Restriction Map of TCD2/YKL027W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TCD2/YKL027W on chromosome XI from coordinates 387562 to 388905.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2502

FatI Tsp4CI* |CviAII | TspRI Hin4II* || NlaIII CviRI* | | MaeIII | BciVI || | BsgI BtsI | TspRI | | Tsp45I \ \ \\ \ \ \ \ \ \ \ \ ATGGTAGAGAAGGATACATGGAAACTGATAACTGCCACTGCACTATTCACTGTGGCAGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATCTCTTCCTATGTACCTTTGACTATTGACGGTGACGTGATAAGTGACACCGTCAC / / / /// / / / / / / | BciVI | ||BsgI TspRI | | | TspRI BtsI Hin4II* | |FatI BtsI | | Tsp4CI* | CviAII | TspRI NlaIII CviRI* M V E K D T W K L I T A T A L F T V A V W * R R I H G N * * L P L H Y S L W Q * G R E G Y M E T D N C H C T I H C G S D ----:----|----:----|----:----|----:----|----:----|----:----| X T S F S V H F S I V A V A S N V T A T X P L S P Y M S V S L Q W Q V I * Q P L H Y L L I C P F Q Y S G S C * E S H C H TspEI AsuI* | Hin6I BtsI AvaII AlfI | |GlaI TspRI |BmgT120I AlfI | |MstI* | Hpy99I || BsrI |Cac8I | ||HhaI \ \ \\ \ \\ \ \\\ ACGACGATTACAGATTATGCTTGGACCAGTTGGCAAGCACAAAAGCAAGTAATTGCGCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTGCTAATGTCTAATACGAACCTGGTCAACCGTTCGTGTTTTCGTTCATTAACGCGTT // /// / / //// |Tsp45I ||AvaII | Cac8I |||Hin6I |MaeIII ||AsuI* AlfI ||MstI* Hpy99I || AlfI ||GlaI |BmgT120I |HhaI BsrI TspEI T T I T D Y A W T S W Q A Q K Q V I A Q R R L Q I M L G P V G K H K S K * L R N D D Y R L C L D Q L A S T K A S N C A T ----:----|----:----|----:----|----:----|----:----|----:----| V V I V S * A Q V L Q C A C F C T I A C S S S * L N H K S W N A L V F A L L Q A R R N C I I S P G T P L C L L L Y N R L AlfI TspGWI AlfI SetI Hpy188I BsaBI |MslI \ \ \ \ \\ CAAAAAAATAAGAATAAAGGTGGGCAAACAAAATCTGACACGGATAAATATCATCAATAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTTTTATTCTTATTTCCACCCGTTTGTTTTAGACTGTGCCTATTTATAGTAGTTATA / / / / / / AlfI SetI Hpy188I BsaBI | MslI AlfI TspGWI Q K N K N K G G Q T K S D T D K Y H Q Y K K I R I K V G K Q N L T R I N I I N M K K * E * R W A N K I * H G * I S S I * ----:----|----:----|----:----|----:----|----:----|----:----| C F F L F L P P C V F D S V S L Y * * Y V F F Y S Y L H A F L I Q C P Y I D D I L F I L I F T P L C F R V R I F I M L I ApoI TspEI MfeI Tsp4CI* TspDTI | MnlI TspEI \ \ \ \ \ GATGAACAGTTTATTCGCCAATCTTTGAAAAACAATGTTGAATTTCTTGGTGAGGACACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTGTCAAATAAGCGGTTAGAAACTTTTTGTTACAACTTAAAGAACCACTCCTGTGT / / / / Tsp4CI* TspDTI TspEI HphI ApoI MnlI D E Q F I R Q S L K N N V E F L G E D T M N S L F A N L * K T M L N F L V R T Q * T V Y S P I F E K Q C * I S W * G H N ----:----|----:----|----:----|----:----|----:----|----:----| S S C N I R W D K F F L T S N R P S S V H H V T * E G I K S F C H Q I E Q H P C I F L K N A L R Q F V I N F K K T L V C TstI |SetI || TaqII || | TsoI || | MboI || | XhoII MmeI || | | DpnI |AarI || | | |BstKTI HphI |BspMI || | | || BinI* \ \\ \\ \ \ \\ \ ATTGAAAAACTATCCAATCAATATGTTGTTGTCGTGGGAGCAGGTGGAGTTGGATCTTGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTTTGATAGGTTAGTTATACAACAACAGCACCCTCGTCCACCTCAACCTAGAACC / / / / / / / // / TspEI MmeI | | SetI | | || XhoII MfeI | TstI | | || MboI BspMI | | |DpnI AarI | | BstKTI | TsoI TaqII I E K L S N Q Y V V V V G A G G V G S W L K N Y P I N M L L S W E Q V E L D L G * K T I Q S I C C C R G S R W S W I L G ----:----|----:----|----:----|----:----|----:----|----:----| I S F S D L * Y T T T T P A P P T P D Q L Q F V I W D I H Q Q R P L L H L Q I K N F F * G I L I N N D H S C T S N S R P TstI SfaNI | AciI | | AsuI* | | AvaII | | RsrII | | |BmgT120I | | ||BetI* | | ||BspMII* | | |||HpaII | | |||Hpy178III* BssKI | | |||| BseGI SexAI MseI | | |||| | MboI EcoRII |HpaI | | |||| | | DpnI | ScrFI |HindII | | |||| | | |FokI | BseBI |Hpy166II | | |||| | | |BstKTI Hin4I | Tth111I \\ \ \ \\\\ \ \ \\ \ \ \ GTGGTTAACTCTTTGGTGCGGTCCGGATGCCGAAAGATCAGGGTCGTTGATTTTGACCAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACCAATTGAGAAACCACGCCAGGCCTACGGCTTTCTAGTCCCAGCAACTAAAACTGGTC / // / / // // / // / // // | || TstI | || || BseGI || | |FokI |Tth111I | |MseI | || |BspMII* || | Hin4I |BseBI | Hpy166II | || |BetI* || MboI |ScrFI | HindII | || Hpy178III* |DpnI SetI | HpaI | || HpaII BstKTI BinI* | |RsrII | |AvaII | |AsuI* | BmgT120I SfaNI AciI V V N S L V R S G C R K I R V V D F D Q W L T L W C G P D A E R S G S L I L T R G * L F G A V R M P K D Q G R * F * P G ----:----|----:----|----:----|----:----|----:----|----:----| T T L E K T R D P H R F I L T T S K S W P P * S K P A T R I G F S * P R Q N Q G H N V R Q H P G S A S L D P D N I K V L AluI OliI MslI SetI CviJI | BsmAI PvuII | Eco31I Hpy166II NspBII* | |DdeI | Hin4I | SetI Cac8I \ \\ \ \ \ \ \ GTCTCACTAAGTTCACTAAATAGACACAGCTGTGCCATACTAAATGATGTTGGCACGCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGTGATTCAAGTGATTTATCTGTGTCGACACGGTATGATTTACTACAACCGTGCGGT / / / / / / EcoRII | Hpy166II | NspBII* Cac8I SexAI | Hin4I | PvuII BssKI Eco31I | CviJI BsmAI | MslI DdeI | OliI | AluI SetI V S L S S L N R H S C A I L N D V G T P S H * V H * I D T A V P Y * M M L A R Q L T K F T K * T Q L C H T K * C W H A K ----:----|----:----|----:----|----:----|----:----|----:----| T E S L E S F L C L Q A M S F S T P V G P R V L N V L Y V C S H W V L H H Q C A D * * T * * I S V A T G Y * I I N A R W TspEI | CviRI* | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII | | ||OliI | | ||MslI Hin4II* | | ||| NlaIII |AccI | | ||| | BinI* ||Hpy166II | | ||| | | MboI ||| FauI | | ||| | | | DpnI ||| | NdeI | | ||| | | | |BstKTI ||| | | AciI | | ||| | | | || Hpy188I \\\ \ \ \ \ \ \\\ \ \ \ \\ \ AAAGTGGAATGTCTACGAAGGCATATGCGGGAAATTGCACCATGGTGTGAGATTGATCCG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCACCTTACAGATGCTTCCGTATACGCCCTTTAACGTGGTACCACACTCTAACTAGGC / // / / / // / /// / // / | |AccI | | AciI || | ||DsaI* | || Hpy188I | Hpy166II | NdeI || | ||SecI* | || MboI Hin4II* FauI || | ||StyI | |DpnI || | ||NcoI | BstKTI || | ||FatI BinI* || | |CviAII || | MslI || | OliI || NlaIII |CviRI* TspEI K V E C L R R H M R E I A P W C E I D P K W N V Y E G I C G K L H H G V R L I R S G M S T K A Y A G N C T M V * D * S D ----:----|----:----|----:----|----:----|----:----|----:----| F T S H R R L C I R S I A G H H S I S G L L P I D V F A Y A P F Q V M T H S Q D F H F T * S P M H P F N C W P T L N I R MaeII |MaeIII || SetI MseI || TaiI StyI VspI TspEI || |TspDTI SecI* Hpy178III* \ \ \\ \\ \ \ ATTAATGAATTATGGACGTTACAAAATGGCGAAAGACTGACCCTTGGTAATGGAACTCCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTACTTAATACCTGCAATGTTTTACCGCTTTCTGACTGGGAACCATTACCTTGAGGA / / / / / / / VspI | | | MaeIII SecI* Hpy178III* MseI | | TspDTI StyI | | MaeII | TaiI | SetI TspEI I N E L W T L Q N G E R L T L G N G T P L M N Y G R Y K M A K D * P L V M E L L * * I M D V T K W R K T D P W * W N S * ----:----|----:----|----:----|----:----|----:----|----:----| I L S N H V N C F P S L S V R P L P V G S * H I I S T V F H R F V S G Q Y H F E N I F * P R * L I A F S Q G K T I S S R SalI Hpy166II |TaqI | CviRI* |AccI | | BaeI |SetI | | | SspI ||HindII BaeI | | | |FalI ||Hpy166II | FalI | | | |FalI ||| SmlI | FalI \ \ \ \\ \\\ \ \ \ GACTTTATCGTGGACTGCATTGATAATATTGATACAAAGGTCGACTTACTTGAGTTTGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAATAGCACCTGACGTAACTATTATAACTATGTTTCCAGCTGAATGAACTCAAACGG / // / / / /// / / / | |BaeI | SspI SetI ||SalI | | FalI | | FalI |AccI | | FalI | | FalI |TaqI | SmlI | CviRI* Hpy166II BaeI Hpy166II HindII D F I V D C I D N I D T K V D L L E F A T L S W T A L I I L I Q R S T Y L S L P L Y R G L H * * Y * Y K G R L T * V C L ----:----|----:----|----:----|----:----|----:----|----:----| S K I T S Q M S L I S V F T S K S S N A Q S * R P S C Q Y Y Q Y L P R S V Q T Q V K D H V A N I I N I C L D V * K L K G FatI |CviAII || NlaIII || Bce83I* || | MboII || | | MboI || | | | DpnI || | | | TaqII || | | | |BstKTI || | | | || FatI || | | | || NcoI || | | | || StyI AciI || | | | || SecI* | FnuDII* || | | | || DsaI* | | BinI* || | | | || |CviAII | | | MboI || | | | || |Ksp632I* | | | | DpnI || | | | || || NlaIII | | | | |BstKTI \\ \ \ \ \\ \\ \ \ \ \ \ \\ TATAATCATGGTATCAAAGTGATCTCTTCCATGGGTGCTTCCGCGAAAAGTGATCCTACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTAGTACCATAGTTTCACTAGAGAAGGTACCCACGAAGGCGCTTTTCACTAGGATGT / /// / /// / / // / / // / | ||FatI | ||| MboI | |Ksp632I* | | || MboI | |CviAII | ||DpnI | |DsaI* | | |DpnI | Bce83I* | |BstKTI | |SecI* | | BstKTI NlaIII | TaqII | |StyI | BinI* MboII | |NcoI FnuDII* | |FatI AciI | CviAII NlaIII Y N H G I K V I S S M G A S A K S D P T I I M V S K * S L P W V L P R K V I L Q * S W Y Q S D L F H G C F R E K * S Y K ----:----|----:----|----:----|----:----|----:----|----:----| * L * P I L T I E E M P A E A F L S G V R Y D H Y * L S R K W P H K R S F H D * I I M T D F H D R G H T S G R F T I R C CviJI | MnlI | | SecI* | | DsaI* | | |MnlI | | ||BslFI | | ||| BinI* | | ||| | MboI | | ||| | BamHI | | ||| | XhoII | | ||| | | DpnI | | ||| | | NlaIV | | ||| | | |BstKTI | | ||| | | || TspGWI | | ||| | | || |BinI* | | ||| | | || || BseRI | | ||| | | || || CviRI* | | ||| | | || || | MnlI MseI TsoI | | ||| | | || || | | Hin4II* \ \ \ \ \\\ \ \ \\ \\ \ \ \ AAACTTAATGTGGGGGACTTGGCTACCACGGAGGAGGATCCTCTTGCAAGGGTAGTGAGA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAATTACACCCCCTGAACCGATGGTGCCTCCTCCTAGGAGAACGTTCCCATCACTCT // // / / / // // /// / / |TsoI || | | | || || ||| | Hin4II* MseI || | | | || || ||| MnlI || | | | || || ||CviRI* || | | | || || |BinI* || | | | || || BseRI || | | | || |TspGWI || | | | || XhoII || | | | || BamHI || | | | || MboI || | | | |NlaIV || | | | |DpnI || | | | BstKTI || | | BslFI || | | BinI* || | DsaI* || | SecI* || MnlI |MnlI CviJI K L N V G D L A T T E E D P L A R V V R N L M W G T W L P R R R I L L Q G * * E T * C G G L G Y H G G G S S C K G S E K ----:----|----:----|----:----|----:----|----:----|----:----| F S L T P S K A V V S S S G R A L T T L L V * H P P S P * W P P P D E Q L P L S F K I H P V Q S G R L L I R K C P Y H S BetI* BspMII* |HpaII |Hpy178III* TspEI || ApoI | MseI || TspEI | | MnlI SetI || EcoRI SfeI* BinI* \ \ \ \ \\ \ \ \ AGGAAATTAAAGAAAAGAGGTATCTTATCCGGAATTCCTGTAGTATTTAGTGCCGAAAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTAATTTCTTTTCTCCATAGAATAGGCCTTAAGGACATCATAAATCACGGCTTTTT // / // / / / |MseI SetI || EcoRI SfeI* BinI* |MnlI || TspEI TspEI || ApoI |BspMII* |BetI* Hpy178III* HpaII R K L K K R G I L S G I P V V F S A E K G N * R K E V S Y P E F L * Y L V P K N E I K E K R Y L I R N S C S I * C R K T ----:----|----:----|----:----|----:----|----:----|----:----| L F N F F L P I K D P I G T T N L A S F F S I L S F L Y R I R F E Q L I * H R F P F * L F S T D * G S N R Y Y K T G F F MboI XhoII | DpnI | |BstKTI CviJI | |Hin4II* | TspEI Hin4I | || Hpy188I | | MboII MnlI | MnlI \ \\ \ \ \ \ \ \ \ CCAGATCCGAAGAAGGCTAAATTATTACCCTTACCAGATGAGGAATATGAAAGAGGAAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTAGGCTTCTTCCGATTTAATAATGGGAATGGTCTACTCCTTATACTTTCTCCTTTC // / / / / / / / /// || Hpy188I | | TspEI MnlI Hin4I MnlI ||TspDTI || XhoII | MboII ||BspCNI || MboI CviJI |BseMII |Hin4II* SetI |DpnI BstKTI P D P K K A K L L P L P D E E Y E R G K Q I R R R L N Y Y P Y Q M R N M K E E R R S E E G * I I T L T R * G I * K R K G ----:----|----:----|----:----|----:----|----:----|----:----| G S G F F A L N N G K G S S S Y S L P F V L D S S P * I I V R V L H P I H F L F W I R L L S F * * G * W I L F I F S S L SalI BseMII |TaqI |AccI |SetI |BspCNI |TspDTI ||HindII ||Hpy166II ||| Hpy99I ||| | AluI ||| | CviJI ||| | |DdeI ||| | |EspI* ||| | ||SetI ||| | ||| Hin6I ||| | ||| |GlaI ||| | ||| |Hin4II* ||| | ||| ||HhaI ||| | ||| ||Hin4I TfiI BsiYI* ||| | ||| |||HaeII HinfI | Csp6I ||| | ||| |||| TspGWI | Eco57I | |RsaI ||| | ||| |||| | XmnI | Eco57MI | |SetI \\\ \ \\\ \\\\ \ \ \ \ \ \\ GTCGACGAGCTGAGCGCCCTGAAGGACTTCCGTGTAAGAATCCTACCCGTTTTAGGTACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTGCTCGACTCGCGGGACTTCCTGAAGGCACATTCTTAGGATGGGCAAAATCCATGA //// / / / ///// / / / / / // |||| | | | ||||TspGWI XmnI | HinfI | | |Csp6I |||| | | | |||Hin6I | TfiI | | RsaI |||| | | | ||GlaI Eco57MI | SetI |||| | | | |Hin4II* Eco57I BsiYI* |||| | | | |HhaI |||| | | | EspI* |||| | | | HaeII |||| | | | DdeI |||| | | Hin4I |||| | CviJI |||| | AluI |||| SetI |||SalI ||AccI ||TaqI |Hpy166II |HindII Hpy99I V D E L S A L K D F R V R I L P V L G T S T S * A P * R T S V * E S Y P F * V L R R A E R P E G L P C K N P T R F R Y Y ----:----|----:----|----:----|----:----|----:----|----:----| T S S S L A R F S K R T L I R G T K P V P R R A S R G S P S G H L F G V R K L Y D V L Q A G Q L V E T Y S D * G N * T S BccI MaeII |BsaAI |DraIII Hin4I || SetI Hin4I Hin4I || TaiI Hin4I Hpy188I \ \\ \ \ \ ATGCCAAGTTTGTTTGGATTGACCATCACTACGTGGATTTTATCTAATATATCCGATAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTTCAAACAAACCTAACTGGTAGTGATGCACCTAAAATAGATTATATAGGCTATTT / // // / / / Hin4I || || Hin4I | SetI Hin4I || || Hin4I Hpy188I || |MaeII || BsaAI || BccI |TaiI |SetI DraIII M P S L F G L T I T T W I L S N I S D K C Q V C L D * P S L R G F Y L I Y P I N A K F V W I D H H Y V D F I * Y I R * T ----:----|----:----|----:----|----:----|----:----|----:----| I G L K N P N V M V V H I K D L I D S L * A L N T Q I S W * * T S K I * Y I R Y H W T Q K S Q G D S R P N * R I Y G I F XbaI SetI |MaeI |Hpy178III* BccI || MnlI |AccI || | MnlI |SetI || | |SetI TspEI ||BssNAI || | || BsiYI* | MseI ||Hpy166II BspMI \\ \ \\ \ \ \ \\\ \ CCTCTAGAACCTGTTGAGGGTAAGAATAGAATTAAGGTATACGATGGTATATATCAATCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGATCTTGGACAACTCCCATTCTTATCTTAATTCCATATGCTACCATATATAGTTAGC /// / / // /// / ||| | BsiYI* || ||AccI BspMI ||| MnlI || |Hpy166II ||SetI || |BssNAI ||MnlI || BccI |XbaI |MseI Hpy178III* |SetI MaeI TspEI P L E P V E G K N R I K V Y D G I Y Q S L * N L L R V R I E L R Y T M V Y I N R S R T C * G * E * N * G I R W Y I S I V ----:----|----:----|----:----|----:----|----:----|----:----| G R S G T S P L F L I L T Y S P I Y * D V E L V Q Q P Y S Y F * P I R H Y I D I R * F R N L T L I S N L Y V I T Y I L R AccI |PleI |BssNAI |Hpy166II TfiI Hin4II* SetI HinfI ||MlyI CviJI HinfI |CviJI \ \ \\\ \ \ \\ TTGGCAGGTCAAATGAGCAGAGTCGGTATACCGAGCCAAAGAATCCCATTGGCTTTGAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTCCAGTTTACTCGTCTCAGCCATATGGCTCGGTTTCTTAGGGTAACCGAAACTTC / / // / / / / SetI | |PleI CviJI HinfI | CviJI | |MlyI TfiI Hin4II* | |AccI | Hpy166II | BssNAI HinfI L A G Q M S R V G I P S Q R I P L A L K W Q V K * A E S V Y R A K E S H W L * R G R S N E Q S R Y T E P K N P I G F E G ----:----|----:----|----:----|----:----|----:----|----:----| N A P * I L L T P I G L W L I G N A K F T P L D F S C L R Y V S G F F G M P K S Q C T L H A S D T Y R A L S D W Q S Q L BseGI |MaeIII TspEI || FokI | BsiYI* || |SetI | |AciI || |Ksp632I* SetI | ||BisI || ||MnlI | MseI | |||BlsI || ||| TaqI | | MboII | ||||TauI \\ \\\ \ \ \ \ \ \\\\\ GATGTTAGTTACCTTGTCGAAGAGGTGTTTAAGGGTAAATCTCCAATTAGCGGCATTTCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAATCAATGGAACAGCTTCTCCACAAATTCCCATTTAGAGGTTAATCGCCGTAAAGG / / / / / / / // / / /// BseGI | | | | | SetI |MseI | | ||BisI | | | | TaqI MboII | | ||AciI | | | Ksp632I* | | |BlsI | | | FokI | | TauI | | MnlI | TspEI | MaeIII BsiYI* SetI D V S Y L V E E V F K G K S P I S G I S M L V T L S K R C L R V N L Q L A A F P C * L P C R R G V * G * I S N * R H F H ----:----|----:----|----:----|----:----|----:----|----:----| S T L * R T S S T N L P L D G I L P M E P H * N G Q R L P T * P Y I E L * R C K I N T V K D F L H K L T F R W N A A N G BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | |BstKTI | | || TsoI SetI MaeI MseI | | || | BinI* MnlI CviRI* TatI \ \ \ \ \\ \ \ \ \ \ ACTAGACTAACTTTAACCAAATGGGATCCCTCTAAACCTATCTCTTTGCAAAATGTGGTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTGATTGAAATTGGTTTACCCTAGGGAGATTTGGATAGAGAAACGTTTTACACCAT / / / // / / / / / MaeI MseI | || | | | MnlI CviRI* | || | | SetI | || | BinI* | || XhoII | || BamHI | || TsoI | || MboI | |NlaIV | |DpnI | BstKTI BinI* T R L T L T K W D P S K P I S L Q N V V L D * L * P N G I P L N L S L C K M W * * T N F N Q M G S L * T Y L F A K C G S ----:----|----:----|----:----|----:----|----:----|----:----| V L S V K V L H S G E L G I E K C F T T W * V L K L W I P D R * V * R K A F H P S S * S * G F P I G R F R D R Q L I H Y Tsp4CI* Tth111I ApaLI |BbvII* | CviRI* ||Hin4II* | Hpy166II ||| Hpy178III* Csp6I | | SduI ||| |FalI HindIII |RsaI | | BseSI ||| |FalI | AluI |ScaI | | HgiAI* ||| |MboII | CviJI \\ \ \ \ \\\ \\ \ \ GTACTAACTAAAAACGAACAGAAAGTGCACGAAGACCGTGTCTTGAAGGGTAAGGAAAGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CATGATTGATTTTTGCTTGTCTTTCACGTGCTTCTGGCACAGAACTTCCCATTCCTTTCG /// / / / / / / / / / ||TatI | | ApaLI | | | Hpy178III* | CviJI |Csp6I | Hpy166II | | BbvII* | AluI ScaI | CviRI* | | MboII SetI RsaI HgiAI* | Tth111I BseSI | Hin4II* SduI | FalI | FalI Tsp4CI* V L T K N E Q K V H E D R V L K G K E S Y * L K T N R K C T K T V S * R V R K A T N * K R T E S A R R P C L E G * G K L ----:----|----:----|----:----|----:----|----:----|----:----| T S V L F S C F T C S S R T K F P L S L L V L * F R V S L A R L G H R S P Y P F Y * S F V F L F H V F V T D Q L T L F A TfiI HinfI FalI | Hpy188I SetI SfaNI FalI BsrI | | HindIII \ \ \ \ \ \ \ TTACAAGATGTTTATGATGCCAAAGTTCTAAAACTGGTTTCACAAAGATTCAGAGAAGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCTACAAATACTACGGTTTCAAGATTTTGACCAAAGTGTTTCTAAGTCTCTTCTT / / / // / HindIII SfaNI BsrI |Hpy188I SetI FalI HinfI FalI TfiI L Q D V Y D A K V L K L V S Q R F R E E Y K M F M M P K F * N W F H K D S E K K T R C L * C Q S S K T G F T K I Q R R S ----:----|----:----|----:----|----:----|----:----|----:----| K C S T * S A L T R F S T E C L N L S S S V L H K H H W L E L V P K V F I * L L * L I N I I G F N * F Q N * L S E S F F AluI CviJI | SetI | | MboII TspEI Hpy188I \ \ \ \ \ GCTTATTACTCTCAATTCAGATGA 1330 1340 ----:----|----:----|---- CGAATAATGAGAGTTAAGTCTACT / / / // | | MboII |Hpy188I | HindIII TspEI CviJI AluI A Y Y S Q F R * L I T L N S D X L L L S I Q M X ----:----|----:----|---- A * * E * N L H L K N S E I * I S I V R L E S S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 5 FblI,XmiI AciI 4 BspACI,SsiI AlfI 2 AluI 4 AluBI ApaLI 1 Alw44I,VneI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 2 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BciVI 1 BfuI BetI* 2 BsaWI BinI* 8 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspMI 2 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstKTI 8 BtsI 2 Cac8I 2 BstC8I Csp6I 2 CviQI,RsaNI CviAII 4 CviJI 8 CviKI-1 CviRI* 6 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI DraIII 1 AdeI DsaI* 3 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 HaeII 1 BstH2I HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 7 HpyAV Hin6I 2 HinP1I,HspAI HindII 3 HincII HindIII 2 HinfI 4 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 11 MseI 7 Tru1I,Tru9I MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 2 AleI PleI 1 PpsI PvuII 1 RsaI 2 AfaI RsrII 1 CspI,Rsr2I,CpoI SalI 2 ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 20 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 1 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 3 TaqII 2 TatI 1 TauI 1 TfiI 3 PfeI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI TstI 1 Tth111I 2 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AloI AlwNI ApaI AscI Asp718I AsuII AvaI AvrII BalI BarI BbvCI BbvI BceAI BcgI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaXI BsePI BseYI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtrI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I FseI FspAI GsaI GsuI HaeIII HgaI HgiCI* HgiJII* KasI KpnI MauBI McrI* MluI Mph1103I MroNI MwoI NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TseI TspMI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769