Restriction Map of DID4/YKL002W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

DID4/YKL002W on chromosome XI from coordinates 437778 to 438544.


MaeIII AciI MseI Tsp45I |MnlI SetI \ \\ \ ATGAGTTTGTTTGAGTGGGTATTTGGAAAGAATGTCACTCCGCAAGAGAGGTTAAAAAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAAACAAACTCACCCATAAACCTTTCTTACAGTGAGGCGTTCTCTCCAATTTTTTT / / / / / | | AciI SetI MseI | MnlI Tsp45I MaeIII M S L F E W V F G K N V T P Q E R L K K * V C L S G Y L E R M S L R K R G * K K E F V * V G I W K E C H S A R E V K K S ----:----|----:----|----:----|----:----|----:----|----:----| X L K N S H T N P F F T V G C S L N F F X S N T Q T P I Q F S H * E A L S T L F H T Q K L P Y K S L I D S R L L P * F F AclI MaeII MboI | MseI | DpnI | SetI | |BstKTI | TaiI | || BinI* Hpy166II | |TspEI \ \\ \ \ \ \\ GTATGTTGTTCTGTATTTGGATCAGTTATTTTAGTGAACATACTAACGTTAATTATTTGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATACAACAAGACATAAACCTAGTCAATAAAATCACTTGTATGATTGCAATTAATAAACT // / / / / / / / || MboI BinI* Hpy166II | | | TspEI |DpnI | | MseI BstKTI | MaeII | AclI TaiI SetI V C C S V F G S V I L V N I L T L I I * Y V V L Y L D Q L F * * T Y * R * L F E M L F C I W I S Y F S E H T N V N Y L S ----:----|----:----|----:----|----:----|----:----|----:----| T H Q E T N P D T I K T F M S V N I I Q L I N N Q I Q I L * K L S C V L T L * K Y T T R Y K S * N N * H V Y * R * N N S MnlI |HinfI || DdeI || | Hpy188I || | | AluI || | | CviJI CviJI || | | | SetI TfiI | MlyI || | | | |BspCNI HinfI | PleI || | | | ||BseMII TspEI \ \ \ \\ \ \ \ \\\ \ GTTTTTAGAATCAAAGGGCTTTAGAAAGGACTCAGAGGGAGCTTGAAAGAGAAAAGAGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAAATCTTAGTTTCCCGAAATCTTTCCTGAGTCTCCCTCGAACTTTCTCTTTTCTCTT / / // / /// / /// HinfI | || MnlI ||DdeI | ||BseMII TfiI | |PleI || | |BspCNI | MlyI || | CviJI CviJI || | AluI || SetI |Hpy188I HinfI V F R I K G L * K G L R G S L K E K R E F L E S K G F R K D S E G A * K R K E K F * N Q R A L E R T Q R E L E R E K R K ----:----|----:----|----:----|----:----|----:----|----:----| T K L I L P S * F P S L P L K F S F L S L K * F * L A K S L V * L S S S L S F L N K S D F P K L F S E S P A Q F L F S F Hpy188I | TspEI | | MseI BbvI \ \ \ \ AATTGGAACTACAAGATAAAAAACTTGTATCAGAAATTAAAAAATCGGCAAAGAATGGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACCTTGATGTTCTATTTTTTGAACATAGTCTTTAATTTTTTAGCCGTTTCTTACCCG / / // / TspEI | |MseI BbvI | TspEI Hpy188I N W N Y K I K N L Y Q K L K N R Q R M G I G T T R * K T C I R N * K I G K E W A L E L Q D K K L V S E I K K S A K N G Q ----:----|----:----|----:----|----:----|----:----|----:----| F Q F * L I F F K Y * F N F F R C L I P F N S S C S L F S T D S I L F D A F F P I P V V L Y F V Q I L F * F I P L S H A TseI CviRI* |BisI ||BlsI |||TseI |||AluI FokI |||CviJI | BssKI |||PvuII | | HpaII |||NspBII* | | ScrFI ||||BisI | | CauII* |||||BlsI | | | TspEI ApoI |||||SetI BbvI | | | | BseGI TspEI \\\\\\ \ \ \ \ \ \ \ AAGTTGCAGCTGCGAAAGTTCAAGCAAAAGATTTAGTAAGAACCCGGAATTACATCCAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAACGTCGACGCTTTCAAGTTCGTTTTCTAAATCATTCTTGGGCCTTAATGTAGGTTT /////// / / /// // ||||||TseI BbvI | ||| |TspEI |||||BisI | ||| BseGI ||||BlsI | ||BssKI |||NspBII* | |HpaII |||PvuII | CauII* |||CviJI | ScrFI |||TseI FokI |||AluI ||BisI |BlsI |SetI CviRI* K L Q L R K F K Q K I * * E P G I T S K S C S C E S S S K R F S K N P E L H P K V A A A K V Q A K D L V R T R N Y I Q K ----:----|----:----|----:----|----:----|----:----|----:----| L N C S R F N L C F I * Y S G P I V D L C T A A A F T * A F S K T L V R F * M W L Q L Q S L E L L L N L L F G S N C G F FalI FalI | Eco57I | Eco57MI | |FatI | ||CviAII | ||| NlaIII EcoRV CviJI | ||| | AluI | BceAI HaeIII | ||| | CviJI | | FalI | TaqI | ||| | | SetI TspDTI | | FalI | AsuII \ \\\ \ \ \ \ \ \ \ \ \ AATTTGACAACATGAAAGCTCAACTTCAGGCGATATCATTGAGAATACAGGCCGTTCGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACTGTTGTACTTTCGAGTTGAAGTCCGCTATAGTAACTCTTATGTCCGGCAAGCTT / / / / // / / / / / / / | | | | || | CviJI TspDTI | BceAI HaeIII AsuII | | | | || | AluI EcoRV CviJI TaqI | | | | || SetI FalI | | | | |FatI FalI | | | | CviAII | | | NlaIII | | Eco57MI | | Eco57I | TspEI | ApoI FalI FalI N L T T * K L N F R R Y H * E Y R P F E I * Q H E S S T S G D I I E N T G R S K F D N M K A Q L Q A I S L R I Q A V R S ----:----|----:----|----:----|----:----|----:----|----:----| F K V V H F S L K L R Y * Q S Y L G N S F N S L M F A * S * A I D N L I C A T R I Q C C S L E V E P S I M S F V P R E F AflIII | MaeII | | SetI BsrI MaeIII | | TaiI CviJI XcmI Tsp45I | | | MnlI HaeIII TspRI CviJI \ \ \ \ \ \ \ \ GTAGTGACCAAATGACACGTTCTATGAGCGAGGCCACTGGTCTTTTGGCTGGAATGAACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CATCACTGGTTTACTGTGCAAGATACTCGCTCCGGTGACCAGAAAACCGACCTTACTTGT / / / / // // / Tsp45I | | MnlI || |XcmI CviJI MaeIII | AflIII || BsrI | MaeII |HaeIII TaiI |CviJI SetI TspRI V V T K * H V L * A R P L V F W L E * T * * P N D T F Y E R G H W S F G W N E Q S D Q M T R S M S E A T G L L A G M N R ----:----|----:----|----:----|----:----|----:----|----:----| T T V L H C T R H A L G S T K Q S S H V L L S W I V R E I L S A V P R K A P I F Y H G F S V N * S R P W Q D K P Q F S C DdeI |SetI || TspDTI || | CviRI* || | | MnlI || | | | BccI || | | | BspCNI || | | | |BseMII TfiI || | | | ||EcoRV HinfI || | | | ||| TaqI |TspDTI || | | | ||| ClaI BccI \\ \\ \ \ \ \\\ \ \ GAACAATGAATCTACCTCAGTTGCAAAGGATATCGATGGAGTTTGAAAAGCAGAGTGATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTACTTAGATGGAGTCAACGTTTCCTATAGCTACCTCAAACTTTTCGTCTCACTAA / / / / // // // / / | | SetI | || || || ClaI BccI | HinfI | || || || TaqI | TfiI | || || |EcoRV TspDTI | || || BccI | || |BseMII | || BspCNI | |MnlI | CviRI* TspDTI DdeI E Q * I Y L S C K G Y R W S L K S R V I N N E S T S V A K D I D G V * K A E * F T M N L P Q L Q R I S M E F E K Q S D L ----:----|----:----|----:----|----:----|----:----|----:----| S C H I * R L Q L P Y R H L K F L L T I L V I F R G * N C L I D I S N S F C L S F L S D V E T A F S I S P T Q F A S H N AluI CviJI | SetI | | TaqII | | | MaeII ApoI | | | | FatI TspEI | | | | SetI EcoRI | | | | TaiI HindII | FatI | | | | |CviAII Hpy166II | |CviAII | | | | || MnlI | TspDTI | || NlaIII | | | | || NlaIII \ \ \ \\ \ \ \ \ \ \\ \ TGATGGGTCAACGACAGGAATTCATGGACGAAGCTATTGATAACGTCATGGGTGATGAGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACTACCCAGTTGCTGTCCTTAAGTACCTGCTTCGATAACTATTGCAGTACCCACTACTCC / / // / / / / // // / Hpy166II | |FatI | | | | || |FatI SetI HindII | | | | | | || CviAII TspDTI | | | | | | || MnlI | | | | | | |NlaIII | | | | | | MaeII | | | | | TaiI | | | | | SetI | | | | TaqII | | | CviJI | | | AluI | | SetI | CviAII NlaIII EcoRI TspEI ApoI * W V N D R N S W T K L L I T S W V M R D G S T T G I H G R S Y * * R H G * * G M G Q R Q E F M D E A I D N V M G D E V ----:----|----:----|----:----|----:----|----:----|----:----| Q H T L S L F E H V F S N I V D H T I L K I P * R C S N M S S A I S L T M P S S S P D V V P I * P R L * Q Y R * P H H P BseGI | BbvII* | | FokI | | | AluI | | | CviJI | | | MboII | | | |TspDTI | | | ||SetI | | | ||| PsrI SetI | | | ||| | MboII | HphI | | | ||| | |TspEI Hpy178III* PsrI \ \ \ \ \ \\\ \ \\ \ \ TGGATGAAGACGAAGAAGCTGACGAAATTGTAAATAAAGTTCTTGATGAGATTGGAGTGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTACTTCTGCTTCTTCGACTGCTTTAACATTTATTTCAAGAACTACTCTAACCTCACC / / //// / / / / | BseGI |||| MboII TspEI | PsrI HphI |||FokI Hpy178III* ||CviJI ||AluI |TspDTI |BbvII* |MboII |PsrI SetI W M K T K K L T K L * I K F L M R L E W G * R R R S * R N C K * S S * * D W S G D E D E E A D E I V N K V L D E I G V D ----:----|----:----|----:----|----:----|----:----|----:----| H I F V F F S V F N Y I F N K I L N S H T S S S S S A S S I T F L T R S S I P T P H L R L L Q R F Q L Y L E Q H S Q L P Hin6I |GlaI ||HhaI ||| MboI ||| | DpnI Tsp4CI* ||| | MwoI ApoI | CviRI* ||| | |PvuI TspEI | | MwoI ||| | |McrI* EcoRI | | |Cac8I MnlI ||| | |BstKTI \ \ \ \\ \ \\\ \ \\ ATTTGAATTCACAGTTGCAAAGCACGCCTCAAAATCTGGTTTCTAATGCGCCGATCGCAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACTTAAGTGTCAACGTTTCGTGCGGAGTTTTAGACCAAAGATTACGCGGCTAGCGTC / / / / / / //// // / / | | | | Cac8I MnlI |||| || | MwoI | | | MwoI |||| || MboI | | CviRI* |||| |DpnI | Tsp4CI* |||| BstKTI EcoRI |||| McrI* TspEI |||| PvuI ApoI |||MwoI ||Hin6I |GlaI HhaI I * I H S C K A R L K I W F L M R R S Q F E F T V A K H A S K S G F * C A D R R L N S Q L Q S T P Q N L V S N A P I A E ----:----|----:----|----:----|----:----|----:----|----:----| I Q I * L Q L A R R L I Q N R I R R D C S K F E C N C L V G * F R T E L A G I A N S N V T A F C A E F D P K * H A S R L TfiI HinfI | Hpy178III* | | BtgZI | | | SetI | | | | KasI | | | | HgiCI* | | | | |AcyI | | | | |NarI | | | | |Hin6I | | | | ||GlaI | | | | ||DinI | | | | ||NlaIV | | | | |||HhaI | | | | ||||HpaII | | | | ||||HaeII | | | | ||||| MboI | | | | ||||| | DpnI | | | | ||||| | |BstKTI | | | | ||||| | || Hpy188I | | | | ||||| | || |ApoI BccI | | | | ||||| | || |TspEI Tsp4CI* |MwoI | | | | ||||| | || || BinI* | Hpy178III* \\ \ \ \ \ \\\\\ \ \\ \\ \ \ \ AAACAGCGATGGGGATTCCTGAACCTATTGGCGCCGGATCAGAATTTCACGGTAATCCTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTCGCTACCCCTAAGGACTTGGATAACCGCGGCCTAGTCTTAAAGTGCCATTAGGAC / / / / / ///// /// / // / / BccI | | | | ||||| ||| | || Tsp4CI* Hpy178III* | | | | ||||| ||| | |TspEI | | | | ||||| ||| | |ApoI | | | | ||||| ||| | BinI* | | | | ||||| ||| Hpy188I | | | | ||||| ||| MboI | | | | ||||| ||DpnI | | | | ||||| |BstKTI | | | | ||||| HpaII | | | | ||||HgiCI* | | | | ||||KasI | | | | |||Hin6I | | | | |||NarI | | | | |||AcyI | | | | ||NlaIV | | | | ||DinI | | | | ||GlaI | | | | |HhaI | | | | HaeII | | | BtgZI | | SetI | Hpy178III* HinfI TfiI K Q R W G F L N L L A P D Q N F T V I L N S D G D S * T Y W R R I R I S R * S * T A M G I P E P I G A G S E F H G N P D ----:----|----:----|----:----|----:----|----:----|----:----| F C R H P N R F R N A G S * F K V T I R S V A I P I G S G I P A P D S N * P L G F L S P S E Q V * Q R R I L I E R Y D Q CviRI* | Cac8I | | AluI | | CviJI | | | SetI MboII \ \ \ \ \ ACGATGACTTGCAAGCTCGGTTGAACACTTTGAAGAAGCAGACTTGA 730 740 750 760 ----:----|----:----|----:----|----:----|----:-- TGCTACTGAACGTTCGAGCCAACTTGTGAAACTTCTTCGTCTGAACT / / / / | | CviJI MboII | | AluI | Cac8I | SetI CviRI* T M T C K L G * T L * R S R L X R * L A S S V E H F E E A D L X D D L Q A R L N T L K K Q T * ----:----|----:----|----:----|----:----|----:-- V I V Q L S P Q V S Q L L L S S S S S K C A R N F V K F F C V Q R H S A L E T S C K S S A S K # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 6 AluBI ApoI 4 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BseGI 2 BstF5I,BtsCI BseMII 2 BspCNI 2 BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 3 BtgZI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII CviAII 3 CviJI 10 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 3 MalI Eco57I 1 AcuI Eco57MI 1 EcoRI 2 EcoRV 2 Eco32I FalI 2 FatI 3 FokI 2 GlaI 2 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 2 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 KasI 1 MaeII 3 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MnlI 6 MseI 3 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NarI 1 Mly113I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 1 PpsI PsrI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 13 TaiI 3 TaqI 2 TaqII 1 TfiI 3 PfeI TseI 2 ApeKI Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 9 TasI,Tsp509I,Sse9I TspRI 1 TscAI XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstXI BstZ17I BtrI BtsI Cfr10I Cfr9I CfrI Csp6I CspCI CviQI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoT22I Esp3I EspI* FaqI FauI FnuDII* FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* Hin4I Hin4II* HindIII HpaI Hpy99I KpnI Ksp632I* MaeI MauBI MfeI MluI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SecI* SexAI SfaNI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TatI TauI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769