Restriction Map of ELM1/YKL048C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ELM1/YKL048C on chromosome XI from coordinates 349136 to 347214.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.31817

EMBOSS_001 MseI VspI |TspEI || BetI* || BspMII* || |HpaII || |Hpy178III* AluI || || HgiCI* CviJI || || | NlaIV MaeIII TaqI | SetI || || | |SduI BseYI Tsp45I SetI | MnlI || || | |BseSI | GsaI \ \ \ \ \\ \\ \ \\ \ \ ATGTCACCTCGACAGCTTATACCGACATTAATTCCGGAATGGGCACCATTATCCCAGCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTGGAGCTGTCGAATATGGCTGTAATTAAGGCCTTACCCGTGGTAATAGGGTCGTT / / / / // / / // / / / / / | | | | |MnlI | | || | | HgiCI* | BseYI | | | | CviJI | | || | NlaIV GsaI | | | | AluI | | || BseSI | | | SetI | | || SduI | | TaqI | | |BspMII* | Tsp45I | | |BetI* | MaeIII | | Hpy178III* SetI | | HpaII | TspEI VspI MseI M S P R Q L I P T L I P E W A P L S Q Q C H L D S L Y R H * F R N G H H Y P S N V T S T A Y T D I N S G M G T I I P A I ----:----|----:----|----:----|----:----|----:----|----:----| X D G R C S I G V N I G S H A G N D W C X T V E V A * V S M L E P I P V M I G A H * R S L K Y R C * N R F P C W * G L L MboII CviRI* CviJI |MnlI BslFI BseGI FokI TspDTI \\ \ \ \ \ TCGTGCATAAGAGAGGATGAGTTAGATAGTCCCCCGATAACGCCTACGAGCCAGACATCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGCACGTATTCTCTCCTACTCAATCTATCAGGGGGCTATTGCGGATGCTCGGTCTGTAGA / // / /// CviRI* |BseGI FokI ||CviJI MnlI BslFI |MboII TspDTI S C I R E D E L D S P P I T P T S Q T S R A * E R M S * I V P R * R L R A R H L V H K R G * V R * S P D N A Y E P D I F ----:----|----:----|----:----|----:----|----:----|----:----| D H M L S S S N S L G G I V G V L W V D I T C L L P H T L Y D G S L A * S G S M R A Y S L I L * I T G R Y R R R A L C R SfeI* |SetI || TatI || |Csp6I || ||RsaI MboII || ||| TspEI \ \\ \\\ \ TCATTTGGTTCTTCTTTTTCTCAACAGAAACCAACCTATAGTACAATTATAGGAGAAAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAACCAAGAAGAAAAAGAGTTGTCTTTGGTTGGATATCATGTTAATATCCTCTTTTA / / / /// / MboII SetI | ||| TspEI | ||TatI | |Csp6I | RsaI SfeI* S F G S S F S Q Q K P T Y S T I I G E N H L V L L F L N R N Q P I V Q L * E K I I W F F F F S T E T N L * Y N Y R R K Y ----:----|----:----|----:----|----:----|----:----|----:----| E N P E E K E * C F G V * L V I I P S F K M Q N K K K E V S V L R Y Y L * L L F * K T R R K R L L F W G I T C N Y S F I BinI* | MboI | | DpnI ApoI | | |PfoI TspEI | | |BssKI |BseGI | | |EcoRII || TaqI | | |BstKTI || | FokI Tsp4CI* | | || ScrFI || | | NdeI | MaeIII | | || BseBI || | | | TspDTI | Tsp45I \ \ \\ \ \\ \ \ \ \ \ \ ATACACACGATCCTGGATGAAATTCGACCATATGTGAAAAAAATAACTGTTAGTGACCAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTGTGCTAGGACCTACTTTAAGCTGGTATACACTTTTTTTATTGACAATCACTGGTT / // / / / / / / / / / / | || | | | | | | | FokI Tsp4CI* Tsp45I | || | | | | | | | NdeI MaeIII | || | | | | | | TspDTI | || | | | | | TaqI | || | | | | TspEI | || | | | | ApoI | || | | | BseGI | || | | EcoRII | || | | BssKI | || | | PfoI | || | BseBI | || | ScrFI | || MboI | |DpnI | BstKTI BinI* I H T I L D E I R P Y V K K I T V S D Q Y T R S W M K F D H M * K K * L L V T K T H D P G * N S T I C E K N N C * * P R ----:----|----:----|----:----|----:----|----:----|----:----| I C V I R S S I R G Y T F F I V T L S W Y V C S G P H F E V M H S F F L Q * H G Y V R D Q I F N S W I H F F Y S N T V L SfeI* |BsmAI ||PleI ||CviRI* TsoI MaeI |||MlyI | Hpy166II | HinfI ||||PstI | | TspEI \ \ \\\\\ \ \ \ GATAAGAAAACTATAAACCAATATACGCTAGGAGTCTCTGCAGGAAGTGGACAATTTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCTTTTGATATTTGGTTATATGCGATCCTCAGAGACGTCCTTCACCTGTTAAACCA / / / //// / / / MaeI | | |||| | | TspEI | | |||| | Hpy166II | | |||| TsoI | | |||BsmAI | | ||SfeI* | | |PleI | | |MlyI | | CviRI* | PstI HinfI D K K T I N Q Y T L G V S A G S G Q F G I R K L * T N I R * E S L Q E V D N L V * E N Y K P I Y A R S L C R K W T I W L ----:----|----:----|----:----|----:----|----:----|----:----| S L F V I F W Y V S P T E A P L P C N P L Y S F * L G I Y A L L R Q L F H V I Q I L F S Y V L I R * S D R C S T S L K T Csp6I Csp6I |RsaI |RsaI || Tsp4CI* SetI Hpy178III* \\ \\ \ \ \ TATGTACGAAAAGCGTACAGTTCTACTTTAGGCAAGGTTGTTGCTGTCAAGATTATACCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATACATGCTTTTCGCATGTCAAGATGAAATCCGTTCCAACAACGACAGTTCTAATATGGT // /// / / |Csp6I ||Tsp4CI* SetI Hpy178III* RsaI |Csp6I RsaI Y V R K A Y S S T L G K V V A V K I I P M Y E K R T V L L * A R L L L S R L Y Q C T K S V Q F Y F R Q G C C C Q D Y T K ----:----|----:----|----:----|----:----|----:----|----:----| * T R F A Y L E V K P L T T A T L I I G N H V F L T C N * K L C P Q Q Q * S * V I Y S F R V T R S * A L N N S D L N Y W MwoI XcmI BseYI | AluI | StyI |BsmI | CviJI | SecI* || GsaI | |Ksp632I* | | SetI || | SspI MnlI | ||SetI \ \ \ \\ \ \ \ \ \\\ AAAAAACCTTGGAATGCCCAGCAATATTCAGTAAATCAAGTAATGAGGCAAATCCAGCTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTGGAACCTTACGGGTCGTTATAAGTCATTTAGTTCATTACTCCGTTTAGGTCGAA // / // / / / / / / |SetI | || | SspI MnlI | | CviJI XcmI | || BseYI | | AluI | |GsaI | SetI | BsmI MwoI SecI* StyI K K P W N A Q Q Y S V N Q V M R Q I Q L K N L G M P S N I Q * I K * * G K S S F K T L E C P A I F S K S S N E A N P A L ----:----|----:----|----:----|----:----|----:----|----:----| F F G Q F A W C Y E T F * T I L C I W S L F V K S H G A I N L L D L L S A F G A F F R P I G L L I * Y I L Y H P L D L K BsmAI MboII MnlI |CviJI \ \ \\ TGGAAGAGTAAAGGAAAAATAACGACAAATATGAGTGGTAATGAGGCTATGAGACTTATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTCTCATTTCCTTTTTATTGCTGTTTATACTCACCATTACTCCGATACTCTGAATAC / / / / / Ksp632I* MboII MnlI | BsmAI CviJI W K S K G K I T T N M S G N E A M R L M G R V K E K * R Q I * V V M R L * D L * E E * R K N N D K Y E W * * G Y E T Y E ----:----|----:----|----:----|----:----|----:----|----:----| Q F L L P F I V V F I L P L S A I L S I K S S Y L F F L S L Y S H Y H P * S V * P L T F S F Y R C I H T T I L S H S K H AciI |BisI ||BlsI |||TauI |||CviJI TspDTI |||| Hpy178III* | SetI |||| | TaqI | | ApoI |||| | AsuII TaqI | | TspEI |||| | |TspDTI \ \ \ \ \\\\ \ \\ AATATCGAAAAATGTAGGTGGGAAATTTTTGCGGCTTCAAGACTTCGAAATAATGTTCAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAGCTTTTTACATCCACCCTTTAAAAACGCCGAAGTTCTGAAGCTTTATTACAAGTA / / / / //// / / / | | SetI | |||CviJI | | AsuII | TspDTI | ||BisI | | TaqI TaqI | ||AciI | TspDTI | |BlsI Hpy178III* | TauI TspEI ApoI N I E K C R W E I F A A S R L R N N V H I S K N V G G K F L R L Q D F E I M F I Y R K M * V G N F C G F K T S K * C S Y ----:----|----:----|----:----|----:----|----:----|----:----| F I S F H L H S I K A A E L S R F L T * S Y R F I Y T P F K Q P K L V E F Y H E I D F F T P P F N K R S * S K S I I N M MlyI Hpy178III* PleI | MaeIII | BsmI TfiI | Tsp45I | | HinfI HinfI | | TspEI \ \ \ \ \ \ \ ATTGTGCGACTAATAGAATGCTTGGACTCTCCTTTCAGCGAATCTATCTGGATAGTCACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACGCTGATTATCTTACGAACCTGAGAGGAAAGTCGCTTAGATAGACCTATCAGTGA // / / / / |BsmI HinfI HinfI | Tsp45I |PleI TfiI | MaeIII MlyI Hpy178III* I V R L I E C L D S P F S E S I W I V T L C D * * N A W T L L S A N L S G * S L C A T N R M L G L S F Q R I Y L D S H * ----:----|----:----|----:----|----:----|----:----|----:----| I T R S I S H K S E G K L S D I Q I T V Y Q A V L L I S P S E K * R I * R S L * N H S * Y F A Q V R R E A F R D P Y D S Hpy166II |BbvI || SfeI* || | Tsp4CI* || | |BsgI || | ||HphI TseI || | ||| TspRI CviRI* || | ||| | MaeII |BisI || | ||| | |MaeIII ||BlsI || | ||| | |Tsp45I |||CviJI || | ||| | || SetI AciI ||||StyI || | ||| | || TaiI MboII ||||SecI* || | ||| | || | BarI |TspDTI \\\\\ \\ \ \\\ \ \\ \ \ \\ AATTGGTGCAGCCTTGGTGAACTACAGTGGAAACGTGACGATGATGAAGATATTTTACCG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACCACGTCGGAACCACTTGATGTCACCTTTGCACTGCTACTACTTCTATAAAATGGC / //// / / / //// // / / / / | |||| | | | |||HphI || | Tsp45I | AciI | |||| | | | ||SfeI* || | MaeIII TspDTI | |||| | | | || || MaeII MboII | |||| | | | || |BarI | |||| | | | || TaiI | |||| | | | || SetI | |||| | | | |Tsp4CI* | |||| | | | |BsgI | |||| | | | BbvI | |||| | | TspRI | |||| | Hpy166II | |||| SecI* | |||| StyI | |||CviJI | |||TseI | ||BisI | |BlsI | CviRI* TspEI N W C S L G E L Q W K R D D D E D I L P I G A A L V N Y S G N V T M M K I F Y R L V Q P W * T T V E T * R * * R Y F T A ----:----|----:----|----:----|----:----|----:----|----:----| L Q H L R P S S C H F R S S S S S I K G * N T C G Q H V V T S V H R H H L Y K V I P A A K T F * L P F T V I I F I N * R MnlI XcmI | PfoI | BssKI | EcoRII BsrDI | | ScrFI | BarI | | BseBI | |TspEI TspEI | | |MmeI \ \\ \ \ \ \\ CAATGGAAAAAAATTGTGATTTCAAATTGTAGTGTTTCTACATTTGCCAAAAAAATCCTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTACCTTTTTTTAACACTAAAGTTTAACATCACAAAGATGTAAACGGTTTTTTTAGGAC / / / / / / BsrDI TspEI TspEI | | BseBI BarI | | ScrFI | MmeI XcmI MnlI Q W K K I V I S N C S V S T F A K K I L N G K K L * F Q I V V F L H L P K K S W M E K N C D F K L * C F Y I C Q K N P G ----:----|----:----|----:----|----:----|----:----|----:----| C H F F I T I E F Q L T E V N A L F I R A I S F F Q S K L N Y H K * M Q W F F G L P F F N H N * I T T N R C K G F F D Q BsmI BspCNI GsuI CviRI* |BseMII Eco57MI | DdeI || Hpy178III* | SspI | | TspDTI || | EcoRV \ \ \ \ \ \\ \ \ GAGGATATGACAAAAGGGTTGGAATATTTGCATTCTCAGGGTTGTATTCATCGTGATATC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTATACTGTTTTCCCAACCTTATAAACGTAAGAGTCCCAACATAAGTAGCACTATAG / / / / / / / // / / EcoRII Eco57MI | | | | DdeI |BseMII | EcoRV BssKI GsuI | | | TspDTI BspCNI Hpy178III* PfoI | | CviRI* | BsmI SspI E D M T K G L E Y L H S Q G C I H R D I R I * Q K G W N I C I L R V V F I V I S G Y D K R V G I F A F S G L Y S S * Y Q ----:----|----:----|----:----|----:----|----:----|----:----| S S I V F P N S Y K C E * P Q I * R S I P P Y S L L T P I N A N E P N Y E D H Y L I H C F P Q F I Q M R L T T N M T I D FokI Tsp4CI* | MboII | SspI | |TspDTI | | XcmI BseGI | || MboII Hpy188I \ \ \ \ \ \\ \ \ AAACCGTCCAATATTTTATTGGATGAAGAAGAAAAAGTAGCGAAACTTTCTGATTTTGGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGCAGGTTATAAAATAACCTACTTCTTCTTTTTCATCGCTTTGAAAGACTAAAACCT / / / / / // / Tsp4CI* | XcmI BseGI | |MboII Hpy188I SspI | FokI TspDTI MboII K P S N I L L D E E E K V A K L S D F G N R P I F Y W M K K K K * R N F L I L E T V Q Y F I G * R R K S S E T F * F W K ----:----|----:----|----:----|----:----|----:----|----:----| L G D L I K N S S S S F T A F S E S K P * V T W Y K I P H L L F L L S V K Q N Q F R G I N * Q I F F F F Y R F K R I K S SfaNI | SetI TspEI BtgZI MnlI \ \ \ \ \ AGTTGTATTTTCACTCCCCAATCATTACCTTTCAGCGATGCTAATTTTGAAGATTGTTTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCAACATAAAAGTGAGGGGTTAGTAATGGAAAGTCGCTACGATTAAAACTTCTAACAAAA / / / // / SetI SfaNI TspEI |MnlI MboII BtgZI S C I F T P Q S L P F S D A N F E D C F V V F S L P N H Y L S A M L I L K I V F L Y F H S P I I T F Q R C * F * R L F S ----:----|----:----|----:----|----:----|----:----|----:----| L Q I K V G W D N G K L S A L K S S Q K F N Y K * E G I M V K * R H * N Q L N N T T N E S G L * * R E A I S I K F I T K MboII Csp6I MwoI AluI |Hpy188I |RsaI BstAPI CviJI || TspEI TspEI || HpaII | CviRI* | SetI \\ \ \ \\ \ \ \ \ \ CAGAGGGAATTGAACAAAATTGTTGGTACTCCGGCATTTATTGCACCAGAGCTATGTCAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTCCCTTAACTTGTTTTAACAACCATGAGGCCGTAAATAACGTGGTCTCGATACAGTA / / / // / / / / / Hpy188I TspEI TspEI || | | | | CviJI || | | | | AluI || | | | SetI || | | CviRI* || | BstAPI || | MwoI || HpaII |Csp6I RsaI Q R E L N K I V G T P A F I A P E L C H R G N * T K L L V L R H L L H Q S Y V I E G I E Q N C W Y S G I Y C T R A M S F ----:----|----:----|----:----|----:----|----:----|----:----| * L S N F L I T P V G A N I A G S S H * E S P I S C F Q Q Y E P M * Q V L A I D L P F Q V F N N T S R C K N C W L * T M CviJI MmeI |BseGI |MaeIII ||Hin4I |Tsp45I ||Hin4I FokI TspEI ||BccI |||MseI TspGWI \ \\\ \\\\ \ TTGGGCAATTCCAAAAGAGATTTTGTGACGGATGGCTTTAAGTTGGATATTTGGTCATTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCGTTAAGGTTTTCTCTAAAACACTGCCTACCGAAATTCAACCTATAAACCAGTAAC / / / / / // // / TspEI MmeI | | | || || FokI | | | || |TspGWI | | | || MseI | | | |CviJI | | | BseGI | | Hin4I | | Hin4I | Tsp45I | MaeIII BccI L G N S K R D F V T D G F K L D I W S L W A I P K E I L * R M A L S W I F G H W G Q F Q K R F C D G W L * V G Y L V I G ----:----|----:----|----:----|----:----|----:----|----:----| K P L E L L S K T V S P K L N S I Q D N N P C N W F L N Q S P H S * T P Y K T M Q A I G F S I K H R I A K L Q I N P * Q BbvI TseI | TatI AluI ApoI MaeIII | Tsp4CI* CviJI TspEI Tsp45I | Bsp1407I |BisI EcoRI | Hin4I | |Csp6I ||BlsI | TaqI | Hin4I | ||RsaI ||SetI BsiYI* | AsuII \ \ \ \\\ \\\ \ \ \ GGAGTGACACTATACTGCTTACTGTACAACGAGCTGCCATTTTTCGGGGAAAATGAATTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCACTGTGATATGACGAATGACATGTTGCTCGACGGTAAAAAGCCCCTTTTACTTAAG / / / //// / //// / / | Tsp45I | |||| | |||| BsiYI* EcoRI | MaeIII | |||| | |||TseI TspEI Hin4I | |||| | ||BisI ApoI Hin4I | |||| | |BlsI | |||| | CviJI | |||| | AluI | |||| SetI | |||Bsp1407I | |||TatI | ||Csp6I | |RsaI | BbvI Tsp4CI* G V T L Y C L L Y N E L P F F G E N E F E * H Y T A Y C T T S C H F S G K M N S S D T I L L T V Q R A A I F R G K * I R ----:----|----:----|----:----|----:----|----:----|----:----| P T V S Y Q K S Y L S S G N K P S F S N P L S V I S S V T C R A A M K R P F H I S H C * V A * Q V V L Q W K E P F I F E SetI MseI |TspDTI TaqI |AhaIII* \\ \ \\ GAAACCTACCACAAAATCATCGAAGTATCATTGAGTTCCAAAATAAATGGTAATACTTTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGATGGTGTTTTAGTAGCTTCATAGTAACTCAAGGTTTTATTTACCATTATGAAAT / / / / // | | TspDTI TaqI |MseI | SetI AhaIII* AsuII TaqI E T Y H K I I E V S L S S K I N G N T L K P T T K S S K Y H * V P K * M V I L * N L P Q N H R S I I E F Q N K W * Y F K ----:----|----:----|----:----|----:----|----:----|----:----| S V * W L I M S T D N L E L I F P L V K R F R G C F * R L I M S N W F L H Y Y K F G V V F D D F Y * Q T G F Y I T I S * MaeII |MaeIII || SetI MseI SetI || TaiI Hpy178III* \ \ \\ \ \ AACGATTTAGTCATTAAAAGGTTATTGGAGAAAGACGTTACTTTACGCATAAGTATTCAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTAAATCAGTAATTTTCCAATAACCTCTTTCTGCAATGAAATGCGTATTCATAAGTC / / / / / / | SetI | | MaeIII Hpy178III* MseI | MaeII TaiI SetI N D L V I K R L L E K D V T L R I S I Q T I * S L K G Y W R K T L L Y A * V F R R F S H * K V I G E R R Y F T H K Y S G ----:----|----:----|----:----|----:----|----:----|----:----| F S K T M L L N N S F S T V K R M L I * L R N L * * F T I P S L R * K V C L Y E V I * D N F P * Q L F V N S * A Y T N L TfiI HinfI | MaeI | | TfiI FnuDII* | | HinfI |MaeIII | | | TspDTI |Tsp45I | | | | Tsp4CI* || MwoI | | | | | ApoI SetI || | CviJI | | | | | TspEI \ \\ \ \ \ \ \ \ \ \ GATTTAGTAAAGGTTTTGTCGCGTGACCAGCCCATAGATTCTAGGAATCACAGTCAAATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATCATTTCCAAAACAGCGCACTGGTCGGGTATCTAAGATCCTTAGTGTCAGTTTAA / / / / / / / / / / SetI | | | CviJI | MaeI | Tsp4CI* TspEI | | Tsp45I HinfI TspDTI ApoI | | MaeIII TfiI HinfI | MwoI TfiI FnuDII* D L V K V L S R D Q P I D S R N H S Q I I * * R F C R V T S P * I L G I T V K F F S K G F V A * P A H R F * E S Q S N F ----:----|----:----|----:----|----:----|----:----|----:----| S K T F T K D R S W G M S E L F * L * I P N L L P K T A H G A W L N * S D C D F I * Y L N Q R T V L G Y I R P I V T L N AsuI* AvaII DraII PpuMI TspRI |BmgT120I MboII BsrI Hpy166II Hin4II* ||SetI | CviJI \ \ \ \\\ \ \ TCATCGTCCAGTGTGAACCCCGTAAGAAACGAAGGTCCTGTAAGAAGATTTTTTGGTAGG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCAGGTCACACTTGGGGCATTCTTTGCTTCCAGGACATTCTTCTAAAAAACCATCC / / / / // / / TspRI Hpy166II Hin4II* | |PpuMI | CviJI BsrI | |DraII MboII | |AvaII | |AsuI* | BmgT120I SetI S S S S V N P V R N E G P V R R F F G R H R P V * T P * E T K V L * E D F L V G I V Q C E P R K K R R S C K K I F W * A ----:----|----:----|----:----|----:----|----:----|----:----| E D D L T F G T L F S P G T L L N K P L K M T W H S G R L F R L D Q L F I K Q Y * R G T H V G Y S V F T R Y S S K K T P DdeI SauI* |SetI ||Hpy178III* ||| MnlI ||| | BspCNI ||| | |BseMII SetI \\\ \ \\ \ CTACTGACTAAAAAAGGAAAGAAAAAGACCTCAGGAAAAGGGAAAGACAAGGTATTGGTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GATGACTGATTTTTTCCTTTCTTTTTCTGGAGTCCTTTTCCCTTTCTGTTCCATAACCAT / // / // / SetI || | |BseMII SetI || | BspCNI || MnlI |Hpy178III* SauI* DdeI L L T K K G K K K T S G K G K D K V L V Y * L K K E R K R P Q E K G K T R Y W Y T D * K R K E K D L R K R E R Q G I G I ----:----|----:----|----:----|----:----|----:----|----:----| S S V L F P F F F V E P F P F S L T N T A V S * F L F S F S R L F L S L C P I P * Q S F F S L F L G * S F P F V L Y Q Y BsaBI Hpy99I CviRI* |Hin4II* | NlaIV | SpeI SetI ||MnlI | |BetI* | |MaeI MaeIII |TaqI ||| TaqI | ||HpaII \ \\ \ \\ \\\ \ \ \\\ TCTGCAACTAGTAAAGTAACACCTTCGATACATATCGACGAGGAACCGGATAAAGAATGT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGTTGATCATTTCATTGTGGAAGCTATGTATAGCTGCTCCTTGGCCTATTTCTTACA / // / / // / / / // | |SpeI MaeIII | || | TaqI | |BetI* | MaeI SetI | || Hpy99I | HpaII CviRI* | |MnlI NlaIV | Hin4II* | BsaBI TaqI S A T S K V T P S I H I D E E P D K E C L Q L V K * H L R Y I S T R N R I K N V C N * * S N T F D T Y R R G T G * R M F ----:----|----:----|----:----|----:----|----:----|----:----| D A V L L T V G E I C I S S S G S L S H I Q L * Y L L V K S V Y R R P V P Y L I R C S T F Y C R R Y M D V L F R I F F T PshAI | AsuI* | AvaII | Tsp4CI* | |BmgT120I | ||MboII | ||| DdeI HinfI | ||| | MboI | AvaI | ||| | BglII | XhoI | ||| | XhoII | SmlI | ||| | | DpnI | PspXI | ||| | | |BstKTI | |TaqI | ||| | | || MlyI | |BmeT110I TaqI | ||| | | || PleI | || TspDTI MnlI \ \ \\\ \ \ \\ \ \ \\ \ \ TTTTCGACTACGGTCCTTAGATCTTCGCCAGACTCGAGCGATTATTGTTCATCGTTAGGG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCTGATGCCAGGAATCTAGAAGCGGTCTGAGCTCGCTAATAACAAGTAGCAATCCC / // /// /// / // / // / | || ||| ||| | |PleI | |PspXI MnlI | || ||| ||| | MlyI | |SmlI | || ||| ||| XhoII | |XhoI | || ||| ||| BglII | |AvaI | || ||| ||| MboI | BmeT110I | || ||| ||DpnI | TspDTI | || ||| |BstKTI | TaqI | || ||| DdeI HinfI | || ||AvaII | || ||AsuI* | || |BmgT120I | || MboII | |Tsp4CI* | PshAI TaqI F S T T V L R S S P D S S D Y C S S L G F R L R S L D L R Q T R A I I V H R * G F D Y G P * I F A R L E R L L F I V R G ----:----|----:----|----:----|----:----|----:----|----:----| K E V V T R L D E G S E L S * Q E D N P N K S * P G * I K A L S S R N N N M T L K R S R D K S R R W V R A I I T * R * P HindIII | AluI CviJI MaeIII | CviJI |XmnI | SetI DdeI TspGWI SetI | | SetI \\ \ \ \ \ \ \ \ \ GAGGAAGCCATTCAGGTTACGGATTTCTTAGATACTTTTTGTAGGTCAAATGAAAGCTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTCGGTAAGTCCAATGCCTAAAGAATCTATGAAAAACATCCAGTTTACTTTCGAAT // / / / / / / / // |XmnI SetI MaeIII | TspGWI SetI | | |SetI CviJI DdeI | | HindIII | CviJI | AluI SetI E E A I Q V T D F L D T F C R S N E S L R K P F R L R I S * I L F V G Q M K A Y G S H S G Y G F L R Y F L * V K * K L T ----:----|----:----|----:----|----:----|----:----|----:----| S S A M * T V S K K S V K Q L D F S L K P P L W E P * P N R L Y K K Y T L H F S L F G N L N R I E * I S K T P * I F A * Hpy188I | FatI | |CviAII | || NlaIII SetI ApoI | || | FokI TspEI TspEI | || | |BplI TspDTI | TspDTI Tsp4CI* EcoRI | || | |BplI | HinfI \ \ \ \ \ \\ \ \\ \ \ CCTAATTTGACTGTGAATAATGATAAGCAGAATTCGGACATGAAAACTGACAGAAGCGAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTAAACTGACACTTATTACTATTCGTCTTAAGCCTGTACTTTTGACTGTCTTCGCTC / / / // / // / // / | | Tsp4CI* || | || BplI || BseGI | TspEI || | || BplI |TspDTI TspDTI || | |FatI FokI || | CviAII || NlaIII |Hpy188I EcoRI TspEI ApoI P N L T V N N D K Q N S D M K T D R S E L I * L * I M I S R I R T * K L T E A S * F D C E * * * A E F G H E N * Q K R V ----:----|----:----|----:----|----:----|----:----|----:----| G L K V T F L S L C F E S M F V S L L S V * N S Q S Y H Y A S N P C S F Q C F R R I Q S H I I I L L I R V H F S V S A L CviJI BseGI |FatI | PleI BplI ||CviAII | |MlyI MnlI BplI SetI ||| NlaIII \ \\ \ \ \ \\\ \ TCATCCTCTCATTCGTCATTGAAAATCCCAACACCTATCAAAGCCATGATAAGACTAAAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGGAGAGTAAGCAGTAACTTTTAGGGTTGTGGATAGTTTCGGTACTATTCTGATTTC / / / / / // // HinfI PleI | BplI SetI || |FatI MlyI | BplI || CviAII MnlI |NlaIII CviJI S S S H S S L K I P T P I K A M I R L K H P L I R H * K S Q H L S K P * * D * R I L S F V I E N P N T Y Q S H D K T K E ----:----|----:----|----:----|----:----|----:----|----:----| D D E * E D N F I G V G I L A M I L S F T M R E N T M S F G L V * * L W S L V L * G R M R * Q F D W C R D F G H Y S * L MseI VspI |TspEI \\ AGTTCCCCTAAAGAGAACGGGAACAGAACCCATATTAATTGCTCACAGGACAAACCGAGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGGGGATTTCTCTTGCCCTTGTCTTGGGTATAATTAACGAGTGTCCTGTTTGGCTCA / / | TspEI VspI MseI S S P K E N G N R T H I N C S Q D K P S V P L K R T G T E P I L I A H R T N R V F P * R E R E Q N P Y * L L T G Q T E F ----:----|----:----|----:----|----:----|----:----|----:----| L E G L S F P F L V W I L Q E C S L G L S N G * L S R S C F G Y * N S V P C V S T G R F L V P V S G M N I A * L V F R T Hin6I |GlaI ||HhaI ||| Tsp4CI* ||| | MseI ||| | |HpaI ||| | |HindII HindIII ||| | |Hpy166II CviJI | AluI MmeI BsiYI* Tsp4CI* ||| | || TspEI |MaeI | CviJI \ \ \ \\\ \ \\ \ \\ \ \ TCCCCACTAATGGATAGGACTGTTGGAAAGCGCACGGTTAACAATTCAGGGGCTAGAAAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGGTGATTACCTATCCTGACAACCTTTCGCGTGCCAATTGTTAAGTCCCCGATCTTTC / / / /// / // / / / / / MmeI BsiYI* Tsp4CI* ||| | |MseI TspEI | | | CviJI ||| | Hpy166II | | | AluI ||| | HindII | | SetI ||| | HpaI | MaeI ||| Tsp4CI* CviJI ||Hin6I |GlaI HhaI S P L M D R T V G K R T V N N S G A R K P H * W I G L L E S A R L T I Q G L E S P T N G * D C W K A H G * Q F R G * K A ----:----|----:----|----:----|----:----|----:----|----:----| E G S I S L V T P F R V T L L E P A L F N G V L P Y S Q Q F A C P * C N L P * F G W * H I P S N S L A R N V I * P S S L Hpy188I SetI MseI ApoI | MaeIII Cac8I SspI |AhaIII* TspEI | Tsp45I \ \ \\ \ \ \ CTTGCTCATTCAAGTAATATTCTCAACTTTAAAGCATACATAAATTCGGAAGATAGTGAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGAGTAAGTTCATTATAAGAGTTGAAATTTCGTATGTATTTAAGCCTTCTATCACTG / / // // / HindIII SspI |MseI |Hpy188I Tsp45I Cac8I AhaIII* TspEI MaeIII ApoI MboII L A H S S N I L N F K A Y I N S E D S D L L I Q V I F S T L K H T * I R K I V T C S F K * Y S Q L * S I H K F G R * * H ----:----|----:----|----:----|----:----|----:----|----:----| S A * E L L I R L K L A Y M F E S S L S A Q E N L Y Y E * S * L M C L N P L Y H K S M * T I N E V K F C V Y I R F I T V MaeII MboII MboII | TaqI | SetI | |Hpy178III* | TaiI | || Tsp4CI* | | Hpy188I CviRI* \ \\ \ \ \ \ \ ATTCGAGAAACAGTAGAAGATGTAAAAACGTATCTGAACTTTGCAGATAATGGTCAAATA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGCTCTTTGTCATCTTCTACATTTTTGCATAGACTTGAAACGTCTATTACCAGTTTAT // / / / / / || Tsp4CI* | | Hpy188I CviRI* |Hpy178III* | MaeII TaqI MboII TaiI SetI I R E T V E D V K T Y L N F A D N G Q I F E K Q * K M * K R I * T L Q I M V K Y S R N S R R C K N V S E L C R * W S N I ----:----|----:----|----:----|----:----|----:----|----:----| M R S V T S S T F V Y R F K A S L P * I C E L F L L L H L F T D S S Q L Y H D F N S F C Y F I Y F R I Q V K C I I T L Y TAG --- ATC * X X --- Y I L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AhaIII* 2 DraI AluI 6 AluBI ApoI 6 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 BetI* 2 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 2 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BseYI 2 BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 2 BtgZI 1 Cac8I 1 BstC8I Csp6I 5 CviQI,RsaNI CviAII 2 CviJI 16 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I Eco57MI 1 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 1 GsaI 2 GsuI 1 BpmI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 7 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 11 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MlyI 4 SchI MmeI 3 MnlI 10 MseI 7 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PfoI 2 PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PspXI 1 PstI 1 RsaI 5 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 26 SfaNI 1 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 4 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 11 TatI 2 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 8 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 19 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 2 TscAI VspI 2 PshBI,AseI XcmI 3 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BfiI BglI BmtI Bpu10I BsaAI BsaXI BsePI BseRI BsiI* Bsp120I BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FalI FauI FseI FspAI HaeII HaeIII HgaI HgiAI* HgiJII* KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PsiI PspOMI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TspMI TstI Tth111I XbaI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769