Restriction Map of MRT4/YKL009W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MRT4/YKL009W on chromosome XI from coordinates 426242 to 426952.


MboI | DpnI AluI | |BstKTI CviJI | || AclI |MaeI | || MaeII ||SetI | || | SetI |||MaeIII | || | TaiI |||Tsp45I \ \\ \ \ \\\\ ATGCCAAGATCAAAACGTTCCAAGCTAGTCACTTTAGCACAAACCGATAAAAAGGGCAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTTCTAGTTTTGCAAGGTTCGATCAGTGAAATCGTGTTTGGCTATTTTTCCCGTCT // / / / / / / / || | | | | | MaeI Tsp45I || | | | | CviJI MaeIII || | | | | AluI || | | | SetI || | | MaeII || | | AclI || | TaiI || | SetI || MboI |DpnI BstKTI M P R S K R S K L V T L A Q T D K K G R C Q D Q N V P S * S L * H K P I K R A E A K I K T F Q A S H F S T N R * K G Q R ----:----|----:----|----:----|----:----|----:----|----:----| X G L D F R E L S T V K A C V S L F P L X A L I L V N W A L * K L V F R Y F P C H W S * F T G L * D S * C L G I F L A S CviJI MaeII ApoI TaqI |TspDTI | SetI TspEI | MnlI ||DdeI | TaiI \ \ \ \\\ \ \ GAAAATAAAGAAAGAATTTTCGATGAAGTGAGGGAAGCCTTAGATACTTATAGATACGTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTATTTCTTTCTTAAAAGCTACTTCACTCCCTTCGGAATCTATGAATATCTATGCAG / / // / / / | TaqI || DdeI | MaeII | MnlI |CviJI TaiI TspEI TspDTI SetI ApoI E N K E R I F D E V R E A L D T Y R Y V K I K K E F S M K * G K P * I L I D T S K * R K N F R * S E G S L R Y L * I R L ----:----|----:----|----:----|----:----|----:----|----:----| S F L S L I K S S T L S A K S V * L Y T L F Y L F F K R H L S P L R L Y K Y I R F I F F S N E I F H P F G * I S I S V D Hpy178III* AsuI* |GsuI AvaII |Eco57MI DraII || MaeII PpuMI || | Hpy99I |NlaIV || | |SetI |BmgT120I || | |TaiI BsrI Hpy188I \\ \\ \ \\ \ \ TGGGTCCTACATCTTGACGACGTAAGAACTCCAGTTTTACAAGAAATCAGAACATCTTGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCAGGATGTAGAACTGCTGCATTCTTGAGGTCAAAATGTTCTTTAGTCTTGTAGAACC /// / / / / / / / ||PpuMI | | | | MaeII BsrI Hpy188I ||DraII | | | TaiI ||AvaII | | | SetI ||AsuI* | | Hpy99I || | Hpy178III* || Eco57MI || GsuI |BmgT120I NlaIV W V L H L D D V R T P V L Q E I R T S W G S Y I L T T * E L Q F Y K K S E H L G G P T S * R R K N S S F T R N Q N I L G ----:----|----:----|----:----|----:----|----:----|----:----| Q T R C R S S T L V G T K C S I L V D Q R P G V D Q R R L F E L K V L F * F M K P D * M K V V Y S S W N * L F D S C R P Cac8I | CviJI MseI | | DdeI |TspEI MnlI MnlI \ \ \ \\ \ \ GCAGGCTCTAAGTTAATTATGGGTAAGAGGAAAGTTTTACAAAAAGCATTGGGAGAAAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCGAGATTCAATTAATACCCATTCTCCTTTCAAAATGTTTTTCGTAACCCTCTTTTC / / / / // / | CviJI | | |MnlI MnlI Cac8I | | TspEI | MseI DdeI A G S K L I M G K R K V L Q K A L G E K Q A L S * L W V R G K F Y K K H W E K R R L * V N Y G * E E S F T K S I G R K E ----:----|----:----|----:----|----:----|----:----|----:----| A P E L N I I P L L F T K C F A N P S F P L S * T L * P Y S S L K V F L M P L F C A R L * N H T L P F N * L F C Q S F L HindIII | AluI AciI MboII MfeI | CviJI | MaeIII | MboII TspEI | | SetI | Tsp45I \ \ \ \ \ \ \ \ AGGGAAGAAGAATACAAAGAAAATCTGTATCAATTGAGTAAGCTTTGTAGCGGTGTCACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTTCTTCTTATGTTTCTTTTAGACATAGTTAACTCATTCGAAACATCGCCACAGTGA / / / / / / / / / | MboII | | | HindIII | | Tsp45I MboII | | CviJI | | MaeIII | | AluI | TspRI | SetI AciI TspEI MfeI R E E E Y K E N L Y Q L S K L C S G V T G K K N T K K I C I N * V S F V A V S L G R R I Q R K S V S I E * A L * R C H W ----:----|----:----|----:----|----:----|----:----|----:----| L S S S Y L S F R Y * N L L S Q L P T V S P L L I C L F D T D I S Y A K Y R H * P F F F V F F I Q I L Q T L K T A T D S BseGI HindII MaeII Hpy166II | SetI | Tsp4CI* | TaiI BsrI Hpy166II |FalI |FokI | |FalI TspRI |MnlI TspRI |FalI || TspRI MseI | |FalI \ \\ \ \\ \\ \ \ \ \\ GGTTTATTGTTCACTGATGAGGATGTCAACACTGTCAAGGAATACTTTAAGTCATACGTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATAACAAGTGACTACTCCTACAGTTGTGACAGTTCCTTATGAAATTCAGTATGCAA / / / / / / / / / / / BsrI | Hpy166II | | | | FokI MseI | MaeII | MnlI | | | Tsp4CI* FalI TspRI | | Hpy166II FalI | | HindII TaiI | | TspRI SetI | BseGI FalI FalI G L L F T D E D V N T V K E Y F K S Y V V Y C S L M R M S T L S R N T L S H T F F I V H * * G C Q H C Q G I L * V I R S ----:----|----:----|----:----|----:----|----:----|----:----| P K N N V S S S T L V T L S Y K L D Y T Q N I T * Q H P H * C Q * P I S * T M R T * Q E S I L I D V S D L F V K L * V N BseMII |BspCNI || TspEI || |MnlI || || Hpy178III* || || |DdeI Hpy188I Hpy178III* TaqII || || |SauI* \ \ \ \\ \\ \\ CGTTCAGACTATTCAAGACCGAACACGAAAGCACCACTAACATTTACAATTCCTGAGGGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAGTCTGATAAGTTCTGGCTTGTGCTTTCGTGGTGATTGTAAATGTTAAGGACTCCCG / / / // / / / / Hpy188I Hpy178III* TaqII || | | | SauI* || | | | DdeI || | | Hpy178III* || | TspEI || MnlI |BspCNI BseMII R S D Y S R P N T K A P L T F T I P E G V Q T I Q D R T R K H H * H L Q F L R A F R L F K T E H E S T T N I Y N S * G H ----:----|----:----|----:----|----:----|----:----|----:----| R E S * E L G F V F A G S V N V I G S P E N L S N L V S C S L V V L M * L E Q P T * V I * S R V R F C W * C K C N R L A ApoI TspEI BseMII |BspCNI || MnlI AccI || | AluI |Hpy166II || | CviJI || MaeII || | PvuII AjuI || |PmaCI || | NspBII* | XmnI || |BsaAI || | |DdeI | | TspDTI || || SetI || | |BbvCI | | | MboII || || TaiI || | |Bpu10I | | | | TfiI || || |DraIII || | ||SetI | | | | HinfI \\ \\ \\ \\ \ \\\ \ \ \ \ \ ATTGTCTACTCACGTGGTGGTCAAATTCCAGCTGAGGAAGATGTTCCAATGATTCATTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAGATGAGTGCACCACCAGTTTAAGGTCGACTCCTTCTACAAGGTTACTAAGTAAGA // / // // // / / // / / / || | |MaeII || || | | || TspDTI MboII HinfI || | DraIII || || | | || XmnI TfiI || | BsaAI || || | | |Bpu10I || | PmaCI || || | | |BbvCI || TaiI || || | | |DdeI || SetI || || | | AjuI |AccI || || | NspBII* Hpy166II || || | PvuII || || | CviJI || || | AluI || || SetI || |TspEI || |ApoI || MnlI |BspCNI BseMII I V Y S R G G Q I P A E E D V P M I H S L S T H V V V K F Q L R K M F Q * F I L C L L T W W S N S S * G R C S N D S F F ----:----|----:----|----:----|----:----|----:----|----:----| M T * E R P P * I G A S S S T G I I * E C Q R S V H H D F E L Q P L H E L S E N N D V * T T T L N W S L F I N W H N M R AluI MboI CviJI | DpnI CviJI ApoI ApoI | HphI | MmeI | AjuI TspEI TspEI | SetI | |BstKTI \ \ \ \ \ \ \ \\ TTAGAGCCAACTATGAGAAACAAATTTGAAATTCCAACTAAAATCAAAGCTGGTAAGATC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTCGGTTGATACTCTTTGTTTAAACTTTAAGGTTGATTTTAGTTTCGACCATTCTAG / / / / // /// / CviJI TspEI TspEI | |HphI ||| MboI AjuI ApoI ApoI | CviJI ||DpnI | AluI |BstKTI SetI MmeI L E P T M R N K F E I P T K I K A G K I * S Q L * E T N L K F Q L K S K L V R S R A N Y E K Q I * N S N * N Q S W * D H ----:----|----:----|----:----|----:----|----:----|----:----| K S G V I L F L N S I G V L I L A P L I K L A L * S F C I Q F E L * F * L Q Y S * L W S H S V F K F N W S F D F S T L D Eco57I Eco57MI | HindIII | | AluI Hin4II* | | CviJI Tsp4CI* |CviRI* TspRI TspEI | | | SetI \ \\ \ \ \ \ \ \ ACCATTGACAGTCCATATTTAGTTTGCACTGAAGGAGAAAAATTAGATGTTCGTCAAGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAACTGTCAGGTATAAATCAAACGTGACTTCCTCTTTTTAATCTACAAGCAGTTCGA / / / / / / / / Tsp4CI* | CviRI* | Eco57MI | | HindIII Hin4II* | Eco57I | CviJI TspRI TspEI | AluI SetI T I D S P Y L V C T E G E K L D V R Q A P L T V H I * F A L K E K N * M F V K L H * Q S I F S L H * R R K I R C S S S F ----:----|----:----|----:----|----:----|----:----|----:----| V M S L G Y K T Q V S P S F N S T R * A * W Q C D M N L K C Q L L F I L H E D L G N V T W I * N A S F S F F * I N T L S BarI Hpy188I BbvI TseI |ApoI CviJI |XmnI |BisI |TspEI HaeIII MseI |TspEI ||BlsI |EcoRI BarI SetI | BsaXI \ \\ \\\ \\ \ \ \ \ TTAATACTGAAACAATTCGGTATCGCTGCTTCTGAATTCAAAGTCAAGGTGTCGGCCTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AATTATGACTTTGTTAAGCCATAGCGACGAAGACTTAAGTTTCAGTTCCACAGCCGGATG / / / // /// / // / / | BarI | |TspEI ||| | |BarI SetI HaeIII MseI | BbvI ||| | EcoRI CviJI XmnI ||| | TspEI BsaXI ||| | ApoI ||| Hpy188I ||TseI |BisI BlsI L I L K Q F G I A A S E F K V K V S A Y * Y * N N S V S L L L N S K S R C R P T N T E T I R Y R C F * I Q S Q G V G L L ----:----|----:----|----:----|----:----|----:----|----:----| K I S F C N P I A A E S N L T L T D A * K L V S V I R Y R Q K Q I * L * P T P R * Y Q F L E T D S S R F E F D L H R G V MslI AluI Tsp4CI* |FatI CviJI | TspRI ||CviAII | SetI | | BsaXI ||| NlaIII \ \ \ \ \ \\\ \ TATGACAACGATAGCTCCACTGTTGAAAGCACTAACATCAACATGGAATAA 670 680 690 700 710 ----:----|----:----|----:----|----:----|----:----|- ATACTGTTGCTATCGAGGTGACAACTTTCGTGATTGTAGTTGTACCTTATT / // / / // // | || | BsaXI || |FatI | || Tsp4CI* || CviAII | |TspRI |NlaIII | CviJI MslI | AluI SetI Y D N D S S T V E S T N I N M E * M T T I A P L L K A L T S T W N X * Q R * L H C * K H * H Q H G I X ----:----|----:----|----:----|----:----|----:----|- * S L S L E V T S L V L M L M S Y S H C R Y S W Q Q F C * C * C P I I V V I A G S N F A S V D V H F L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AclI 1 Psp1406I AjuI 1 AluI 6 AluBI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvCI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseGI 1 BstF5I,BtsCI BseMII 2 BspCNI 2 BsrI 2 BseNI,Bse1I,BsrSI BstKTI 2 Cac8I 1 BstC8I CviAII 1 CviJI 10 CviKI-1 CviRI* 1 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I DraIII 1 AdeI Eco57I 1 AcuI Eco57MI 2 EcoRI 1 FalI 2 FatI 1 FokI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI Hin4II* 1 HpyAV HindII 1 HincII HindIII 2 HinfI 1 HphI 1 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 1 MaeI 1 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 1 MunI MmeI 1 MnlI 6 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PvuII 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI SetI 12 TaiI 5 TaqI 1 TaqII 1 TfiI 1 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 10 TasI,Tsp509I,Sse9I TspRI 5 TscAI XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI BsaBI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HinP1I HpaI HpaII HspAI KasI KpnI Ksp632I* MauBI McrI* MluI MlyI Mph1103I MroNI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsaI RsaNI RsrII SacI SacII SalI SanDI SapI ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TatI TauI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769