTTTTTGTTTCTTCGGATGCGGCATCTGTTGTTAAACAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGAGGTTGTGGCCACCTTAAAAAACAAAGAAGCCTACGCCGTAGACAACAATTTGTA // // / // // / / / /// / // / || || | || |TspEI | | | ||BisI | || Hin4II* || || | || |Hin4I | | | ||AciI | |SfaNI || || | || |Hin4I | | | |BlsI | Hin4I || || | || |ApoI | | | BseGI | Hin4I || || | || MboII | | | TauI | MseI || || | |Cfr10I | | Hpy188I FokI || || | |SgrAI | SfaNI || || | |BetI* CspCI || || | |AgeI MmeI || || | HpaII || || BinI* || |MboII || XhoII || MboI |DpnI BstKTI G S P T P V E F F V S S D A A S V V K H D L Q H R W N F L F L R M R H L L L N I I S N T G G I F C F F G C G I C C * T Y ----:----|----:----|----:----|----:----|----:----|----:----| P D G V G T S N K T E E S A A D T T L C H I E L V P P I K Q K K P H P M Q Q * V S R W C R H F K K N R R I R C R N N F M MboII TspDTI SetI | CviJI BccI |MaeIII \ \ \ \ \\ ACCAAGAAGGTGCTATTTTTAGAAGATGACGATTTGGCTCATATTTACGATGGTGAGTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCTTCCACGATAAAAATCTTCTACTGCTAAACCGAGTATAAATGCTACCACTCAAT / / / / / SetI | CviJI BccI TspDTI MboII T K K V L F L E D D D L A H I Y D G E L P R R C Y F * K M T I W L I F T M V S Y Q E G A I F R R * R F G S Y L R W * V T ----:----|----:----|----:----|----:----|----:----|----:----| V L F T S N K S S S S K A * I * S P S N Y W S P A I K L L H R N P E Y K R H H T G L L H * K * F I V I Q S M N V I T L * MboI BglII XhoII | DpnI SfaNI | Ksp632I* | Tth111I | |XbaI Hin6I | | AsuI* | |BstKTI MboII | | AvaII | ||MaeI |GlaI | | |BmgT120I HphI | ||Hpy178III* ||HhaI | | ||SetI BccI \ \ \\\ \\\ \ \ \\\ \ CATATTCATAGATCTAGAAGAGAAGTAGGCGCATCAATGACAAGGTCCATTCAAACTTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTATAAGTATCTAGATCTTCTCTTCATCCGCGTAGTTACTGTTCCAGGTAAGTTTGAAAT / / // //// //// /// // / | HphI || |||XbaI |||Hin6I ||| |AvaII BccI MaeIII || ||Hpy178III* ||GlaI ||| |AsuI* || ||MaeI |HhaI ||| BmgT120I || |Ksp632I* MboII ||SfaNI || XhoII |Tth111I || BglII SetI || MboI |DpnI BstKTI H I H R S R R E V G A S M T R S I Q T L I F I D L E E K * A H Q * Q G P F K L * Y S * I * K R S R R I N D K V H S N F R ----:----|----:----|----:----|----:----|----:----|----:----| C I * L D L L S T P A D I V L D M * V K V Y E Y I * F L L L R M L S L T W E F K M N M S R S S F Y A C * H C P G N L S * AluI CviJI |DdeI ||SetI |||BarI ||||MboI ||||Hpy188I |||||Hin4II* ||||||DpnI |||||||FatI |||||||BspHI |||||||BstKTI ||||||||CviAII ||||||||Hpy178III* ||||||||| NlaIII ||||||||| | AsuI* ||||||||| | DraII ||||||||| | BspCNI ||||||||| | Bsp120I ||||||||| | |AsuI* ||||||||| | |DraII ||||||||| | |BseMII ||||||||| | |BmgT120I ||||||||| | ||CviJI ||||||||| | ||NlaIV ||||||||| | ||HaeIII ||||||||| | ||BmgT120I ||||||||| | ||| ApaI ||||||||| | ||| SduI ||||||||| | ||| BseSI ||||||||| | ||| HgiJII* BarI ||||||||| | ||| | TspDTI CviRI* \\\\\\\\\ \ \\\ \ \ \ GAGATGGAGTTAGCTCAGATCATGAAGGGCCCTTACGACCATTTTATGCAAAAGGAAATC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTACCTCAATCGAGTCTAGTACTTCCCGGGAATGCTGGTAAAATACGTTTTCCTTTAG / / ////// ///// /// / / / | | |||||| ||||| ||| TspDTI BarI CviRI* | | |||||| ||||| ||Bsp120I | | |||||| ||||| ||DraII | | |||||| ||||| ||AsuI* | | |||||| ||||| |BmgT120I | | |||||| ||||| |DraII | | |||||| ||||| |AsuI* | | |||||| ||||| BmgT120I | | |||||| ||||| HaeIII | | |||||| ||||| NlaIV | | |||||| ||||| CviJI | | |||||| ||||HgiJII* | | |||||| ||||BseSI | | |||||| ||||SduI | | |||||| ||||ApaI | | |||||| |||BseMII | | |||||| ||BspCNI | | |||||| |BspHI | | |||||| |FatI | | |||||| Hpy178III* | | |||||| CviAII | | |||||MboI | | ||||NlaIII | | |||DpnI | | ||BstKTI | | |Hin4II* | | |DdeI | | Hpy188I | CviJI | AluI SetI BarI E M E L A Q I M K G P Y D H F M Q K E I R W S * L R S * R A L T T I L C K R K S D G V S S D H E G P L R P F Y A K G N L ----:----|----:----|----:----|----:----|----:----|----:----| S I S N A * I M F P G * S W K I C F S I L S P T L E S * S P G K R G N * A F P F L H L * S L D H L A R V V M K H L L F D SetI | TfiI TfiI Hin4I | HinfI HinfI | MnlI | | TaqI Hin4I \ \ \ \ \ \ \ TATGAGCAACCAGAATCTACTTTCAATACTATGAGAGGTAGAATCGACTATGAAAATAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCGTTGGTCTTAGATGAAAGTTATGATACTCTCCATCTTAGCTGATACTTTTATTA / / / / / / / / | Hin4I MnlI SetI | TaqI Hin4I TaqII HinfI HinfI TfiI TfiI Y E Q P E S T F N T M R G R I D Y E N N M S N Q N L L S I L * E V E S T M K I I * A T R I Y F Q Y Y E R * N R L * K * * ----:----|----:----|----:----|----:----|----:----|----:----| * S C G S D V K L V I L P L I S * S F L R H A V L I * K * Y * S L Y F R S H F Y I L L W F R S E I S H S T S D V I F I I TsoI SapI |MseI Ksp632I* ||AhaIII* | Hpy188I ||| FatI | | BsmAI ||| |CviAII | | | SduI ||| || MaeIII | | | HgiAI* ||| || BstEII | | | | MboII TaqII ||| || NlaIII | | | | | MboI | TspDTI ||| || | BsrI | | | | | BclI \ \ \\\ \\ \ \ \ \ \ \ \ \ AAAGTGATATTGGGTGGTTTAAAGGCATGGTTACCAGTTGTCAGAAGAGCACGGAGACTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCACTATAACCCACCAAATTTCCGTACCAATGGTCAACAGTCTTCTCGTGCCTCTGAC / / // / // / / / / / / / TspDTI | || | || | BstEII | | | | BstKTI | || | || | MaeIII | | | MboII | || | || BsrI | | BsmAI | || | |FatI | HgiAI* | || | CviAII | SduI | || NlaIII Ksp632I* | |MseI Hpy188I | AhaIII* SapI TsoI K V I L G G L K A W L P V V R R A R R L K * Y W V V * R H G Y Q L S E E H G D * S D I G W F K G M V T S C Q K S T E T D ----:----|----:----|----:----|----:----|----:----|----:----| L T I N P P K F A H N G T T L L A R L S Y L S I P H N L P M T V L Q * F L V S V F H Y Q T T * L C P * W N D S S C P S Q DpnI |FatI |BspHI |BstKTI ||CviAII ||Hpy178III* |||BsaBI ||||MboI |||||NlaIII |||||TspGWI ||||||DpnI |||||||BstKTI |||||||| FatI |||||||| |CviAII |||||||| ||Cac8I TsoI |||||||| ||| AciI | FatI |||||||| ||| SphI | |CviAII |||||||| ||| NspI | || NlaIII |||||||| ||| NlaIII | || | CviJI |||||||| ||| | Csp6I | || | | BsiI* |||||||| ||| | |RsaI | || | | |MboII TaqI |||||||| ||| | || TspDTI | || | | ||MwoI AsuII \\\\\\\\ \\\ \ \\ \ \ \\ \ \ \\\ \ ATCATGATCGCATGCGGTACTTCTTATCATTCATGTTTGGCTACTCGTGCTATCTTCGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTACTAGCGTACGCCATGAAGAATAGTAAGTACAAACCGATGAGCACGATAGAAGCTT /////// // /// / // / / // / // / / ||||||| || ||| | |Csp6I TsoI | |FatI | || BsiI* AsuII ||||||| || ||| | TspDTI | | | |MboII TaqI ||||||| || ||| | RsaI | | | MwoI ||||||| || ||| AciI | | CviJI ||||||| || ||FatI | CviAII ||||||| || |CviAII NlaIII ||||||| || Cac8I ||||||| |NlaIII ||||||| |NspI ||||||| |SphI ||||||| MboI ||||||DpnI |||||BstKTI |||||BspHI |||||FatI ||||Hpy178III* ||||CviAII |||TspGWI |||BsaBI ||BclI ||MboI |NlaIII DpnI I M I A C G T S Y H S C L A T R A I F E S * S H A V L L I I H V W L L V L S S K H D R M R Y F L S F M F G Y S C Y L R R ----:----|----:----|----:----|----:----|----:----|----:----| I M I A H P V E * * E H K A V R A I K S S * S R M R Y K K D N M N P * E H * R R D H D C A T S R I M * T Q S S T S D E F Hpy188I Hpy188I | Hpy178III* |BfiI | | Eco57I |MboII | | Eco57MI || EcoRV | | | MboII TspEI || | BsrI HgaI TspEI | | | BbvII* \ \\ \ \ \ \ \ \ \ \ GAATTATCAGATATCCCAGTTAGTGTGGAATTAGCGTCTGACTTTCTGGACAGAAAATGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATAGTCTATAGGGTCAATCACACCTTAATCGCAGACTGAAAGACCTGTCTTTTACG / // / / / / / // / | || | BsrI | TspEI Hpy188I || MboII | || EcoRV HgaI |Eco57MI | |MboII |Eco57I | |BfiI Hpy178III* | Hpy188I TspEI E L S D I P V S V E L A S D F L D R K C N Y Q I S Q L V W N * R L T F W T E N A I I R Y P S * C G I S V * L S G Q K M P ----:----|----:----|----:----|----:----|----:----|----:----| S N D S I G T L T S N A D S K R S L F H L I I L Y G L * H P I L T Q S E P C F I F * * I D W N T H F * R R V K Q V S F A BciVI | AciI Esp3I | | HphI BsmAI | | | FatI | Hpy188I DraIII | | | |CviAII \ \ \ \ \ \ \\ CCTGTCTTCAGAGACGATGTATGCGTGTTTGTTTCACAAAGTGGTGAAACTGCGGATACC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAGAAGTCTCTGCTACATACGCACAAACAAAGTGTTTCACCACTTTGACGCCTATGG / / / / / / BbvII* Hpy188I DraIII BciVI HphI NlaIII BsmAI AciI Esp3I P V F R D D V C V F V S Q S G E T A D T L S S E T M Y A C L F H K V V K L R I P C L Q R R C M R V C F T K W * N C G Y H ----:----|----:----|----:----|----:----|----:----|----:----| G T K L S S T H T N T E C L P S V A S V G Q R * L R H I R T Q K V F H H F Q P Y R D E S V I Y A H K N * L T T F S R I G Tsp4CI* | BseRI | | Hpy188I | | | MseI | | | |HpaI NlaIII | | | |HindII | Cac8I NlaIV | | | |Hpy166II | | CviJI MnlI |CviJI | | | || Tsp4CI* | | | TspEI | MmeI || MseI | | |TspEI || |MboII \ \ \ \ \ \ \\ \ \ \ \\ \\ \\ ATGCTGGCTCTAAATTATTGTTTAGAAAGAGGAGCCTTAACTGTCGGAATTGTTAACAGT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACGACCGAGATTTAATAACAAATCTTTCTCCTCGGAATTGACAGCCTTAACAATTGTCA // / / / // // / // / / // // || | CviJI | |MmeI || | || | | || |MboII || Cac8I | MnlI || | || | | || Tsp4CI* |FatI TspEI || | || | | |MseI CviAII || | || | | Hpy166II || | || | | HindII || | || | | TspRI || | || | | HpaI || | || | TspEI || | || Hpy188I || | |BseRI || | Tsp4CI* || MseI |CviJI NlaIV M L A L N Y C L E R G A L T V G I V N S C W L * I I V * K E E P * L S E L L T V A G S K L L F R K R S L N C R N C * Q C ----:----|----:----|----:----|----:----|----:----|----:----| M S A R F * Q K S L P A K V T P I T L L W A P E L N N N L F L L R L Q R F Q * C H Q S * I I T * F S S G * S D S N N V T TspDTI AsuI* HphI | Tsp4CI* AvaII | BsiI* | |OliI |BmgT120I | | MaeIII | |MslI TaqII || Hpy178III* TspRI | | Tsp45I | || TspRI | MseI || | TspEI \ \ \ \ \ \\ \ \ \ \\ \ \ GTTGGTTCTTCTATCTCTCGTGTCACCCACTGTGGTGTTCATATTAACGCTGGTCCTGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCAAGAAGATAGAGAGCACAGTGGGTGACACCACAAGTATAATTGCGACCAGGACTT / / // / / / / // // HphI | || | MslI TaqII MseI || |BsiYI* | || | OliI || Hpy178III* | || Tsp4CI* |AvaII | |Tsp45I |AsuI* | |MaeIII BmgT120I | |TspDTI | TspRI BsiI* V G S S I S R V T H C G V H I N A G P E L V L L S L V S P T V V F I L T L V L K W F F Y L S C H P L W C S Y * R W S * N ----:----|----:----|----:----|----:----|----:----|----:----| T P E E I E R T V W Q P T * I L A P G S H Q N K * R E H * G S H H E Y * R Q D Q N T R R D R T D G V T T N M N V S T R F HindIII |MnlI ||AluI ||CviJI ||| SetI Hin4I BsiYI* ||| | BfiI BsrI | DdeI \ \\\ \ \ \ \ \ ATTGGTGTTGCCTCTACAAAAGCTTATACTTCCCAGTATATTGCCTTAGTGATGTTTGCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCACAACGGAGATGTTTTCGAATATGAAGGGTCATATAACGGAATCACTACAAACGA / / / / / / / / TspEI | | | BfiI BsrI Hin4I DdeI | | HindIII | CviJI | AluI MnlI SetI I G V A S T K A Y T S Q Y I A L V M F A L V L P L Q K L I L P S I L P * * C L L W C C L Y K S L Y F P V Y C L S D V C S ----:----|----:----|----:----|----:----|----:----|----:----| I P T A E V F A * V E W Y I A K T I N A F Q H Q R * L L K Y K G T Y Q R L S T Q N T N G R C F S I S G L I N G * H H K S Hin4I Hin4I | Hpy188I | | Hin4I Hin4I | | | Tsp4CI* BdaI Hin4I XmnI | | | | TaqI BdaI | TspEI MboII CviJI \ \ \ \ \ \ \ \ \ \ CTATCGCTGTCAGATGACCGTGTATCGAAAATAGACAGAAGAATTGAAATCATTCAAGGC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGCGACAGTCTACTGGCACATAGCTTTTATCTGTCTTCTTAACTTTAGTAAGTTCCG / / / / / / / / // / Hin4I | | Tsp4CI* TaqI | Hin4I | |XmnI CviJI Hin4I | Hpy188I | Hin4I | MboII Hin4I BdaI TspEI BdaI L S L S D D R V S K I D R R I E I I Q G Y R C Q M T V Y R K * T E E L K S F K A I A V R * P C I E N R Q K N * N H S R L ----:----|----:----|----:----|----:----|----:----|----:----| R D S D S S R T D F I S L L I S I M * P E I A T L H G H I S F L C F F Q F * E L * R Q * I V T Y R F Y V S S N F D N L A MseI |BdaI |BdaI || BssKI || |AvaI || |BssKI || |SecI* || |Cfr9I || ||HpaII || ||ScrFI || ||CauII* || ||BmeT110I || |||SmaI || |||ScrFI || |||CauII* || ||||AsuI* || |||||BmgT120I || ||||||CviJI || ||||||HaeIII AluI || |||||||BspMI CviJI || |||||||| TspEI SetI | SetI AluI || |||||||| | MseI | MseI | | NlaIV CviJI \\ \\\\\\\\ \ \ \ \ \ \ \ \ TTGAAGTTAATCCCGGGCCAAATTAAGCAGGTATTAAAGCTGGAACCAAGAATAAAAAAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCAATTAGGGCCCGGTTTAATTCGTCCATAATTTCGACCTTGGTTCTTATTTTTTC / / ///// / // / // / / / / | MseI ||||| | || SetI || | NlaIV | CviJI BdaI ||||| | |MseI || CviJI | AluI BdaI ||||| | TspEI || AluI SetI ||||| BspMI |SetI ||||AsuI* MseI |||BmgT120I |||HaeIII |||BssKI |||CviJI ||Cfr9I ||BssKI ||SecI* ||AvaI |BmeT110I |CauII* |HpaII |ScrFI CauII* ScrFI SmaI L K L I P G Q I K Q V L K L E P R I K K * S * S R A K L S R Y * S W N Q E * K S E V N P G P N * A G I K A G T K N K K A ----:----|----:----|----:----|----:----|----:----|----:----| K F N I G P W I L C T N F S S G L I F F S S T L G P G F * A P I L A P V L F L F Q L * D R A L N L L Y * L Q F W S Y F L BbvI |MaeIII Hin4I MboI EcoP15I |BstEII Hin4I | DpnI | MnlI || BbvI TspEI | |BstKTI | | Hin4I || SetI SetI | MseI | || BinI* | | Hin4I || | TspEI \ \ \ \ \\ \ \ \ \ \\ \ \ CTCTGTGCGACTGAATTAAAGGATCAAAAATCTCTATTGTTATTGGGTAGAGGTTACCAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GAGACACGCTGACTTAATTTCCTAGTTTTTAGAGATAACAATAACCCATCTCCAATGGTT / // // / / // / / / // Hin4I || || MboI BinI* || MnlI SetI | |BbvI Hin4I || |DpnI |Hin4I | BstEII || BstKTI |Hin4I | MaeIII |MseI EcoP15I BbvI TspEI L C A T E L K D Q K S L L L L G R G Y Q S V R L N * R I K N L Y C Y W V E V T N L C D * I K G S K I S I V I G * R L P I ----:----|----:----|----:----|----:----|----:----|----:----| S Q A V S N F S * F D R N N N P L P * W A R H S Q I L P D F I E I T I P Y L N G E T R S F * L I L F R * Q * Q T S T V L TseI |BisI ||BlsI |||TseI MboI ||||BisI | DpnI BsmI |||||BlsI | |BstKTI CviRI* ||||||Hin4II* | || ApoI |Hin4II* ||||||| Hpy178III* | || TspEI ||EcoT22I ||||||| | SetI | || |MboII ||| Hpy188I \\\\\\\ \ \ \ \\ \\ \\\ \ TTTGCTGCTGCTCTGGAAGGTGCTTTGAAGATCAAAGAAATTTCTTATATGCATTCTGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGACGACGAGACCTTCCACGAAACTTCTAGTTTCTTTAAAGAATATACGTAAGACTT / ////// / / // / / / / / / / | |||||TseI | SetI || MboI | TspEI | | | SetI | ||||| Hpy178III* |DpnI | ApoI | | Hpy188I | ||||Hin4II* BstKTI MboII | Hin4II* | ||||BisI | CviRI* | |||BlsI EcoT22I | ||TseI BsmI | |BisI | BlsI TspEI F A A A L E G A L K I K E I S Y M H S E L L L L W K V L * R S K K F L I C I L K C C C S G R C F E D Q R N F L Y A F * R ----:----|----:----|----:----|----:----|----:----|----:----| N A A A R S P A K F I L S I E * I C E S I Q Q Q E P L H K S S * L F K K Y A N Q K S S S Q F T S Q L D F F N R I H M R F CviJI AarI SetI HaeIII BspMI | Eco57I HphI |StyI | SetI | Eco57MI | Tsp4CI* |SecI* Hpy166II \ \ \ \ \ \ \\ \ GGTGTTTTGGCAGGTGAGTTGAAGCACGGTGTCTTGGCCTTGGTGGACGAAAACTTGCCA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAAAACCGTCCACTCAACTTCGTGCCACAGAACCGGAACCACCTGCTTTTGAACGGT / / / / / / / / / BspMI | Eco57MI | Tsp4CI* | | Hpy166II BsrDI AarI | Eco57I HphI | SecI* SetI | StyI HaeIII CviJI G V L A G E L K H G V L A L V D E N L P V F W Q V S * S T V S W P W W T K T C Q C F G R * V E A R C L G L G G R K L A N ----:----|----:----|----:----|----:----|----:----|----:----| P T K A P S N F C P T K A K T S S F K G L H K P L H T S A R H R P R P P R F S A T N Q C T L Q L V T D Q G Q H V F V Q W Acc65I HgiCI* |BsmAI |Csp6I ||RsaI ||NlaIV |||MlyI |||PleI AlfI MnlI BsrDI ||||KpnI HinfI AlfI | MaeIII \ \\\\\ \ \ \ \ ATCATTGCTTTTGGTACCAGAGACTCTCTATTCCCTAAAGTAGTTTCCTCTATTGAGCAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAACGAAAACCATGGTCTCTGAGAGATAAGGGATTTCATCAAAGGAGATAACTCGTT / //// / / / | |||BsmAI HinfI AlfI MnlI | ||HgiCI* AlfI | ||Acc65I | ||PleI | |Csp6I | |MlyI | NlaIV | RsaI KpnI I I A F G T R D S L F P K V V S S I E Q S L L L V P E T L Y S L K * F P L L S K H C F W Y Q R L S I P * S S F L Y * A S ----:----|----:----|----:----|----:----|----:----|----:----| I M A K P V L S E R N G L T T E E I S C L * Q K Q Y W L S E I G * L L K R * Q A D N S K T G S V R * E R F Y N G R N L L AsuI* |BmgT120I ||CviJI ||HaeIII |||BseGI |||| AlfI |||| AlfI Hin6I FokI |||| | TspEI |GlaI | CviRI* |||| | | BccI MaeIII ||HhaI \ \ \\\\ \ \ \ \ \\\ GTTACTGCAAGAAAGGGCCATCCAATTATTATTTGTAACGAAAATGATGAAGTGTGGGCG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGACGTTCTTTCCCGGTAGGTTAATAATAAACATTGCTTTTACTACTTCACACCCGC / / / /// / / /// | | FokI ||AsuI* TspEI MaeIII ||TspDTI | CviRI* ||AlfI BccI ||Hin6I MaeIII ||AlfI |GlaI |BmgT120I HhaI |HaeIII |CviJI BseGI V T A R K G H P I I I C N E N D E V W A L L Q E R A I Q L L F V T K M M K C G R Y C K K G P S N Y Y L * R K * * S V G A ----:----|----:----|----:----|----:----|----:----|----:----| T V A L F P W G I I I Q L S F S S T H A L * Q L F P G D L * * K Y R F H H L T P N S C S L A M W N N N T V F I I F H P R SetI |CviRI* || BspMI || |DdeI TspDTI TaqI || ||SetI Tsp4CI* Hpy166II \ \ \\ \\\ \ \ CAAAAATCTAAATCAATCGACCTGCAAACCTTAGAAGTTCCACAAACTGTTGATTGTTTA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTTAGATTTAGTTAGCTGGACGTTTGGAATCTTCAAGGTGTTTGACAACTAACAAAT / / / / / / TaqI | SetI BspMI Tsp4CI* Hpy166II SetI CviRI* DdeI Q K S K S I D L Q T L E V P Q T V D C L K N L N Q S T C K P * K F H K L L I V Y K I * I N R P A N L R S S T N C * L F T ----:----|----:----|----:----|----:----|----:----|----:----| C F D L D I S R C V K S T G C V T S Q K A F I * I L R G A F R L L E V F Q Q N N L F R F * D V Q L G * F N W L S N I T * SetI | TspEI | | MseI | | VspI CviJI | | | SspI | MseI \ \ \ \ \ \ CAAGGTCTAATTAATATTATTCCATTACAACTAATGTCATATTGGTTGGCTGTTAATAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCAGATTAATTATAATAAGGTAATGTTGATTACAGTATAACCAACCGACAATTATTT / // / / / SetI || SspI CviJI MseI |VspI |MseI TspEI Q G L I N I I P L Q L M S Y W L A V N K K V * L I L F H Y N * C H I G W L L I K R S N * Y Y S I T T N V I L V G C * * R ----:----|----:----|----:----|----:----|----:----|----:----| C P R I L I I G N C S I D Y Q N A T L L V L D L * Y * E M V V L T M N T P Q * Y L T * N I N N W * L * H * I P Q S N I F MaeIII | Tsp4CI* | | TaqI TsoI CviJI | | | Hpy99I \ \ \ \ \ \ GGGATTGATGTTGATTTTCCAAGAAACTTGGCTAAATCTGTTACCGTCGAATAA 2110 2120 2130 2140 2150 ----:----|----:----|----:----|----:----|----:----|---- CCCTAACTACAACTAAAAGGTTCTTTGAACCGATTTAGACAATGGCAGCTTATT / / / / TsoI CviJI | TaqI Tsp4CI* MaeIII Hpy99I G I D V D F P R N L A K S V T V E * G L M L I F Q E T W L N L L P S N X D * C * F S K K L G * I C Y R R I X ----:----|----:----|----:----|----:----|----:----|---- P I S T S K G L F K A L D T V T S Y L S Q H Q N E L F S P * I Q * R R I P N I N I K W S V Q S F R N G D F L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 4 BspACI,SsiI AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AlfI 2 AluI 8 AluBI ApaI 2 ApoI 9 AcsI,XapI AsuI* 9 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 1 BpuEI BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 4 BetI* 3 BsaWI BfiI 2 BmrI,BmuI BglII 2 BinI* 3 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 9 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BseRI 3 BseSI 2 BaeGI,BstSLI BsiI* 3 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 2 PspOMI BspCNI 1 BspHI 2 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 9 Cac8I 2 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I Cfr9I 1 TspMI,XmaCI,XmaI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CspCI 2 CviAII 7 CviJI 24 CviKI-1 CviRI* 6 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 9 MalI DraII 3 EcoO109I DraIII 1 AdeI Eco57I 3 AcuI Eco57MI 3 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI FatI 7 FokI 4 GlaI 3 HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 5 HpyAV Hin6I 3 HinP1I,HspAI HindII 5 HincII HindIII 1 HinfI 6 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 13 Hpy99I 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 12 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 14 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 10 MseI 16 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 1 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI OliI 2 AleI PacI 1 PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI RsaI 2 AfaI SalI 2 SanDI 1 SapI 1 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 24 SfaNI 3 LweI SgrAI 1 SmaI 1 SmlI 1 SmoI SphI 1 PaeI,BbuI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 10 TaqII 2 TauI 2 TfiI 4 PfeI TseI 2 ApeKI TsoI 5 Tsp45I 4 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 27 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflII AflIII AjuI AloI AlwNI ApaLI AscI AvrII BaeI BalI BamHI BbvCI BceAI BglI BmtI Bpu10I BsaAI BsaXI BsePI BseYI BsgI Bsp1407I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI BtsI CfrI DinI DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EgeI EheI EspI* FalI FauI FnuDII* FseI FspAI GsaI GsuI HaeII KasI MauBI MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* PasI PfoI PmaCI PmeI PpiI PshAI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrDI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TstI XcmI XhoI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769