Restriction Map of UTP11/YKL099C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

UTP11/YKL099C on chromosome XI from coordinates 256472 to 255720.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 AclI BbvI MaeII | BceAI TatI | |SetI Bsp1407I | |TaiI |Csp6I Hpy188I | || DdeI ||RsaI | TseI | || | AluI |||FatI | |BisI | || | CviJI CviJI ||||CviAII | ||BlsI | || | | SetI |PsrI ||||| NlaIII | ||| PsrI | || | | | MaeI \\ \\\\\ \ \ \\\ \ \ \\ \ \ \ \ ATGGCTAAACTTGTACATGATGTTCAGAAAAAGCAGCATAGAGAACGTTCTCAGCTAACT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATTTGAACATGTACTACAAGTCTTTTTCGTCGTATCTCTTGCAAGAGTCGATTGA / /// // / / /// / / / /// CviJI ||| |FatI | | ||TseI | | | ||CviJI ||| CviAII | | |BisI | | | ||AluI ||Bsp1407I | | BlsI | | | |DdeI ||TatI | PsrI | | | SetI |NlaIII Hpy188I | | BceAI |Csp6I | | BbvI RsaI | MaeII | AclI TaiI SetI M A K L V H D V Q K K Q H R E R S Q L T W L N L Y M M F R K S S I E N V L S * L G * T C T * C S E K A A * R T F S A N * ----:----|----:----|----:----|----:----|----:----|----:----| X A L S T C S T * F F C C L S R E * S V X P * V Q V H H E S F A A Y L V N E A L H S F K Y M I N L F L L M S F T R L * S MaeII | SetI CviJI | TaiI |BspCNI | | SmlI ||BseMII | | |SduI ||| Hpy178III* | | |HgiAI* ||| | BsiYI* Bce83I* | | ||Hpy178III* \\\ \ \ \ \ \ \\\ AGCCGTTCCAGATATGGGTTTTTAGAAAAGCATAAAGACTATGTGAAACGTGCTCAAGAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGCAAGGTCTATACCCAAAAATCTTTTCGTATTTCTGATACACTTTGCACGAGTTCTG // // / / / / |BseMII |BsiYI* Bce83I* | HgiAI* Hpy178III* |CviJI Hpy178III* | MaeII SmlI BspCNI | SduI MaeI TaiI SetI S R S R Y G F L E K H K D Y V K R A Q D A V P D M G F * K S I K T M * N V L K T P F Q I W V F R K A * R L C E T C S R L ----:----|----:----|----:----|----:----|----:----|----:----| L R E L Y P N K S F C L S * T F R A * S * G N W I H T K L F A Y L S H S V H E L A T G S I P K * F L M F V I H F T S L V DdeI | Hpy188I | | MnlI | | | BspCNI | | | |BseMII BdaI | | | ||BdaI BdaI Hpy166II | | | ||BdaI Hpy178III* \ \ \ \ \ \\\ \ TTCCACAGGAAGCAGTCCACTTTGAAAGTCCTCAGAGAAAAAGCAAAAGAGAGAAATCCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTGTCCTTCGTCAGGTGAAACTTTCAGGAGTCTCTTTTTCGTTTTCTCTCTTTAGGT / / // / /// / BdaI Hpy166II |DdeI | ||BdaI Hpy178III* BdaI | | ||BdaI | | |BseMII | | BspCNI | MnlI Hpy188I F H R K Q S T L K V L R E K A K E R N P S T G S S P L * K S S E K K Q K R E I Q P Q E A V H F E S P Q R K S K R E K S R ----:----|----:----|----:----|----:----|----:----|----:----| K W L F C D V K F T R L S F A F S L F G S G C S A T W K S L G * L F L L L S F D E V P L L G S Q F D E S F F C F L S I W FatI |CviAII || NlaIII || |TspDTI MboI || || BsmI BbvII* BclI || || CviRI* |Hin4I | DpnI || || EcoP15I |Hin4I | |BstKTI || || | EcoT22I || CviRI* | || AluI || || | | SfaNI || | MboII | || CviJI \\ \\ \ \ \ \\ \ \ \ \\ \ GATGAATACTACCATGCTATGCATTCAAGGAAGACAGATGCAAAAGGACTGCTGATCAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTATGATGGTACGATACGTAAGTTCCTTCTGTCTACGTTTTCCTGACGACTAGTCG / // / / / / / // // / / | || | | EcoP15I | Hin4I |BbvII* || | CviJI | || | CviRI* | Hin4I |MboII || | AluI | || EcoT22I SfaNI CviRI* || BclI | || BsmI || MboI | |FatI || SetI | TspDTI |DpnI | CviAII BstKTI NlaIII D E Y Y H A M H S R K T D A K G L L I S M N T T M L C I Q G R Q M Q K D C * S A * I L P C Y A F K E D R C K R T A D Q L ----:----|----:----|----:----|----:----|----:----|----:----| S S Y * W A I C E L F V S A F P S S I L L H I S G H * A N L S S L H L L V A S * I F V V M S H M * P L C I C F S Q Q D A HphI | TfiI | HinfI | |BbvII* | || MboII | || | MboII | || | | FatI SetI | || | | NcoI | MaeII | || | | StyI | |BtrI | || | | SecI* | |MaeIII | || | | DsaI* | |Tsp45I | || | | |CviAII | || SetI | || | | || MboI | || TaiI | || | | || NlaIII | || | Hin4I | || | | || | DpnI | || | Hin4I | || | | || | |BstKTI | || | MaeIII | || | | || | || MseI | || | Tsp45I | || | | || | || BinI* | || | Tsp4CI* | || | | || | || | TspEI \ \\ \ \ \ \\ \ \ \\ \ \\ \ \ TCACGTCACGGTGACGAAGAAGACGAATCGCTTTCCATGGATCAAGTTAAATTACTCAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGCAGTGCCACTGCTTCTTCTGCTTAGCGAAAGGTACCTAGTTCAATTTAATGAGTTT / // / / / // / / //// / // / | || | | HphI || | | |||| MboI || TspEI | || | Tsp45I || | | |||DpnI |MseI | || | MaeIII || | | ||BstKTI BinI* | || Tsp4CI* || | | |DsaI* | || Tsp45I || | | |SecI* | || MaeIII || | | |StyI | |Hin4I || | | |NcoI | |Hin4I || | | |FatI | |MaeII || | | CviAII | BtrI || | NlaIII TaiI || BbvII* SetI || MboII |HinfI |TfiI MboII S R H G D E E D E S L S M D Q V K L L K H V T V T K K T N R F P W I K L N Y S K T S R * R R R R I A F H G S S * I T Q N ----:----|----:----|----:----|----:----|----:----|----:----| E R * P S S S S S D S E M S * T L N S L S V D R H R L L R I A K W P D L * I V * * T V T V F F V F R K G H I L N F * E F MwoI | AluI | CviJI | | SetI DdeI | | | MwoI BseMII BbvCI | | | | AluI TspEI |BspCNI Bpu10I | | | | CviJI | MnlI || MnlI | HgaI | | | | | SetI \ \ \\ \ \ \ \ \ \ \ \ \ ACGCAAGATAGTAATTATGTGAGGACGCTGAGGCAAATAGAGCTGAAAAAGCTGGAGAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTTCTATCATTAATACACTCCTGCGACTCCGTTTATCTCGACTTTTTCGACCTCTTT / /// / / / / / / / / / | ||| MnlI | | | | | | | CviJI | ||BspCNI | | | | | | | AluI | |BseMII | | | | | | SetI | TspEI | | | | | MwoI MnlI | | | | CviJI | | | | AluI | | | SetI | | HgaI | MwoI Bpu10I BbvCI DdeI T Q D S N Y V R T L R Q I E L K K L E K R K I V I M * G R * G K * S * K S W R K A R * * L C E D A E A N R A E K A G E R ----:----|----:----|----:----|----:----|----:----|----:----| V C S L L * T L V S L C I S S F F S S F F A L Y Y N H S S A S A F L A S F A P S R L I T I I H P R Q P L Y L Q F L Q L F TaqI | TfiI | HinfI | Hpy99I | | AvaI CspCI TfiI | | Hpy178III* | Tsp4CI* BtsI | | |BdaI | | GsuI HinfI SspI | | |BdaI | | Eco57MI TspRI CspCI | | |BmeT110I \ \ \ \ \ \ \ \\ GGAGCGAAACAGTTGATGTTCAAAAGCAGTGGGAATCATACAATATTCGTCGATTCCCGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCGCTTTGTCAACTACAAGTTTTCGTCACCCTTAGTATGTTATAAGCAGCTAAGGGCT / // / / / / / / / / /// | |Eco57MI TspRI BtsI HinfI | | | | | ||AvaI | |GsuI TfiI | | | | | |BmeT110I | Tsp4CI* | | | | | Hpy178III* CspCI | | | | HinfI | | | | TfiI | | | | BdaI | | | | BdaI | | | TaqI | | Hpy99I | SspI CspCI G A K Q L M F K S S G N H T I F V D S R E R N S * C S K A V G I I Q Y S S I P E S E T V D V Q K Q W E S Y N I R R F P R ----:----|----:----|----:----|----:----|----:----|----:----| P A F C N I N L L L P F * V I N T S E R L L S V T S T * F C H S D Y L I R R N G S R F L Q H E F A T P I M C Y E D I G S HphI | ApoI BccI | XmnI |SetI | TspEI XmnI || XcmI | EcoRI BdaI || Hpy188I | | MboII TspDTI BdaI || | MnlI \ \ \ \ \ \\ \ \ GAGAAGATGAACGAATTCACCCCAGAGAAGTTTTTCAATACCACCTCCGAGATGGTGAAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCTACTTGCTTAAGTGGGGTCTCTTCAAAAAGTTATGGTGGAGGCTCTACCACTTA / // / / / / / // / HphI || | TspDTI | XmnI | || MnlI || EcoRI BdaI | |Hpy188I || TspEI BdaI | |XcmI || ApoI | BccI |MboII SetI XmnI E K M N E F T P E K F F N T T S E M V N R R * T N S P Q R S F S I P P P R W * I E D E R I H P R E V F Q Y H L R D G E * ----:----|----:----|----:----|----:----|----:----|----:----| S F I F S N V G S F N K L V V E S I T F L S S S R I * G L S T K * Y W R R S P S L L H V F E G W L L K E I G G G L H H I MboI BglII MseI XhoII | DdeI | DpnI | | AsuI* | |BstKTI | | AvaII | || HphI | | |BmgT120I | || Hpy188I | | || TspEI CviJI TspDTI \ \\ \ \ \ \\ \ \ \ AGATCTGAAAATAGATTAACTAAGGACCAATTAGCCCAAGATATTTCAAACAATAGGAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGACTTTTATCTAATTGATTCCTGGTTAATCGGGTTCTATAAAGTTTGTTATCCTTG // / / / // / / / || Hpy188I MseI | || | CviJI TspDTI || XhoII | || TspEI || BglII | |AvaII || HphI | |AsuI* || MboI | BmgT120I |DpnI DdeI BstKTI R S E N R L T K D Q L A Q D I S N N R N D L K I D * L R T N * P K I F Q T I G T I * K * I N * G P I S P R Y F K Q * E R ----:----|----:----|----:----|----:----|----:----|----:----| L D S F L N V L S W N A W S I E F L L F Y I Q F Y I L * P G I L G L Y K L C Y S S R F I S * S L V L * G L I N * V I P V TfiI BdaI FalI HinfI BdaI TspEI XmnI FalI \ \ \ \ \ GCTTCATCAATAATGCCAAAGGAATCATTAGACAAAAAGAAATTGAAAAAGTTCAAGCAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTAGTTATTACGGTTTCCTTAGTAATCTGTTTTTCTTTAACTTTTTCAAGTTCGTT / / / // / HinfI BdaI | |FalI MwoI TfiI BdaI | |FalI | XmnI TspEI A S S I M P K E S L D K K K L K K F K Q L H Q * C Q R N H * T K R N * K S S S K F I N N A K G I I R Q K E I E K V Q A S ----:----|----:----|----:----|----:----|----:----|----:----| A E D I I G F S D N S L F F N F F N L C R K M L L A L P I M L C F S I S F T * A S * * Y H W L F * * V F L F Q F L E L L MwoI | TseI | |BisI AsuI* | |BdaI AvaII | |BdaI |BmgT120I | ||BlsI FalI ||SetI | |||BplI FalI ||BplI | |||BplI |MfeI ||BplI | |||| MnlI BbvI |TspEI ||| SfaNI BseGI \ \\\\ \ \ \\ \\\ \ \ GTCAAGCAGCACTTACAGAGGGAAACTCAATTGAAACAGGTCCAACAAAGAATGGATGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCGTCGTGAATGTCTCCCTTTGAGTTAACTTTGTCCAGGTTGTTTCTTACCTACGA // //// / / // // / / || |||MnlI FalI | || |AvaII SfaNI BseGI || ||TseI BbvI | || |AsuI* || |BisI FalI | || BmgT120I || BlsI | |SetI |BdaI | BplI |BdaI | BplI BplI TspEI BplI MfeI V K Q H L Q R E T Q L K Q V Q Q R M D A S S S T Y R G K L N * N R S N K E W M L Q A A L T E G N S I E T G P T K N G C S ----:----|----:----|----:----|----:----|----:----|----:----| T L C C K C L S V * N F C T W C L I S A L * A A S V S P F E I S V P G V F F P H D L L V * L P F S L Q F L D L L S H I S NlaIV | MboII | | Eco57I | | Eco57MI | | | MlyI | | | PleI | | | |MboII | | | || AccI | | | || |Hpy166II | | | || || TspDTI | | | || || Hpy178III* MmeI | | | || || |Ksp632I* |FokI | | | || || || ApoI |TspEI | | | || || || TspEI || Hin4II* | | | || ||HinfI || |XmnI \\ \ \ \ \ \\ \\\ \\ \\ CAAAGAGAATTGTTGAAGAAGGGTTCCAAGAAAAAAATCGTAGACTCTTCAGGAAAAATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTCTTAACAACTTCTTCCCAAGGTTCTTTTTTTAGCATCTGAGAAGTCCTTTTTAA / / / / / // // / / / / / / MmeI Hin4II* | | | || || | | | | | TspEI TspEI | | | || || | | | | | ApoI FokI | | | || || | | | | XmnI | | | || || | | | Ksp632I* | | | || || | | Hpy178III* | | | || || | TspDTI | | | || || HinfI | | | || |AccI | | | || Hpy166II | | | |PleI | | | MboII | | | MlyI | | Eco57MI | | Eco57I | MboII NlaIV Q R E L L K K G S K K K I V D S S G K I K E N C * R R V P R K K S * T L Q E K F K R I V E E G F Q E K N R R L F R K N F ----:----|----:----|----:----|----:----|----:----|----:----| * L S N N F F P E L F F I T S E E P F I E F L I T S S P N W S F F R L S K L F F L S F Q Q L L T G L F F D Y V R * S F N MboII MseI | AclI |SwaI | MaeII |MslI | | SetI |AhaIII* | | TaiI \\ \ \ \ TCATTTAAATGGAAGAAACAACGGAAACGTTAG 730 740 750 ----:----|----:----|----:----|--- AGTAAATTTACCTTCTTTGTTGCCTTTGCAATC // / / / |MseI | | MaeII AhaIII* | | AclI MslI | TaiI SwaI | SetI MboII S F K W K K Q R K R * H L N G R N N G N V X I * M E E T T E T L X ----:----|----:----|----:----|--- E N L H F F C R F R * K M * I S S V V S V N * K F P L F L P F T L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AclI 2 Psp1406I AhaIII* 1 DraI AluI 4 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BdaI 6 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 2 BplI 2 Bpu10I 1 BseGI 1 BstF5I,BtsCI BseMII 3 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BstKTI 3 BtrI 1 BmgBI,AjiI BtsI 1 Csp6I 1 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 7 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 3 FokI 1 GsuI 1 BpmI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 2 Hin4II* 1 HpyAV HinfI 5 HphI 3 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 5 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PleI 1 PpsI PsrI 1 RsaI 1 AfaI SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 10 SfaNI 2 LweI SmlI 1 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 4 TaqI 1 TatI 1 TfiI 4 PfeI TseI 2 ApeKI Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspRI 1 TscAI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AciI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BcgI BciVI BetI* BfiI BglI BmtI BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoRV EgeI EheI Esp3I EspI* FaqI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HaeIII HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI HpaII HspAI KasI KpnI MauBI McrI* MluI MroNI MstI* MvaI NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I TaqII TauI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769