Restriction Map of YJRWTy1-2



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YJRWTy1-2 on chromosome X from coordinates 478051 to 483972.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.24121

SpeI SpeI |MaeI |MaeI \\ \\ TGTTGGAATAGAAATCAACTATCATCTACTAACTAGTATTTACATTACTAGTATATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTTATCTTTAGTTGATAGTAGATGATTGATCATAAATGTAATGATCATATAATAG // // |SpeI |SpeI MaeI MaeI C W N R N Q L S S T N * Y L H Y * Y I I V G I E I N Y H L L T S I Y I T S I L S L E * K S T I I Y * L V F T L L V Y Y H ----:----|----:----|----:----|----:----|----:----|----:----| X Q F L F * S D D V L * Y K C * * Y I I X N S Y F D V I M * * S T N V N S T Y * T P I S I L * * R S V L I * M V L I N D Hin4I Hin4I | MboII | AluI Tsp4CI* | | HgaI TspEI | CviJI \ \ \ \ \ \ \ ATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCCACAATCTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCACCTTCG / / / / // / / Tsp4CI* Hin4I MboII HgaI |TspEI | CviJI Hin4I | AluI SetI I Y G V R R * R K * * E I V I * I S G S Y T V L E D D A N D E K * S S K L V E A I R C * K M T Q M M R N S H L N * W K L ----:----|----:----|----:----|----:----|----:----|----:----| M Y P T L L H R L H H S I T M * I L P L * I R H * F I V C I I L F L * R F * H F Y V T N S S S A F S S F Y D D L N T S A MboI | DpnI | |BstKTI SetI | || BinI* TspDTI \ \ \\ \ \ TGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAAAATGATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATATTTGTATATTTTACTACTA // / / / || MboI BinI* TspDTI |DpnI BstKTI * N A R I D N V I G S M N I N I * N D D E T Q G L I M * * D Q * I * T Y K M M I K R K D * * C N R I N E Y K H I K * * * ----:----|----:----|----:----|----:----|----:----|----:----| Q F A L I S L T I P D I F I F M Y F S S S F R L S Q Y H L L I L S Y L C I F H H S V C P N I I Y Y S * H I Y V Y L I I I TspEI | CviRI* BsiYI* | | TfiI | TfiI MnlI SspI TspEI | | HinfI | HinfI | SmlI \ \ \ \ \ \ \ \ \ AATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATAAATATCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAA / / // / / / / SspI TspEI || | BsiYI* | MnlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI N N I Y R I V * N C R F P F M D S * I L I I F I E L C R I A D S L L W I P K S L * Y L * N C V E L Q I P F Y G F L N P * ----:----|----:----|----:----|----:----|----:----|----:----| L L I * L I T Y F Q L N G K I S E * I R Y Y Y K Y F Q T S N C I G K * P N R F G I I N I S N H L I A S E R K H I G L D K MaeI | BseRI | | Bce83I* | | | AccI | | | |BssNAI | | | |Hpy166II | | | || SetI TfiI | | | || | SspI CviJI HinfI \ \ \ \\ \ \ \ \ GAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATAGTTGTTACCTTA / / / // / / / SmlI | Bce83I* |AccI SspI CviJI HinfI BseRI |SetI TfiI MaeI Hpy166II BssNAI E E N F * Y I L Y T * Y Y S L Y Q Q W N R R T S S I F C I P N I I A F I N N G I G E L L V Y S V Y L I L * P L S T M E S ----:----|----:----|----:----|----:----|----:----|----:----| S S F K * Y I R Y V * Y * L R * * C H F Q P S S R T Y E T Y R I N Y G K D V I S L L V E L I N Q I G L I I A K I L L P I FatI |CviAII || NlaIII || | Hin6I || | |GlaI || | ||HhaI TspEI || | |||HaeII MaeIII \ \\ \ \\\\ \ CCCAACAATTATCTCAACATTCACATATTTCTCATGGTAGCGCCTGTGCTTCGGTTACTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTGTTAATAGAGTTGTAAGTGTATAAAGAGTACCATCGCGGACACGAAGCCAATGAA / / // //// / TspEI | || |||Hin6I MaeIII | || ||GlaI | || |HhaI | || HaeII | |FatI | CviAII NlaIII P N N Y L N I H I F L M V A P V L R L L P T I I S T F T Y F S W * R L C F G Y F Q Q L S Q H S H I S H G S A C A S V T S ----:----|----:----|----:----|----:----|----:----|----:----| G L L * R L M * M N R M T A G T S R N S D W C N D * C E C I E * P L A Q A E T V G V I I E V N V Y K E H Y R R H K P * K Hpy166II | TspGWI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeII AluI | | | | | DpnI | SetI CviJI DdeI | | | | | |BstKTI | TaiI | SetI Hin4II* \ \ \ \ \ \ \\ \ \ \ \ \ CTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTCAGCTTCCAAAACAGAAGAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCCTTCAGGTGTGTTTAGTTCTAGGCAATCTGCAAAGTCGAAGGTTTTGTCTTCTTA / / / / /// / / / / / / DdeI | | | ||| XhoII | | | CviJI Hin4II* | | | ||| MboI | | | AluI | | | ||DpnI | | SetI | | | |BstKTI | MaeII | | | | TaiI | | | | SetI | | | Hpy178III* | | BinI* | TspGWI Hpy166II L R K S T Q I K I R * T F Q L P K Q K N * G S P H K S R S V R R F S F Q N R R M K E V H T N Q D P L D V S A S K T E E C ----:----|----:----|----:----|----:----|----:----|----:----| R L F D V C I L I R * V N * S G F C F F E L S T W V F * S G N S T E A E L V S S * P L G C L D L D T L R K L K W F L L I AarI BspMI |MwoI || AluI || CviJI || PvuII MboII || NspBII* | CviJI DdeI CviJI TspDTI SetI || | SetI \ \ \ \ \ \ \\ \ \ GTGAGAAGGCTTCCACTAAGGCTAACTCTCAACAGACAACAACACCTGCTTCATCAGCTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCTTCCGAAGGTGATTCCGATTGAGAGTTGTCTGTTGTTGTGGACGAAGTAGTCGAC / / / / / / / / / | CviJI | CviJI | SetI | | NspBII* MboII DdeI TspDTI | | BspMI | | PvuII | | CviJI | | AarI | | AluI | SetI MwoI V R R L P L R L T L N R Q Q H L L H Q L * E G F H * G * L S T D N N T C F I S C E K A S T K A N S Q Q T T T P A S S A V ----:----|----:----|----:----|----:----|----:----|----:----| T L L S G S L S V R L L C C C R S * * S H S F A E V L A L E * C V V V G A E D A H S P K W * P * S E V S L L V Q K M L Q BceAI BseRI DdeI | BspCNI |FatI MnlI | |BseMII ||CviAII | HphI | || PflMI ||| NlaIII | MaeIII | || BsiYI* Hpy178III* ||| |BccI MnlI | Tsp45I | || | AsuI* \ \\\ \\ \ \ \ \ \\ \ \ TTCCAGAGAACCCCCATCATGCCTCTCCTCAAACTGCTCAGTCACATTCACCACAGAATG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTCTCTTGGGGGTAGTACGGAGAGGAGTTTGACGAGTCAGTGTAAGTGGTGTCTTAC / / / // / / / // / // / | | | || BccI MnlI | |DdeI | || BsiYI* | | | |FatI | HphI | || PflMI | | | CviAII MnlI | |BseMII | | NlaIII | |BceAI | BseRI | BspCNI Hpy178III* Tsp45I MaeIII F Q R T P I M P L L K L L S H I H H R M S R E P P S C L S S N C S V T F T T E W P E N P H H A S P Q T A Q S H S P Q N G ----:----|----:----|----:----|----:----|----:----|----:----| N W L V G M M G R R L S S L * M * W L I T G S F G W * A E G * V A * D C E G C F E L S G G D H R E E F Q E T V N V V S H FatI BmgT120I CviRI* |CviJI |CviAII |HaeIII ||BtsI || Csp6I OliI ||TspRI CviJI BstXI || |RsaI MslI ||| NlaIII | EcoP15I |BccI \\ \\ \ \\\ \ \ \ \\ GGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGCCAATCCATCTGGTTGGTCAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGCATGGGTGTCGTCACGTACTACTGGGTTTTGGTTCGGTTAGGTAGACCAACCAGTA // // / / / // / / / / || || | MslI | |FatI | | BstXI BccI || || | OliI | CviAII | EcoP15I || || TspRI CviRI* CviJI || |Csp6I NlaIII || RsaI BtsI |AsuI* BmgT120I HaeIII CviJI G R T H S S A * * P K T K P I H L V G H A V P T A V H D D P K P S Q S I W L V I P Y P Q Q C M M T Q N Q A N P S G W S F ----:----|----:----|----:----|----:----|----:----|----:----| P R V W L L A H H G L V L G I W R T P * P G Y G C C H M I V W F W A L G D P Q D A T G V A T C S S G F G L W D M Q N T M TspGWI | TspGWI | |TfiI | |BccI | |HinfI | || TaqII | || | AccI | || | |BssNAI TatI | || | |Hpy166II |Csp6I | || | || SetI ||RsaI \ \\ \ \\ \ \\\ TTTACGGACACCCATCTATGATTCCGTATACACCTTATCAAATGTCGCCTATGTACTTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGCCTGTGGGTAGATACTAAGGCATATGTGGAATAGTTTACAGCGGATACATGAAAG / / / / // / /// | | | | || SetI ||TatI | | | | |AccI |Csp6I | | | | Hpy166II RsaI | | | | BssNAI | | | TaqII | | | HinfI | | | TfiI | | BccI | TspGWI TspGWI F T D T H L * F R I H L I K C R L C T F L R T P I Y D S V Y T L S N V A Y V L S Y G H P S M I P Y T P Y Q M S P M Y F P ----:----|----:----|----:----|----:----|----:----|----:----| K V S V W R H N R I C R I L H R R H V K N * P C G D I I G Y V G * * I D G I Y K K R V G M * S E T Y V K D F T A * T S E BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI DdeI ||||AsuI* BciVI |Hpy188I |||||BmgT120I Tsp4CI* |BccI || HphI ||||||CviJI | MmeI || BseMII || | SduI ||||||HaeIII | |AciI || |BspCNI || | HgiAI* \\\\\\\ \ \\ \\ \\ \\ \ \ CACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATCAGTTGGAACGCCTCTGAGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGACCCGGTGTTAGTGTCAAAGGCGTCATAGGTAGTAGTCAACCTTGCGGAGACTCGT / / /// / / / / /// / // // | | ||AsuI* | MmeI AciI | ||BspCNI | || |BspCNI | | |BmgT120I Tsp4CI* | |BseMII | || |MnlI | | |HaeIII | BccI | || BseMII | | |CviJI BciVI | |DdeI | | EcoRII | |HphI | | BssKI | HgiAI* | | SecI* | SduI | BseBI Hpy188I | ScrFI SetI H L G H N H S F R S I H H Q L E R L * A T W A T I T V S A V S I I S W N A S E H P G P Q S Q F P Q Y P S S V G T P L S T ----:----|----:----|----:----|----:----|----:----|----:----| W R P W L * L K R L I W * * N S R R Q A G G P G C D C N G C Y G D D T P V G R L V Q A V I V T E A T D M M L Q F A E S C TfiI HinfI | BseGI | | DdeI | | BbvCI | | Bpu10I | | |MlyI | | |PleI DdeI | | || AciI |SetI | | || Hin4I |BccI | | || Hin4I ||HinfI | | || NspBII* |||EcoNI | | || | FokI |||| BsiYI* | | || | |HinfI |||| | SetI | | || | || MnlI |||| | PleI | | || | || | Hpy188I |||| | |MlyI | | || | || | |BspCNI MnlI |||| | || FokI | | || | || | ||BseMII BseMII |||| | || |Hin4I | | || | || | |||Hin4I |BspCNI |||| | || ||TspDTI | | || | || | |||| BseGI \\ \\\\ \ \\ \\\ \ \ \\ \ \\ \ \\\\ \ CTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATCCTCAGCGGACTCTGATATGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTAGTGGACTCAGTCCATTATGTAAATGACTAAGTAGGAGTCGCCTGAGACTATACT / ///// / / / / / / / //// / / /// / SetI ||||| | | | FokI | | | |||| | | ||| BseGI ||||| | | TspDTI | | | |||| | | ||BseMII ||||| | PleI | | | |||| | | |Hpy188I ||||| | MlyI | | | |||| | | |BspCNI ||||| Hin4I | | | |||| | | Hin4I ||||SetI | | | |||| | | HinfI |||HinfI | | | |||| | | FokI ||EcoNI | | | |||| | MnlI |DdeI | | | |||| AciI BsiYI* | | | |||NspBII* BccI | | | ||Bpu10I | | | ||BbvCI | | | ||DdeI | | | |PleI | | | MlyI | | Hin4I | | Hin4I | HinfI | TfiI BseGI L H H L S Q V I H L L I H P Q R T L I * S I T * V R * Y I Y * F I L S G L * Y D P S P E S G N T F T D S S S A D S D M T ----:----|----:----|----:----|----:----|----:----|----:----| S W * R L * T I C K S I * G * R V R I H V G D G S D P L V N V S E D E A S E S I E M V Q T L Y Y M * Q N M R L P S Q Y S HphI | MseI | |HpaI Hin4I | |HindII Hin4I | |Hpy166II SetI | Hpy188I | || SetI | MnlI TspEI \ \ \ \\ \ \ \ \ CATCCACTAAAAAATATGTCAGACCACCACCAATGTTAACCTCACCTAATGACTTTCCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGTGATTTTTTATACAGTCTGGTGGTGGTTACAATTGGAGTGGATTACTGAAAGGTT / / / // / / Hin4I Hpy188I | |MseI SetI MnlI Hin4I | |SetI | Hpy166II | HindII | HpaI HphI H P L K N M S D H H Q C * P H L M T F Q I H * K I C Q T T T N V N L T * * L S K S T K K Y V R P P P M L T S P N D F P N ----:----|----:----|----:----|----:----|----:----|----:----| C G S F F I D S W W W H * G * R I V K W V D V L F Y T L G G G I N V E G L S K G M W * F I H * V V V L T L R V * H S E L TaqI ApoI | TfiI MseI TspEI | HinfI Hpy188I \ \ \ \ \ ATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAATCTCGGTGGTATTATTCCGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCCAATTTTGTATGTAGTTTAAAAATGTTTTGAGCTTAGAGCCACCATAATAAGGCT / / / / / / TspEI MseI TspEI | HinfI Hpy188I ApoI | TfiI TaqI I G L K H T S N F Y K T R I S V V L F R L G * N I H Q I F T K L E S R W Y Y S D W V K T Y I K F L Q N S N L G G I I P T ----:----|----:----|----:----|----:----|----:----|----:----| I P N F C V D F K * L V R I E T T N N R F Q T L V Y M L N K C F E F R P P I I G N P * F M C * I K V F S S D R H Y * E S SplI* |Csp6I ||RsaI |||MaeII ||||MmeI |||||TspGWI ||||||SetI ||||||TaiI ||||||| MboI ||||||| Hpy188I SetI Tsp4CI* ||||||| | DpnI HphI | TspDTI | Hpy166II ||||||| | |BstKTI TspRI | | Hin4II* \ \ \\\\\\\ \ \\ \ \ \ \ CAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGAACTCACCTTCTTGTATAACA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATTTGCCTTTTGGGCATGCAGTCTAGTGACTACTACTTGAGTGGAAGAACATATTGT / / //// / // / / / / / | Hpy166II |||| | || MboI HphI SetI | Hin4II* Tsp4CI* |||| | |DpnI TspDTI |||| | BstKTI |||| | TspRI |||| Hpy188I |||MaeII ||SplI* |TspGWI |Csp6I MmeI RsaI TaiI SetI Q * T E N P Y V R S L M M N S P S C I T S K R K T R T S D H * * * T H L L V * H V N G K P V R Q I T D D E L T F L Y N T ----:----|----:----|----:----|----:----|----:----|----:----| C Y V S F G Y T L D S I I F E G E Q I V V T F P F G T R * I V S S S S V K K Y L L L R F V R V D S * Q H H V * R R T Y C SetI |FokI |BssKI |EcoRII ||SecI* |||ScrFI |||BseBI ||||SetI TspEI ||||Hin4I TspGWI SspI | MnlI ||||Hin4I | BseGI \ \ \ \\\\\ \ \ CTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTGGGTCAAAGACATCCTATCCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAGTTTATAAACGAGGGAGAGTTAAGGATGGATGGACCCAGTTTCTGTAGGATAGGC / / / // /// / / SspI | | || ||| | BseGI | | || ||| TspGWI | | || ||EcoRII | | || ||BssKI | | || ||SecI* | | || |FokI | | || BseBI | | || ScrFI | | |SetI | | Hin4I | | Hin4I | SetI TspEI MnlI L F K Y L L P L N S Y L P G S K T S Y P F S N I C S L S I P T Y L G Q R H P I R F Q I F A P S Q F L P T W V K D I L S V ----:----|----:----|----:----|----:----|----:----|----:----| S K L Y K S G R L E * R G P D F V D * G V K * I N A G E * N R G V Q T L S M R D K E F I Q E R E I G V * R P * L C G I R Hin4I Hin4I | EcoRV | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || NlaIII | | || | ApoI CviRI* | | || | TspEI | Hpy188I | | || | | TspGWI TspDTI | | MnlI \ \ \\ \ \ \ \ \ \ \ TTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTATTGAAAAAATGCAATCTGATA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAATATGCCTATAGTACTTTTAAGAAAGGTTTTCATAACTTTTTTACGTTAGACTAT / / / // / / / / / / Hin4I | | || | | TspDTI | | MnlI Hin4I | | || | TspEI | Hpy188I | | || | ApoI CviRI* | | || TspGWI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII EcoRV L I I R I S * K F F P K V L K K C N L I * L Y G Y H E N S F Q K Y * K N A I * Y D Y T D I M K I L S K S I E K M Q S D T ----:----|----:----|----:----|----:----|----:----|----:----| N I I R I D H F N K G F T N F F H L R I T S * V S I M F I R E L L I S F I C D S Q N Y P Y * S F E K W F Y Q F F A I Q Y MaeIII Tsp45I TatI | BssKI |Csp6I | SecI* ||RsaI | EcoRII ||SfaNI | | ScrFI |||Hpy166II | | BseBI |||| SfeI* | | | ApoI |||| |SetI | | | TspEI CviRI* |||| ||CviRI* \ \ \ \ \ \\\\ \\\ CCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCAATATAATGGCAGTACACCTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTCTCCGTTTGCTGTAACACTGGGACCGTTTAAACGTTATATTACCGTCATGTGGAC / /// / / /// // / | ||| | CviRI* ||| || CviRI* | ||| TspEI ||| |PstI | ||| ApoI ||| SfaNI | ||EcoRII ||TatI | ||BssKI ||SetI | |SecI* |Hpy166II | BseBI |Csp6I | ScrFI RsaI Tsp45I MaeIII P K R Q T T L * P W Q I C N I M A V H L P R G K R H C D P G K F A I * W Q Y T C Q E A N D I V T L A N L Q Y N G S T P A ----:----|----:----|----:----|----:----|----:----|----:----| G L L C V V N H G Q C I Q L I I A T C R V W S A F S M T V R A F K C Y L P L V G G L P L R C Q S G P L N A I Y H C Y V Q PstI | AarI | BspMI | |CviRI* MaeIII | || EcoT22I Tsp45I TaqI TspDTI BsmI \ \\ \ \ \ \ \ CAGATGCATTTGAAACAAAAGTCACAAACATTATCGACAGACTGAACAATAATGGCATTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTACGTAAACTTTGTTTTCAGTGTTTGTAATAGCTGTCTGACTTGTTATTACCGTAAG / / / / / / / / | | | BspMI Tsp45I TaqI TspDTI BsmI | | | AarI MaeIII | | CviRI* | EcoT22I SfeI* Q M H L K Q K S Q T L S T D * T I M A F R C I * N K S H K H Y R Q T E Q * W H S D A F E T K V T N I I D R L N N N G I H ----:----|----:----|----:----|----:----|----:----|----:----| C I C K F C F D C V N D V S Q V I I A N A S A N S V F T V F M I S L S F L L P M L H M Q F L L * L C * R C V S C Y H C E SetI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| NlaIII | ||| | TspEI | ||| | | MseI | ||| | | VspI | ||| | | |TspEI ApoI | ||| | | || MnlI SetI TspEI \ \\\ \ \ \\ \ \ \ ATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGGTCTATCTGGCGAATATAAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGTTATTGTTCCAGCGTACGGTTAATTAATACTCTCCAGATAGACCGCTTATATTTA / / /// // / / SetI | ||FatI || | SetI | |CviAII || TspEI | Cac8I |VspI NlaIII |MseI NspI |MnlI SphI TspEI I S I T R S H A N * L * E V Y L A N I N Y Q * Q G R M P I N Y E R S I W R I * I I N N K V A C Q L I M R G L S G E Y K F ----:----|----:----|----:----|----:----|----:----|----:----| M D I V L D C A L * N H S T * R A F I F * I L L L T A H W N I I L P R D P S Y L Y * Y C P R M G I L * S L D I Q R I Y I AflIII | MaeII | |BtrI | || SetI | || TaiI Tsp4CI* Tsp4CI* | || | TaqI | AlwNI | DdeI EcoRV \ \\ \ \ \ \ \ \ \ TTTTACGCTACACACGTCATCGACATCTAAATATGACAGTCGCTGAACTGTTCTTAGATA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATGCGATGTGTGCAGTAGCTGTAGATTTATACTGTCAGCGACTTGACAAGAATCTAT / / // / / / / / / TspEI | || TaqI | AlwNI Tsp4CI* | EcoRV ApoI | |AflIII Tsp4CI* DdeI | |MaeII | BtrI TaiI SetI F Y A T H V I D I * I * Q S L N C S * I F T L H T S S T S K Y D S R * T V L R Y L R Y T R H R H L N M T V A E L F L D I ----:----|----:----|----:----|----:----|----:----|----:----| K * A V C T M S M * I H C D S F Q E * I N K R * V R * R C R F I V T A S S N K S K V S C V D D V D L Y S L R Q V T R L Y MboI MboII |TspDTI ||DpnI |||TaqI |||BstKTI ||||Hpy178III* ||||| BinI* ||||| | Tsp4CI* FatI ||||| | | Hpy166II |CviAII ||||| | | | SetI || NlaIII ||||| | | | TspEI \\ \ \\\\\ \ \ \ \ TCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAGTAAACCTAATTACAGGAGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTACGATAAATACTTCTTGTTGTCCCTAGCTCTTTGTCATTTGGATTAATGTCCTCTT / // / // /// / / // / | |FatI | || ||| | | |SetI TspEI | CviAII | || ||| | | Hpy166II NlaIII | || ||| | Tsp4CI* | || ||| BinI* | || ||Hpy178III* | || |TaqI | || MboI | |DpnI | BstKTI TspDTI MboII S M L F M K N N R D R E T V N L I T G E P C Y L * R T T G I E K Q * T * L Q E K H A I Y E E Q Q G S R N S K P N Y R R N ----:----|----:----|----:----|----:----|----:----|----:----| D M S N I F F L L S R S V T F R I V P S I W A I * S S C C P D L F L L G L * L L G H * K H L V V P I S F C Y V * N C S F TfiI HinfI | MboII | | TseI | | |BisI | | ||BlsI | | |||AluI | | |||CviJI Hpy188I | | |||| SetI BbvI \ \ \ \\\\ \ \ ATCCGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAATACAACCAAACCCAAAGTTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGCTCACTACTCTTCTTACTAAGAGCGTCGATATGCTTATGTTGGTTTGGGTTTCAAT / // /// / Hpy188I || ||CviJI BbvI || ||TseI || ||AluI || |BisI || BlsI || SetI |MboII HinfI TfiI I R V M R R M I L A A I R I Q P N P K L S E * * E E * F S Q L Y E Y N Q T Q S Y P S D E K N D S R S Y T N T T K P K V I ----:----|----:----|----:----|----:----|----:----|----:----| I R T I L L I I R A A I R I C G F G F N F G L S S F F S E R L * V F V V L G L T D S H H S S H N E C S Y S Y L W V W L * TstI BssKI CviJI EcoRII AluI |SecI* CviJI ||ScrFI | SetI MnlI ||BseBI | | Hpy188I | TspEI ||| CviJI | | |TfiI | | TaqI ||| | SduI | | |HinfI | | AsuII TaqI ||| | HgiJII* \ \ \\ \ \ \ \ \\\ \ \ TAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAAAACAGCCAGGGCTCACAATG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATCGAGCCTTAGGAGTTTTTTGTTTATTAAGCTTTAGCTTTTGTCGGTCCCGAGTGTTAC / / / / / / / / / / //// | | | HinfI MnlI | AsuII | TstI | |||CviJI | | | TfiI | TaqI TaqI | ||EcoRII | | Hpy188I TspEI | ||BssKI | CviJI | ||SecI* | AluI | |HgiJII* SetI | |SduI | BseBI | ScrFI CviJI * L G I L K K Q I I R N R K Q P G L T M S S E S S K N K * F E I E N S Q G S Q C A R N P Q K T N N S K S K T A R A H N V ----:----|----:----|----:----|----:----|----:----|----:----| Y S P I R L F C I I R F R F C G P S V I I A R F G * F V F L E F D F V A L A * L L E S D E F F L Y N S I S F L W P E C H TspGWI TstI | BdaI | BseYI TfiI | BdaI BciVI | | GsaI HinfI | BccI \ \ \ \ \ \ \ TATCCACATCTAATAACTCTCCCAGCACGGACAACGATTCCATCAGTAAATCAACTACTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTGTAGATTATTGAGAGGGTCGTGCCTGTTGCTAAGGTAGTCATTTAGTTGATGAC / / / / // / / | TstI | BseYI || | BccI BciVI GsaI || BdaI || BdaI |TspGWI HinfI TfiI Y P H L I T L P A R T T I P S V N Q L L I H I * * L S Q H G Q R F H Q * I N Y * S T S N N S P S T D N D S I S K S T T E ----:----|----:----|----:----|----:----|----:----|----:----| Y G C R I V R G A R V V I G D T F * S S T D V D L L E G L V S L S E M L L D V V I W M * Y S E W C P C R N W * Y I L * Q XmnI |TfiI DdeI |HinfI TspDTI | Hin4II* TfiI || MfeI |BdaI | | CviJI HinfI || TspEI |BdaI SetI | | HaeIII | SfeI* \\ \ \\ \ \ \ \ \ \ AACCGATTCAATTGAACAATAAGCACGACCTTCATCTTAGGCCAGAAACTTACTGAATCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGCTAAGTTAACTTGTTATTCGTGCTGGAAGTAGAATCCGGTCTTTGAATGACTTAGA / / / // / // / / | | TspEI |BdaI SetI || HaeIII HinfI | | MfeI |BdaI || CviJI TfiI | HinfI TspDTI |DdeI | TfiI Hin4II* XmnI N R F N * T I S T T F I L G Q K L T E S T D S I E Q * A R P S S * A R N L L N L P I Q L N N K H D L H L R P E T Y * I Y ----:----|----:----|----:----|----:----|----:----|----:----| F R N L Q V I L V V K M K P W F S V S D S G I * N F L L C S R * R L G S V * Q I V S E I S C Y A R G E D * A L F K S F R Hpy178III* |TaqI BssKI || TfiI SecI* || MnlI EcoRII || HinfI MslI | ScrFI TspDTI || | Hin4II* Tsp4CI* |Hpy188I | BseBI | SetI || | |Hpy178III* \ \\ \ \ \ \ \\ \ \\ ACAGTAAATCATACTAATCATTCTGATGATGAACTCCCTGGACACCTCCTTCTCGATTCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCATTTAGTATGATTAGTAAGACTACTACTTGAGGGACCTGTGGAGGAAGAGCTAAGT // / ///// // // |SfeI* Hpy188I ||||SetI || |HinfI Tsp4CI* MslI |||TspDTI || |TfiI ||EcoRII || Hin4II* ||BssKI |TaqI |SecI* Hpy178III* BseBI MnlI ScrFI T V N H T N H S D D E L P G H L L L D S Q * I I L I I L M M N S L D T S F S I Q S K S Y * S F * * * T P W T P P S R F R ----:----|----:----|----:----|----:----|----:----|----:----| V T F * V L * E S S S S G P C R R R S E * L L D Y * D N Q H H V G Q V G G E R N C Y I M S I M R I I F E R S V E K E I * PsiI | MboI | BglII SfaNI | XhoII BspCNI Hpy178III* | | DpnI |BseMII | SfaNI | | |BstKTI DdeI || Hpy178III* \ \ \ \ \\ \ \\ \ GGAGCATCACGAACCCTTATAAGATCTGCTCATCACATACACTCAGCATCATCTAATCCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCGTAGTGCTTGGGAATATTCTAGACGAGTAGTGTATGTGAGTCGTAGTAGATTAGGA / / / / // / / // // | | | | || XhoII DdeI || |Hpy178III* | | | | || BglII || SfaNI | | | | || MboI |BseMII | | | | |DpnI BspCNI | | | | BstKTI | | | PsiI | | SfaNI | Hpy178III* Hpy178III* G A S R T L I R S A H H I H S A S S N P E H H E P L * D L L I T Y T Q H H L I L S I T N P Y K I C S S H T L S I I * S * ----:----|----:----|----:----|----:----|----:----|----:----| P A D R V R I L D A * * M C E A D D L G L L M V F G * L I Q E D C V S L M M * D S C * S G K Y S R S M V Y V * C * R I R SfaNI | MaeII MaeIII | | SetI TspEI Tsp45I | | TaiI | MseI BstEII SetI \ \ \ \ \ \ \ GACATAAACGTAGTTGATGCTCAAAAAAGAAATATACCAATTAACGCTATTGGTGACCTA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTATTTGCATCAACTACGAGTTTTTTCTTTATATGGTTAATTGCGATAACCACTGGAT / / // / / | MaeII |MseI | BstEII | SfaNI TspEI | Tsp45I TaiI | MaeIII SetI SetI D I N V V D A Q K R N I P I N A I G D L T * T * L M L K K E I Y Q L T L L V T Y H K R S * C S K K K Y T N * R Y W * P T ----:----|----:----|----:----|----:----|----:----|----:----| S M F T T S A * F L F I G I L A I P S R Q C L R L Q H E F F F Y V L * R * Q H G V Y V Y N I S L F S I Y W N V S N T V * PfoI BssKI EcoRII TspEI | ScrFI SetI | HphI | BseBI | CviRI* \ \ \ \ \ \ CAATTTCACTTCCAGGACAACACCAAAACATCAATAAAGGTATTGCACACTCCTAACATA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAAGTGAAGGTCCTGTTGTGGTTTTGTAGTTATTTCCATAACGTGTGAGGATTGTAT / / / / / / | TspEI | EcoRII SetI CviRI* HphI | BssKI | PfoI BseBI ScrFI Q F H F Q D N T K T S I K V L H T P N I N F T S R T T P K H Q * R Y C T L L T * I S L P G Q H Q N I N K G I A H S * H S ----:----|----:----|----:----|----:----|----:----|----:----| C N * K W S L V L V D I F T N C V G L M V I E S G P C C W F M L L P I A C E * C L K V E L V V G F C * Y L Y Q V S R V Y TspEI |BspCNI ||BseMII ||| TseI ||| CviJI ||| |BisI ||| |SfeI* FatI ||| ||BlsI |CviAII ||| |||CviRI* ||Cac8I ||| |||| PstI ||| SphI ||| |||| | TspDTI ||| NspI CviJI DdeI BbvI ||| |||| | | EcoRV ||| NlaIII \ \ \ \\\ \\\\ \ \ \ \\\ \ GCCTATGACTTACTCAGTTTGAATGAATTGGCTGCAGTAGATATCACAGCATGCTTTACC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGGATACTGAATGAGTCAAACTTACTTAACCGACGTCATCTATAGTGTCGTACGAAATGG / / / // / //// / / / /// CviJI DdeI | || | |||| | EcoRV | ||FatI | || | |||| TspDTI | |CviAII | || | |||| SfeI* | Cac8I | || | |||CviRI* NlaIII | || | |||TseI NspI | || | ||BisI SphI | || | |BlsI | || | |PstI | || | CviJI | || TspEI | |BseMII | BspCNI BbvI A Y D L L S L N E L A A V D I T A C F T P M T Y S V * M N W L Q * I S Q H A L P L * L T Q F E * I G C S R Y H S M L Y Q ----:----|----:----|----:----|----:----|----:----|----:----| A * S K S L K F S N A A T S I V A H K V L R H S V * N S H I P Q L L Y * L M S * G I V * E T Q I F Q S C Y I D C C A K G TatI Tsp4CI* |Csp6I ||RsaI MaeII |||TspRI | SetI |||| CviRI* | TaiI Tsp4CI* |||| | BceAI | |DdeI | Hpy188I |||| | | SetI BsmAI \ \\ \ \ \\\\ \ \ \ \ AAAAACGTCTTAGAACGGTCTGACGGCACTGTACTTGCACCTATCGTAAAATATGGAGAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGCAGAATCTTGCCAGACTGCCGTGACATGAACGTGGATAGCATTTTATACCTCTG / / / / / / / /// // / / | | | | | | | ||| || BceAI BsmAI | | | | | | | ||| |SetI | | | | | | | ||| CviRI* | | | | | | | ||TatI | | | | | | | |Csp6I | | | | | | | RsaI | | | | | | Tsp4CI* | | | | | TspRI | | | | Hpy188I | | | Tsp4CI* | | DdeI | MaeII TaiI SetI K N V L E R S D G T V L A P I V K Y G D K T S * N G L T A L Y L H L S * N M E T K R L R T V * R H C T C T Y R K I W R L ----:----|----:----|----:----|----:----|----:----|----:----| L F T K S R D S P V T S A G I T F Y P S W F R R L V T Q R C Q V Q V * R L I H L F V D * F P R V A S Y K C R D Y F I S V TatI |Csp6I ||RsaI TspGWI Csp6I BsrI BfiI ||ScaI | BccI |RsaI \ \ \\\ \ \ \\ TTTTACTGGGTATCTAAAAAGTACTTGCTTCCATCAAATATCTCCGTACCCACCATCAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATGACCCATAGATTTTTCATGAACGAAGGTAGTTTATAGAGGCATGGGTGGTAGTTA / / /// / / // BsrI BfiI ||TatI TspGWI BccI |Csp6I |Csp6I RsaI ScaI RsaI F Y W V S K K Y L L P S N I S V P T I N F T G Y L K S T C F H Q I S P Y P P S I L L G I * K V L A S I K Y L R T H H Q * ----:----|----:----|----:----|----:----|----:----|----:----| K * Q T D L F Y K S G D F I E T G V M L S K S P I * F T S A E M L Y R R V W W * K V P Y R F L V Q K W * I D G Y G G D I TatI |Csp6I TaqI ||RsaI TspDTI |AlfI BsmI BccI MslI |||Hpy166II | TspDTI |AlfI Cac8I \ \ \\\\ \ \ \\ \ AATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATCCTTTCATTCATCGAATGCTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAGGTATGTTCACTTTCATGTGCGTTTATAGGAATAGGAAAGTAAGTAGCTTACGAA / / /// / / / / / / BccI MslI ||TatI | TspDTI | | | Cac8I |Hpy166II TspDTI | | BsmI |Csp6I | TaqI RsaI AlfI AlfI N V H T S E S T R K Y P Y P F I H R M L M S I Q V K V H A N I L I L S F I E C L C P Y K * K Y T Q I S L S F H S S N A C ----:----|----:----|----:----|----:----|----:----|----:----| L T W V L S L V R L Y G * G K M * R I S Y H G Y L H F Y V C I D K D K * E D F A I D M C T F T C A F I R I R E N M S H K Hin6I |GlaI |MstI* ||FatI ||HhaI |||CviAII MaeII ||||Cac8I |BsaAI ||||| SphI TspEI || SetI ||||| NspI | TaqI || TaiI ||||| NlaIII | | AlfI || BccI ||||| |MslI CviRI* | | AlfI MseI || | MseI \\\\\ \\ \ \ \ \ \ \\ \ \ GCGCATGCCAATGCACAGACAATTCGATACTCACTTAAAAATAACACCATCACGTATTTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTACGGTTACGTGTCTGTTAAGCTATGAGTGAATTTTTATTGTGGTAGTGCATAAAA /// //// / / / / / // / ||| |||MslI CviRI* | TaqI MseI | || BccI ||| ||FatI TspEI | |MaeII ||| |CviAII AlfI | BsaAI ||| Cac8I AlfI TaiI ||NlaIII SetI ||Hin6I ||NspI ||SphI |MstI* |GlaI HhaI A H A N A Q T I R Y S L K N N T I T Y F R M P M H R Q F D T H L K I T P S R I L A C Q C T D N S I L T * K * H H H V F * ----:----|----:----|----:----|----:----|----:----|----:----| A C A L A C V I R Y E S L F L V M V Y K Q A H W H V S L E I S V * F Y C W * T N R M G I C L C N S V * K F I V G D R I K TfiI HinfI | Hpy188I | | SalI | | |TaqI | | |AccI | | ||HindII | | ||Hpy166II | | ||| BsrI Hpy178III* | | ||| |MaeI | MseI \ \ \\\ \\ \ \ AACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATCAATGTCCTGATTGTTTAATC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTAGTCTACAGCTGACCAGATCACGATAACTGATAGTTACAGGACTAACAAATTAG / // /// / / / / MseI || ||| BsrI MaeI | MseI || ||SalI Hpy178III* || |AccI || |TaqI || Hpy166II || HindII |Hpy188I HinfI TfiI N E S D V D W S S A I D Y Q C P D C L I T N Q M S T G L V L L T I N V L I V * S R I R C R L V * C Y * L S M S * L F N R ----:----|----:----|----:----|----:----|----:----|----:----| L S D S T S Q D L A I S * * H G S Q K I * R I L H R S T * H * Q S D I D Q N N L V F * I D V P R T S N V I L T R I T * D SetI |Hpy166II ||Hpy178III* ApoI ||| TspDTI TspEI \\\ \ \ GGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGACTAAAATACCAAAATTCATAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTTTCGTGGTTTGTGTCTGTATAGTTTCCAAGTGCTGATTTTATGGTTTTAAGTATG / / / / / SetI | | TspDTI TspEI | Hpy178III* ApoI Hpy166II G K S T K H R H I K G S R L K Y Q N S Y A K A P N T D I S K V H D * N T K I H T Q K H Q T Q T Y Q R F T T K I P K F I R ----:----|----:----|----:----|----:----|----:----|----:----| P L L V L C L C I L P E R S F Y W F E Y R C F C W V C V Y * L N V V L I G F N M A F A G F V S M D F T * S * F V L I * V AsuI* AvaII |BmgT120I || Hpy166II || | SetI XmnI SetI || BsrI | |FokI ApaLI \ \ \\ \ \ \\ \ GAACCCTTTCAATACCTACATACTGACATATTTGGTCCAGTTCACAACCTACCAAAAAGT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGGAAAGTTATGGATGTATGACTGTATAAACCAGGTCAAGTGTTGGATGGTTTTTCA / / /// / / / / XmnI SetI ||| | SetI | HgiAI* ||| Hpy166II | BseSI ||AvaII | SduI ||AsuI* FokI |BmgT120I BsrI E P F Q Y L H T D I F G P V H N L P K S N P F N T Y I L T Y L V Q F T T Y Q K V T L S I P T Y * H I W S S S Q P T K K C ----:----|----:----|----:----|----:----|----:----|----:----| S G K * Y R C V S M N P G T * L R G F L R V R E I G V Y Q C I Q D L E C G V L F F G K L V * M S V Y K T W N V V * W F T CviRI* Hpy166II | SduI | BseSI | TspDTI TspGWI | HgiAI* | ApoI | |BseGI BccI BsmAI | TspEI \ \\ \ \ \ \ GCACCATCCTATTTCATCTCATTTACTGATGAGACAACAAAATTCCGTTGGGTTTATCCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTAGGATAAAGTAGAGTAAATGACTACTCTGTTGTTTTAAGGCAACCCAAATAGGT /// / / / / ||ApaLI BccI | TspGWI TspEI |BseGI BsmAI ApoI Hpy166II CviRI* TspDTI A P S Y F I S F T D E T T K F R W V Y P H H P I S S H L L M R Q Q N S V G F I H T I L F H L I Y * * D N K I P L G L S I ----:----|----:----|----:----|----:----|----:----|----:----| A G D * K M E N V S S V V F N R Q T * G H V M R N * R M * Q H S L L I G N P K D C W G I E D * K S I L C C F E T P N I W MnlI McrI* |Tsp4CI* || MlyI || PleI || Hpy178III* || |NruI || |Hpy99I MaeI || |FnuDII* | AluI || ||BsiYI* | CviJI || ||| HinfI TaqI MnlI | | SetI MseI \\ \\\ \ \ \ \ \ \ \ TTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTACTACGATACTAGCTTTTATT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTGCTGGCAGCGCTCCTGAGATAGGAGCTACAAAAATGATGCTATGATCGAAAATAA /// //// / / / /// ||| |||| HinfI TaqI MnlI ||CviJI ||| |||Hpy178III* ||AluI ||| ||FnuDII* |MaeI ||| ||NruI SetI ||| ||PleI ||| |MlyI ||| BsiYI* ||Tsp4CI* ||Hpy99I |MnlI McrI* L H D R R E D S I L D V F T T I L A F I Y T T V A R T L S S M F L L R Y * L L L T R P S R G L Y P R C F Y Y D T S F Y * ----:----|----:----|----:----|----:----|----:----|----:----| N C S R R S S E I R S T K V V I S A K I M V R G D R P S * G R H K * * S V L K * * V V T A L V R D E I N K S R Y * S K N AsuI* AvaII |BmgT120I ||BseMII |||SecI* |||DsaI* |||BspCNI ||||Tsp4CI* BsiYI* ||||| DdeI | TsoI ||||| |Hpy188I | CviJI ||||| || AccI | HaeIII TspRI ||||| || |BssNAI BsrI | |BsrI BstXI ||||| || |Hpy166II \ \ \\ \ \\\\\ \\ \\ AAGAACCAGTTTCAGGCCAGTGTCTTGGTTATACAAATGGACCGTGGTTCTGAGTATACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTGGTCAAAGTCCGGTCACAGAACCAATATGTTTACCTGGCACCAAGACTCATATGA / / / /// / //// / / / // | BsrI | ||| BstXI |||| | | | |AccI MseI | ||HaeIII |||| | | | Hpy166II | ||CviJI |||| | | | BssNAI | |TspRI |||| | | DdeI | |BsrI |||| | Hpy188I | TsoI |||| DsaI* BsiYI* |||| SecI* |||Tsp4CI* |||AvaII |||AsuI* ||BmgT120I |BspCNI BseMII K N Q F Q A S V L V I Q M D R G S E Y T R T S F R P V S W L Y K W T V V L S I L E P V S G Q C L G Y T N G P W F * V Y * ----:----|----:----|----:----|----:----|----:----|----:----| L F W N * A L T K T I C I S R P E S Y V * S G T E P W H R P * V F P G H N Q T Y L V L K L G T D Q N Y L H V T T R L I S FatI ApoI |CviAII TspEI || NlaIII \ \\ \ AACAGAACTCTCCATAAATTCCTTGAAAAAAATGGTATAACTCCATGCTATACAACCACA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTTGAGAGGTATTTAAGGAACTTTTTTTACCATATTGAGGTACGATATGTTGGTGT / / // TspEI | |FatI ApoI | CviAII NlaIII N R T L H K F L E K N G I T P C Y T T T T E L S I N S L K K M V * L H A I Q P Q Q N S P * I P * K K W Y N S M L Y N H S ----:----|----:----|----:----|----:----|----:----|----:----| L L V R W L N R S F F P I V G H * V V V * C F E G Y I G Q F F H Y L E M S Y L W V S S E M F E K F F I T Y S W A I C G C AciI NspBII* | TfiI | HinfI | | AvaI | | Hpy178III* | | |BmeT110I | | || FatI Tsp4CI* | | || SduI |Csp6I | | || HgiAI* ||RsaI | | || |CviAII PleI ||| BceAI | | || || NlaIII |MlyI ||| | SetI | | || || |HinfI || CviJI ||| | BceAI \ \ \\ \\ \\ \\ \ \\\ \ \ GCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTCAACCGTACCTTATTAGATGACTGC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTAAGGGCTCGTGTACCTCAGCGACTTGCCGAGTTGGCATGGAATAATCTACTGACG / / / /// / // / / / / // / / | | | ||| | || HinfI | CviJI | || | BceAI | | | ||| | |FatI PleI | || BceAI | | | ||| | CviAII MlyI | |Csp6I | | | ||| NlaIII | RsaI | | | ||AvaI | SetI | | | |BmeT110I Tsp4CI* | | | |HgiAI* | | | |SduI | | | Hpy178III* | | HinfI | | TfiI | AciI NspBII* A D S R A H G V A E R L N R T L L D D C R I P E H M E S L N G S T V P Y * M T A G F P S T W S R * T A Q P Y L I R * L P ----:----|----:----|----:----|----:----|----:----|----:----| A S E R A C P T A S R S L R V K N S S Q L P N G L V H L R Q V A * G Y R I L H S R I G S C M S D S F P E V T G * * I V A CviRI* | TaqI Csp6I | | ApoI |RsaI CviRI* BsrDI Hpy166II | | TspEI \\ \ \ \ \ \ \ CGTACTCAACTGCAATGTAGTGGTTTACCGAACCATTTATGGTTCTCTGCAATCGAATTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GCATGAGTTGACGTTACATCACCAAATGGCTTGGTAAATACCAAGAGACGTTAGCTTAAA // / / / / / / |Csp6I | BsrDI Hpy166II | | TspEI RsaI CviRI* | | ApoI | TaqI CviRI* R T Q L Q C S G L P N H L W F S A I E F V L N C N V V V Y R T I Y G S L Q S N F Y S T A M * W F T E P F M V L C N R I F ----:----|----:----|----:----|----:----|----:----|----:----| R V * S C H L P K G F W K H N E A I S N G Y E V A I Y H N V S G N I T R Q L R I T S L Q L T T T * R V M * P E R C D F K ApoI TspEI | HphI | | MaeI | | | AluI | | | CviJI FatI | | | | SetI SetI CviRI* |CviAII \ \ \ \ \ \ \ \\ TCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCAAAAAATCTGCAAGACAACAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGATAACACTCTTTAAGTGATCGAAGTGGATTTTCGTTTTTTAGACGTTCTGTTGTA / /// / / / / | ||| SetI CviRI* | CviAII | ||CviJI | Hin4I | ||AluI | Hin4I | |MaeI NlaIII | SetI NspI TspEI ApoI HphI S T I V R N S L A S P K S K K S A R Q H L L L * E I H * L H L K A K N L Q D N M Y Y C E K F T S F T * K Q K I C K T T C ----:----|----:----|----:----|----:----|----:----|----:----| E V I T L F E S A E G L L L F D A L C C K * * Q S F N V L K V * F C F I Q L V V R S N H S I * * S * R F A F F R C S L M EcoRV | TatI | |Csp6I NspI | ||RsaI NlaIII | ||ScaI | Cac8I | ||| TaqII | | Hin4I | ||| |MaeIII | | Hin4I | ||| || Hin4I HindII | | CviJI | ||| || Hin4I Hpy166II | | | MwoI | ||| || | SetI | SetI \ \ \ \ \ \\\ \\ \ \ \ \ GCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTTTCGGTCAACCTGTTATCGTC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCGAACCGTCCTGAACTATAGTCATGAAACAATGGAAAGCCAGTTGGACAATAGCAG / /// / /// / / / // / | ||CviJI EcoRV ||| | | MaeIII |SetI BsaXI | |MwoI ||| | SetI Hpy166II | Cac8I ||| Hin4I HindII FatI ||| Hin4I ||TaqII ||TatI |Csp6I ScaI RsaI A G L A G L D I S T L L P F G Q P V I V L A W Q D L I S V L C Y L S V N L L S S W L G R T * Y Q Y F V T F R S T C Y R Q ----:----|----:----|----:----|----:----|----:----|----:----| A P K A P S S I L V K N G K P * G T I T H Q S P L V Q Y * Y K T V K R D V Q * R S A Q C S K I D T S Q * R E T L R N D D BseGI | MnlI | |BssKI | |SecI* | |EcoRII | || FokI | || MwoI BsaXI FokI | || ScrFI | MboI | BseGI | || BseBI | BclI | | BsaXI | || | CviJI | | DpnI | | |MslI | || | SfaNI | | |BstKTI FokI | | |BsiI* | || | | TspGWI BseGI \ \ \\ \ \ \ \\ \ \\ \ \ \ \ AATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCATCCCAGGCTACGCTCTACAT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTAGTGTTGGGATTGAGGTTTTATGTAGGAGCACCGTAGGGTCCGATGCGAGATGTA // / / / // / / // //// / / || BclI FokI | || | | || |||| | BseGI || MboI | || | | || |||| SfaNI |DpnI | || | | || |||TspGWI BstKTI | || | | || |||FokI | || | | || ||EcoRII | || | | || ||BssKI | || | | || ||CviJI | || | | || |SecI* | || | | || BseBI | || | | || ScrFI | || | | |MwoI | || | | MnlI | || | BsiI* | || | BseGI | || MslI | |FokI | BsaXI BseGI N D H N P N S K I H P R G I P G Y A L H M I T T L T P K Y I L V A S Q A T L Y I * S Q P * L Q N T S S W H P R L R S T S ----:----|----:----|----:----|----:----|----:----|----:----| L S * L G L E L I C G R P M G P * A R C * H D C G * S W F V D E H C G L S R E V I I V V R V G F Y M R T A D W A V S * M Hpy178III* |TaqI || BsmAI MseI || Esp3I Hin4I Tsp4CI* || | Hin4I FokI Hin4I |BbvII* || | Hin4I |MboII BseGI | BccI || MboII \\ \ \ \\ \ \ \ \\ \ CCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCATCCTTAAAGAAGACAGTAGAT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAGAGCTTTGAGAATACCTATATAGTAGATAGAAGGTAGGAATTTCTTCTGTCATCTA /// / / / / / // / / ||| Esp3I | FokI | Hin4I |BccI | BbvII* ||| BsmAI MboII | Hin4I MseI | MboII ||TaqI BseGI Tsp4CI* |Hpy178III* Hin4I Hin4I P S R N S Y G Y I I Y L P S L K K T V D R L E T L M D I S S I F H P * R R Q * I V S K L L W I Y H L S S I L K E D S R Y ----:----|----:----|----:----|----:----|----:----|----:----| G D R F E * P Y I M * R G D K F F V T S D T E F S K H I Y * R D E M R L S S L L R R S V R I S I D D I K W G * L L C Y I TfiI HinfI | Hpy178III* | | MboI | | | DpnI Eco57I | | | |BstKTI Eco57MI | | | ||TspEI | MboII | | | ||| TspEI \ \ \ \ \ \\\ \ ACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGATTAGATCAATTCAATTACGAC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGATTGATACAATAAGAAGTCCCGTTCCTTAGGTCTAATCTAGTTAAGTTAATGCTG / / / / // / / // | MboII | | || | | |Hpy99I Eco57MI | | || | | TspEI Eco57I | | || | TspEI | | || MboI | | |DpnI | | BstKTI | Hpy178III* HinfI TfiI T T N Y V I L Q G K E S R L D Q F N Y D Q L T M L F F R A R N P D * I N S I T T N * L C Y S S G Q G I Q I R S I Q L R R ----:----|----:----|----:----|----:----|----:----|----:----| V V L * T I R * P L S D L N S * N L * S Y L * S H * E E P C P I W I L D I * N R C S V I N N K L A L F G S * I L E I V V MseI |BbvII* || MboII Hpy99I || Tsp4CI* | HgaI || |TspDTI TspDTI | | TaqI || || MseI | HgaI BsrDI \ \ \ \\ \\ \ \ \ \ GCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTTCATATCAATCGTTCATTGCG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGAGTGAAAGCTACTTCTGAATTTGGCAAATTGACGAAGTATAGTTAGCAAGTAACGC // / / / / // |TaqI | | MseI TspDTI |HgaI HgaI | Tsp4CI* BsrDI | TspDTI | BbvII* | MboII MseI A L T F D E D L N R L T A S Y Q S F I A H S L S M K T * T V * L L H I N R S L R T H F R * R L K P F N C F I S I V H C V ----:----|----:----|----:----|----:----|----:----|----:----| A S V K S S S K F R K V A E Y * D N M A R V * K R H L S L G N L Q K M D I T * Q C E S E I F V * V T * S S * I L R E N R MmeI |TfiI |HinfI || Hin4I BinI* Hpy188I || Hin4I | MboI | MboI || | Hpy188I | XhoII | | DpnI || | | FatI | | DpnI | | |BstKTI || | | |CviAII FokI | | |BstKTI | | || MseI || | | || NlaIII |Hpy188I \ \ \\ \ \ \\ \ \\ \ \ \\ \ \\ TCAAATGAGATCCAACAATCCGATGATCTTAACATAGAATCTGACCATGACTTCCAATCT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTACTCTAGGTTGTTAGGCTACTAGAATTGTATCTTAGACTGGTACTGAAGGTTAGA / // / / // / / // // / // / | || XhoII | || | | || || | |FatI Hpy188I | || MboI | || | | || || | CviAII | |DpnI | || | | || || NlaIII | BstKTI | || | | || |Hpy188I BinI* | || | | || HinfI | || | | || TfiI | || | | |Hin4I | || | | |Hin4I | || | | MmeI | || | MseI | || MboI | |DpnI | BstKTI Hpy188I S N E I Q Q S D D L N I E S D H D F Q S Q M R S N N P M I L T * N L T M T S N L K * D P T I R * S * H R I * P * L P I * ----:----|----:----|----:----|----:----|----:----|----:----| D F S I W C D S S R L M S D S W S K W D T L H S G V I R H D * C L I Q G H S G I * I L D L L G I I K V Y F R V M V E L R TaqI | BseMII | |BspCNI | || BseGI | || Hin4I | || Hin4I AluI | || | Hpy178III* CviJI | || | |DdeI | SetI PleI | || | |Bpu10I | | HinfI |MlyI \ \\ \ \\ \ \ \ \\ GACATCGAACTACATCCTGAGCAACCGAGAAATGTCCTTTCAAAAGCTGTGAGTCCAACC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAGCTTGATGTAGGACTCGTTGGCTCTTTACAGGAAAGTTTTCGACACTCAGGTTGG / // / / / / / / / | || BseGI | Bpu10I | CviJI HinfI TspGWI | |BspCNI | DdeI | AluI PleI | |Hin4I Hpy178III* SetI MlyI | |Hin4I | |TaqI | BseMII FokI D I E L H P E Q P R N V L S K A V S P T T S N Y I L S N R E M S F Q K L * V Q P H R T T S * A T E K C P F K S C E S N R ----:----|----:----|----:----|----:----|----:----|----:----| S M S S C G S C G L F T R E F A T L G V Q C R V V D Q A V S F H G K L L Q S D L V D F * M R L L R S I D K * F S H T W G TfiI HinfI | TaqI | AsuII | | MaeII HindII | | AflIII TfiI Hpy166II | | |MboII HinfI | MmeI | | || SetI Eco57I |TspGWI SetI | |MnlI | | || TaiI Eco57MI SspI \\ \ \ \\ \ \ \\ \ \ \ GATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAACGTGTTTCTAAAACCAATATT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGGTGTGGAGGCAGTTGAGTATGACTTCTAAGCTTTGCACAAAGATTTTGGTTATAA / / / / / / // / / / / | SetI | MnlI | | || | | Eco57MI SspI HinfI Hpy166II | | || | | Eco57I TfiI HindII | | || | AflIII MmeI | | || MaeII | | |MboII | | TaiI | | SetI | AsuII | TaqI HinfI TfiI D S T P P S T H T E D S K R V S K T N I I P H L R Q L I L K I R N V F L K P I F F H T S V N S Y * R F E T C F * N Q Y S ----:----|----:----|----:----|----:----|----:----|----:----| S E V G G D V * V S S E F R T E L V L I R N W V E T L E Y Q L N S V H K * F W Y I G C R R * S M S F I R F T N R F G I N Hpy188I Hin6I |TfiI FnuDII* HindII |HinfI |GlaI Hpy166II || MboII Ksp632I* ||HhaI | TaqII || | SspI | BccI \\\ \ \ \\ \ \ \ \ CGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTAATATTCTTCCATCAAAGAAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCGTGGGTCTCTTCAACTGGGGTTGTATAGACTTAGATTATAAGAAGGTAGTTTCTTC /// // / // / / / ||Hin6I |TaqII | || SspI | BccI |GlaI Hpy166II | |HinfI Ksp632I* FnuDII* HindII | |TfiI HhaI | MboII Hpy188I R A P R E V D P N I S E S N I L P S K K A H P E K L T P T Y L N L I F F H Q R R R T Q R S * P Q H I * I * Y S S I K E E ----:----|----:----|----:----|----:----|----:----|----:----| R A G L S T S G L M D S D L I R G D F F E R V W L L Q G W C I Q I * Y E E M L S A C G S F N V G V Y R F R I N K W * L L TaqI MboI |Hpy178III* BglII || Csp6I XhoII || |RsaI | DpnI || ||AgeI CviRI* | |BstKTI || ||BetI* | PpiI | ||MaeI ApoI || ||Cfr10I | EcoT22I | ||| MboII TspEI PpiI || |||HpaII | | TspEI \ \\\ \ \ \ \\ \\\\ \ \ \ AGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCGGTTCGGGTGGTATGCATAAA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGATCGTGGGGGGTTTAAAGGTTATAGCTCTCATGGCCAAGCCCACCATACGTATTT // / // / / // // // // / || | |MboII | TspEI || || |Cfr10I || CviRI* || | MaeI | ApoI || || |BetI* |EcoT22I || XhoII PpiI || || |AgeI PpiI || BglII || || HpaII || MboI || |Csp6I |DpnI || RsaI BstKTI |Hpy178III* TaqI R S S T P Q I S N I E S T G S G G M H K D L A P P K F P I S R V P V R V V C I N I * H P P N F Q Y R E Y R F G W Y A * I ----:----|----:----|----:----|----:----|----:----|----:----| L D L V G W I E L I S L V P E P P I C L S I * C G G F K W Y R S Y R N P H Y A Y S R A G G L N G I D L T G T R T T H M F PleI FatI Hpy99I FatI |CviAII |MlyI |CviAII || HinfI ||Cac8I MseI BslFI || NlaIII || NlaIII ||| BsrI \ \ \\ \ \\ \ \\\ \ TTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACACACATGAGTCGTCGCACGCC 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTACAAGGAAATGAACGAGGGTACAGGGTTAGATTGTGTGTACTCAGCAGCGTGCGG // / / // / // / /// |MseI BslFI | |FatI | || | ||BsrI TspEI | CviAII | || | |Cac8I NlaIII | || | PleI | || | MlyI | || Hpy99I | || HinfI | |FatI | CviAII NlaIII L N V P L L A P M S Q S N T H E S S H A * M F L Y L L P C P N L T H M S R R T P K C S F T C S H V P I * H T * V V A R Q ----:----|----:----|----:----|----:----|----:----|----:----| N F T G K S A G M D W D L V C S D D C A I L H E K V Q E W T G I * C V H T T A R * I N R * K S G H G L R V C M L R R V G Hpy188I | MlyI | PleI | | DdeI | | | Hpy188I | | | |HinfI | | | || Csp6I | | | || |BdaI | | | || |BdaI | | | || |RsaI | | | || || BspCNI | | | || || Tsp4CI* | | | || || |BseMII | | | || || || BsmAI | | | || || || | TspRI | | | || || || | | BaeI \ \ \ \\ \\ \\ \ \ \ AGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTGAAAATGAGACTAATCATACA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTAGATTTCTAAAGTCTGTGAGTCTGAGCATGTCACTTTTACTCTGATTAGTATGT / // // ////// / / | || || |||||| | BsmAI | || || |||||| BaeI | || || |||||Tsp4CI* | || || |||||BseMII | || || ||||BspCNI | || || ||||Csp6I | || || |||RsaI | || || ||TspRI | || || |BdaI | || || |BdaI | || || HinfI | || |DdeI | || Hpy188I | |PleI | MlyI Hpy188I S K S K D F R H S D S Y S E N E T N H T V N L K I S D T Q T R T V K M R L I I Q * I * R F Q T L R L V Q * K * D * S Y K ----:----|----:----|----:----|----:----|----:----|----:----| L L D L S K L C E S E Y L S F S V L * V W Y I * L N * V S L S T C H F H S * D Y T F R F I E S V * V R V T F I L S I M C MaeII | Csp6I Acc65I | |RsaI HgiCI* MaeIII | |SetI BsrI |Csp6I Tsp45I | |TaiI | Csp6I ||RsaI | BsmAI | || BdaI | |RsaI ||NlaIV Tsp4CI* | |BseMII | || BdaI | || BaeI ||| KpnI | AciI | ||BspCNI \ \\ \ \ \\ \ \\\ \ \ \ \ \\\ AACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAACTGTTCCGCAGATAAGTGAC 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCATGGTTATAGGTCATGCCCACCATGGTTGTTGTTTTGACAAGGCGTCTATTCACTG / /// / / // / /// / / // / | ||Csp6I | | |Csp6I | ||HgiCI* | AciI || Tsp45I | ||BdaI | | RsaI | ||Acc65I Tsp4CI* || MaeIII | ||BdaI | BaeI | |Csp6I |BspCNI | |RsaI BsrI | NlaIV BseMII | MaeII | RsaI TaiI KpnI SetI N V P I S S T G G T N N K T V P Q I S D T Y Q Y P V R V V P T T K L F R R * V T R T N I Q Y G W Y Q Q Q N C S A D K * P ----:----|----:----|----:----|----:----|----:----|----:----| F T G I D L V P P V L L L V T G C I L S L R V L I W Y P H Y W C C F Q E A S L H V Y W Y G T R T T G V V F S N R L Y T V Tsp4CI* BtgZI | Hpy166II TaqI |BetI* | | SfaNI ClaI ||HpaII DdeI HphI | | | SetI | Hin4II* |||TspDTI \ \ \ \ \ \ \ \ \\\\ CAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAATCGATGCTTCTCCACCGGAA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTGACTCTTTTCCTAATATGTGGCAAGTGGAAGTTAGCTACGAAGAGGTGGCCTT / / / / // / / / // BsmAI DdeI HphI | |SetI SfaNI Hin4II* | |BetI* | Hpy166II ClaI | HpaII Tsp4CI* TaqI | BtgZI TspDTI Q E T E K R I I H R S P S I D A S P P E K R L R K G L Y T V H L Q S M L L H R K R D * E K D Y T P F T F N R C F S T G K ----:----|----:----|----:----|----:----|----:----|----:----| W S V S F L I I C R E G E I S A E G G S G L S Q S F S * V G N V K L R H K E V P L L S L F P N Y V T * R * D I S R W R F Tsp4CI* | Hpy188I | | MnlI TspEI SspI AjuI | | | BtgZI \ \ \ \ \ \ \ AATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAACTACTGTTTCTGAACAGAAT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTAAGTAGCGTGTTATAACAAGGATAGTTTTGCGGTTGATGACAAAGACTTGTCTTA / / / / / // TspEI SspI AjuI | | |AjuI | | MnlI | Hpy188I Tsp4CI* N N S S H N I V P I K T P T T V S E Q N I I H R T I L F L S K R Q L L F L N R I * F I A Q Y C S Y Q N A N Y C F * T E Y ----:----|----:----|----:----|----:----|----:----|----:----| F L E D C L I T G I L V G V V T E S C F F Y N M A C Y Q E * * F A L * Q K Q V S I I * R V I N N R D F R W S S N R F L I MboI | DpnI | |BstKTI | || GsuI | || Eco57MI | || | MboI | || | | DpnI | || | | |BstKTI | || | | || SetI AjuI | || | | || |Hpy178III* SecI* | || | | || || TfiI | TfiI | || | | || || HinfI | HinfI | || | | || || | MnlI \ \ \ \\ \ \ \\ \\ \ \ ACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATCTACCTCCAGAATCTCCTACC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCTCCTTAGATAGTAGCGACTAGAGGGTGAGGGACTAGATGGAGGTCTTAGAGGATGG / / / // / / // // / / | | HinfI || | Eco57MI || |SetI | HinfI | | TfiI || | GsuI || MboI | MnlI | SecI* || MboI |DpnI | TfiI BtgZI |DpnI BstKTI Hpy178III* BstKTI T E E S I I A D L P L P D L P P E S P T P R N L S S L I S H S L I Y L Q N L L P R G I Y H R * S P T P * S T S R I S Y R ----:----|----:----|----:----|----:----|----:----|----:----| V S S D I M A S R G S G S R G G S D G V Y R P I * * R Q D G V G Q D V E L I E * G L F R D D S I E W E R I * R W F R R G MboI TspEI ApoI MseI | DpnI |TaqII TspEI |AhaIII* | |BstKTI || BsrI EcoRI || Hin4I | ||TspEI || Hin4I \ \\ \ \ \\\ \\ \ GAATTCCCTGACCCATTTAAAGAACTCCCACCGATCAATTCTCGTCAAACTAATTCCAGT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAGGGACTGGGTAAATTTCTTGAGGGTGGCTAGTTAAGAGCAGTTTGATTAAGGTCA / // // / / // // EcoRI |Hin4I || | TspEI || |TspEI TspEI |MseI || MboI || BsrI ApoI AhaIII* |DpnI |Hin4I BstKTI TaqII E F P D P F K E L P P I N S R Q T N S S N S L T H L K N S H R S I L V K L I P V I P * P I * R T P T D Q F S S N * F Q F ----:----|----:----|----:----|----:----|----:----|----:----| S N G S G N L S S G G I L E R * V L E L R I G Q G M * L V G V S * N E D F * N W F E R V W K F F E W R D I R T L S I G T MlyI PleI | MaeIII MboI | Tsp45I | DpnI | | HinfI HphI Tsp4CI* | |BstKTI \ \ \ \ \ \ \\ TTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCAACAGTAAGAAAAGATCATTA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCACCATAACCACTGAGATTACGGATATGATGATAGTTGTCATTCTTTTCTAGTAAT // // / / // / |PleI || HphI Tsp4CI* || MboI MlyI |HinfI |DpnI Tsp45I BstKTI MaeIII L G G I G D S N A Y T T I N S K K R S L W V V L V T L M P I L L S T V R K D H * G W Y W * L * C L Y Y Y Q Q * E K I I R ----:----|----:----|----:----|----:----|----:----|----:----| K P P I P S E L A * V V I L L L F L D N N P H Y Q H S * H R Y * * * C Y S F I M Q T T N T V R I G I S S D V T L F S * * MboII | TspEI | | MseI | | | TspDTI | | | | SetI | | | | BsmAI | | | | | BsiI* | | | | | Hpy178III* | | | | | | FatI | | | | | | |CviAII | | | | | | || NlaIII | | | | | | || | DdeI \ \ \ \ \ \ \\ \ \ GAAGATAATGAAACTGAAATTAAGGTATCACGAGACACATGGAATACTAAGAATATGCGT 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTATTACTTTGACTTTAATTCCATAGTGCTCTGTGTACCTTATGATTCTTATACGCA / // // / / // / MboII |MseI || | | |FatI DdeI |SetI || | | CviAII TspDTI || | NlaIII TspEI || BsiI* |Hpy178III* BsmAI E D N E T E I K V S R D T W N T K N M R K I M K L K L R Y H E T H G I L R I C V R * * N * N * G I T R H M E Y * E Y A * ----:----|----:----|----:----|----:----|----:----|----:----| S S L S V S I L T D R S V H F V L F I R L L Y H F Q F * P I V L C M S Y * S Y A F I I F S F N L Y * S V C P I S L I H T SetI | Hpy188I TseI | | MboI CviRI* | | | DpnI |BisI | | | |TaqI ||BlsI | | | |BstKTI |||AluI | | | || HphI |||CviJI | | | || | ApoI |||PvuII | | | || | TspEI |||NspBII* | | | || | EcoRI |||| SetI | | | || | | MboII |||| | MwoI | | | ||MnlI | | | SetI |||| | | BbvI \ \ \ \\\ \ \ \ \ \\\\ \ \ \ AGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTAAAAGCAGTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAATCTTGGAGGCTCTAGCTTCTTTGCTTAAGTGGACTAACGTCGACATTTTCGTCAT / / ///// / /// //// / / SetI | ||||| HphI ||SetI |||| MwoI BbvI | ||||TaqI |EcoRI |||NspBII* | |||MboI |TspEI |||PvuII | ||MnlI |ApoI |||CviJI | |DpnI MboII |||TseI | BstKTI |||AluI Hpy188I ||BisI |BlsI |SetI CviRI* S L E P P R S K K R I H L I A A V K A V V * N L R D R R N E F T * L Q L * K Q * F R T S E I E E T N S P D C S C K S S K ----:----|----:----|----:----|----:----|----:----|----:----| L K S G G L D F F R I * R I A A T F A T Y N L V E S I S S V F E G S Q L Q L L L T * F R R S R L F S N V Q N C S Y F C Y MnlI TspGWI SetI | HphI SetI \ \ \ \ AAATCAATCAAACCAATACGGACAACCTTACGATACGATGAGGCAATCACCTATAATAAA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTTAGTTTGGTTATGCCTGTTGGAATGCTATGCTACTCCGTTAGTGGATATTATTT / // / / SetI |MnlI HphI SetI TspGWI K S I K P I R T T L R Y D E A I T Y N K N Q S N Q Y G Q P Y D T M R Q S P I I K I N Q T N T D N L T I R * G N H L * * R ----:----|----:----|----:----|----:----|----:----|----:----| F D I L G I R V V K R Y S S A I V * L L L I L * V L V S L R V I R H P L * R Y Y F * D F W Y P C G * S V I L C D G I I F MseI MnlI TaqI Tsp4CI* \ \ \ \ GATATTAAAGAAAAAGAAAAATATATCGAGGCATACCACAAAGAAGTCAATCAACTGTTG 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAATTTCTTTTTCTTTTTATATAGCTCCGTATGGTGTTTCTTCAGTTAGTTGACAAC / / / / MseI MnlI TaqI Tsp4CI* D I K E K E K Y I E A Y H K E V N Q L L I L K K K K N I S R H T T K K S I N C * Y * R K R K I Y R G I P Q R S Q S T V E ----:----|----:----|----:----|----:----|----:----|----:----| S I L S F S F Y I S A Y W L S T L * S N L Y * L F L F I Y R P M G C L L * D V T I N F F F F F I D L C V V F F D I L Q Q TspDTI | TspRI | | SspI MboII | | BslFI \ \ \ \ AAGATGAAAACTTGGGACACTGACGAATATTATGACAGAAAAGAAATAGACCCTAAAAGA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACTTTTGAACCCTGTGACTGCTTATAATACTGTCTTTTCTTTATCTGGGATTTTCT / / / / / | | TspDTI | BslFI | TspRI SspI MboII K M K T W D T D E Y Y D R K E I D P K R R * K L G T L T N I M T E K K * T L K E D E N L G H * R I L * Q K R N R P * K S ----:----|----:----|----:----|----:----|----:----|----:----| F I F V Q S V S S Y * S L F S I S G L L S S S F K P C Q R I N H C F L F L G * F L H F S P V S V F I I V S F F Y V R F S MaeII |MaeIII |Tsp45I || SetI || TaiI AluI || | Tsp4CI* CviJI BdaI || | |Csp6I |MaeI BdaI MboII BdaI || | ||RsaI ||SetI BdaI \ \ \\ \ \\\ \\\ \ GTAATAAACTCAATGTTTATCTTCAACAAGAAACGTGACGGTACTCATAAAGCTAGATTT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CATTATTTGAGTTACAAATAGAAGTTGTTCTTTGCACTGCCATGAGTATTTCGATCTAAA / / / / / // / / / / / MboII BdaI | | | |Csp6I | | | | MnlI BdaI | | | RsaI | | | BdaI | | Tsp4CI* | | | BdaI | | Tsp45I | | MaeI | | MaeIII | CviJI | MaeII | AluI TaiI SetI SetI V I N S M F I F N K K R D G T H K A R F * * T Q C L S S T R N V T V L I K L D L N K L N V Y L Q Q E T * R Y S * S * I C ----:----|----:----|----:----|----:----|----:----|----:----| T I F E I N I K L L F R S P V * L A L N L L L S L T * R * C S V H R Y E Y L * I Y Y V * H K D E V L F T V T S M F S S K FatI |CviAII ||Cac8I BseGI ||| SphI |HphI ||| NspI MnlI || Hpy178III* ||| CviRI* | CviRI* || | SfaNI ||| NlaIII | | FokI || | |MlyI HinfI ||| | BspCNI | | | SetI || | |PleI | DdeI ||| | |BseMII Tsp4CI* \ \ \ \ \\ \ \\ \ \ \\\ \ \\ \ GTTGCAAGAGGTGATATTCAGCATCCTGACACTTACGACTCAGGCATGCAATCCAATACC 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGTTCTCCACTATAAGTCGTAGGACTGTGAATGCTGAGTCCGTACGTTAGGTTATGG / / / / / / // / / / / /// // / | | FokI | HphI | || SfaNI | | | ||| |BseMII Tsp4CI* | SetI BseGI | |PleI | | | ||| BspCNI CviRI* | MlyI | | | ||CviRI* Hpy178III* | | | ||FatI | | | |CviAII | | | Cac8I | | NlaIII | | NspI | | SphI | DdeI HinfI V A R G D I Q H P D T Y D S G M Q S N T L Q E V I F S I L T L T T Q A C N P I P C K R * Y S A S * H L R L R H A I Q Y R ----:----|----:----|----:----|----:----|----:----|----:----| T A L P S I * C G S V * S E P M C D L V Q Q L L H Y E A D Q C K R S L C A I W Y N C S T I N L M R V S V V * A H L G I G MslI |FokI || CviRI* || | EcoT22I || | | BseGI || | | | DrdI Csp6I || | |MseI | | MaeIII |RsaI || | |VspI | | Tsp45I CviRI* \\ \\ \ \\ \ \ \ \ GTACATCACTATGCATTAATGACATCCCTGTCACTTGCATTAGACAATAACTACTATATT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTAGTGATACGTAATTACTGTAGGGACAGTGAACGTAATCTGTTATTGATGATATAA // / / / / / / / / || | | | | | DrdI | CviRI* || | | | | BseGI Tsp45I || | | | VspI MaeIII || | | | MseI || | | CviRI* || | | FokI || | EcoT22I || MslI |Csp6I RsaI V H H Y A L M T S L S L A L D N N Y Y I Y I T M H * * H P C H L H * T I T T I L T S L C I N D I P V T C I R Q * L L Y Y ----:----|----:----|----:----|----:----|----:----|----:----| T C * * A N I V D R D S A N S L L * * I R V D S H M L S M G T V Q M L C Y S S Y Y M V I C * H C G Q * K C * V I V V I N TspEI | MboII CviRI* TspEI MboII \ \ \ \ \ ACACAATTAGACATATCTTCGGCATATTTGTATGCAGACATCAAAGAAGAATTATACATA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTAATCTGTATAGAAGCCGTATAAACATACGTCTGTAGTTTCTTCTTAATATGTAT // / / / |TspEI CviRI* | MboII MboII TspEI T Q L D I S S A Y L Y A D I K E E L Y I H N * T Y L R H I C M Q T S K K N Y T * T I R H I F G I F V C R H Q R R I I H K ----:----|----:----|----:----|----:----|----:----|----:----| V C N S M D E A Y K Y A S M L S S N Y M * V I L C I K P M N T H L C * L L I I C C L * V Y R R C I Q I C V D F F F * V Y TspDTI | MaeII MnlI | | SetI SetI | BsiYI* | | TaiI MboII \ \ \ \ \ \ \ AGACCTCCACCACATTTAGGAATGAATGATAAGTTGATACGTTTGAAGAAATCACTTTAT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGGAGGTGGTGTAAATCCTTACTTACTATTCAACTATGCAAACTTCTTTAGTGAAATA / / / / / / SetI BsiYI* | | MaeII MboII MnlI | TaiI | SetI TspDTI R P P P H L G M N D K L I R L K K S L Y D L H H I * E * M I S * Y V * R N H F M T S T T F R N E * * V D T F E E I T L W ----:----|----:----|----:----|----:----|----:----|----:----| L G G G C K P I F S L N I R K F F D S * L V E V V N L F S H Y T S V N S S I V K S R W W M * S H I I L Q Y T Q L F * K I Csp6I |RsaI |BsrI SetI \\ \ GGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCAAATCATACCTGATACAACAA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAACTTTGTTTCACCTCGCTTGACCATGCTTTGATAGTTTAGTATGGACTATGTTGTT / // / | |Csp6I SetI | RsaI BsrI G L K Q S G A N W Y E T I K S Y L I Q Q D * N K V E R T G T K L S N H T * Y N N I E T K W S E L V R N Y Q I I P D T T M ----:----|----:----|----:----|----:----|----:----|----:----| P N F C L P A F Q Y S V I L D Y R I C C H I S V F H L S S T R F * * I M G S V V S Q F L T S R V P V F S D F * V Q Y L L FatI BseGI |CviAII || NlaIII || | FokI || | | MseI || | | |AhaIII* || | | || Tsp4CI* || | | || | MaeIII XmnI || | | || | Tsp45I | BccI MboII || | | || | | TspEI \ \ \ \\ \ \ \\ \ \ \ TGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTAAAAACAGTCAAGTGACAATT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATACCTTCTTCAAGCACCTACCAGTACGCATAAATTTTTGTCAGTTCACTGTTAA / / / / / // // / / / | | | | | |FatI |MseI Tsp4CI* | TspEI | | | | | CviAII AhaIII* Tsp45I | | | | NlaIII FokI MaeIII | | | BseGI | | MboII | BccI XmnI C G M E E V R G W S C V F K N S Q V T I V V W K K F V D G H A Y L K T V K * Q F W Y G R S S W M V M R I * K Q S S D N L ----:----|----:----|----:----|----:----|----:----|----:----| H P I S S T R P H D H T N L F L * T V I I H Y P L L E H I T M R I * F C D L S L T T H F F N T S P * A Y K F V T L H C N ApoI TspEI TspEI \ \ TGTTTATTCGTAGATGATATGGTATTGTTTAGCAAAAATCTAAATTCAAACAAAAGAATT 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAATAAGCATCTACTATACCATAACAAATCGTTTTTAGATTTAAGTTTGTTTTCTTAA / / TspEI TspEI ApoI C L F V D D M V L F S K N L N S N K R I V Y S * M I W Y C L A K I * I Q T K E L F I R R * Y G I V * Q K S K F K Q K N Y ----:----|----:----|----:----|----:----|----:----|----:----| Q K N T S S I T N N L L F R F E F L L I K N I R L H Y P I T * C F D L N L C F F T * E Y I I H Y Q K A F I * I * V F S N SfaNI | HindIII | | AluI | | CviJI | | |SmlI | | |AflII | | ||MseI | | ||SetI | | ||| MwoI | | ||| | CviRI* MaeI | | ||| | | Hin4I | BdaI Hin4I | | ||| | | Hin4I PsiI | BdaI MnlI Hin4I \ \ \\\ \ \ \ \ \ \ \ \ ATAGAGAAGCTTAAGATGCAATACGACACCAAGATTATAAATCTAGGCGAAAGTGATGAG 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTCTTCGAATTCTACGTTATGCTGTGGTTCTAATATTTAGATCCGCTTTCACTACTC / / //// // / // // | | |||| |Hin4I PsiI |MaeI |Hin4I | | |||| |Hin4I BdaI |Hin4I | | |||| CviRI* BdaI MnlI | | |||AflII | | |||SmlI | | ||MseI | | |MwoI | | HindIII | CviJI | SfaNI | AluI SetI I E K L K M Q Y D T K I I N L G E S D E * R S L R C N T T P R L * I * A K V M R R E A * D A I R H Q D Y K S R R K * * G ----:----|----:----|----:----|----:----|----:----|----:----| I S F S L I C Y S V L I I F R P S L S S * L S A * S A I R C W S * L D L R F H H Y L L K L H L V V G L N Y I * A F T I L FatI BdaI |CviAII ApoI BdaI || NlaIII TspEI | CviJI MnlI SetI || |TspEI \ \ \ \ \ \\ \\ GAAATTCAATATGACATTCTTGGCTTGGAAATCAAATACCAAAGAGGTAAATACATGAAA 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAGTTATACTGTAAGAACCGAACCTTTAGTTTATGGTTTCTCCATTTATGTACTTT / / / / / / // TspEI BdaI CviJI MnlI SetI | |FatI ApoI BdaI | CviAII NlaIII E I Q Y D I L G L E I K Y Q R G K Y M K K F N M T F L A W K S N T K E V N T * N N S I * H S W L G N Q I P K R * I H E I ----:----|----:----|----:----|----:----|----:----|----:----| S I * Y S M R P K S I L Y W L P L Y M F P F E I H C E Q S P F * I G F L Y I C S F N L I V N K A Q F D F V L S T F V H F MaeII | Csp6I | |RsaI | |SetI | |TaiI | || SetI | || |MseI | || ||AhaIII* | || ||| Hin4II* TspDTI MseI | || ||| |TstI \ \ \ \\ \\\ \\ TTGGGTATGGAAAACTCATTAACTGAAAAAATACCCAAACTAAACGTACCTTTAAACCCA 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCATACCTTTTGAGTAATTGACTTTTTTATGGGTTTGATTTGCATGGAAATTTGGGT / / / / /// /// / TspEI TspDTI MseI | ||| ||| Hin4II* | ||| ||TstI | ||| |MseI | ||| AhaIII* | ||Csp6I | |RsaI | |SetI | MaeII TaiI SetI L G M E N S L T E K I P K L N V P L N P W V W K T H * L K K Y P N * T Y L * T Q G Y G K L I N * K N T Q T K R T F K P K ----:----|----:----|----:----|----:----|----:----|----:----| N P I S F E N V S F I G L S F T G K F G I P Y P F S M L Q F F V W V L R V K L G Q T H F V * * S F F Y G F * V Y R * V W SduI BssKI EcoRII HgiAI* | ScrFI | BseBI | | SetI | | |HindII | | |Hpy166II | | || BssKI | | || SexAI | | || EcoRII | | || | TstI | | || | ScrFI GsuI | | || | BseBI Eco57MI DdeI | | || | | SetI MaeI \ \ \ \ \\ \ \ \ \ AAAGGAAGGAAACTTAGTGCTCCAGGTCAACCAGGTCTATATATAGACCAGCAAGAACTA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCTTCCTTTGAATCACGAGGTCCAGTTGGTCCAGATATATATCTGGTCGTTCTTGAT / // // /// // / / Eco57MI || || ||| || EcoRII MaeI GsuI || || ||| || SexAI || || ||| || BssKI || || ||| |BseBI || || ||| |ScrFI || || ||| SetI || || ||Hpy166II || || ||HindII || || |TstI || || EcoRII || || BssKI || |BseBI || |ScrFI || SetI |HgiAI* |SduI DdeI K G R K L S A P G Q P G L Y I D Q Q E L K E G N L V L Q V N Q V Y I * T S K N * R K E T * C S R S T R S I Y R P A R T R ----:----|----:----|----:----|----:----|----:----|----:----| F P L F S L A G P * G P R Y I S W C S S L L F S V * H E L D V L D I Y L G A L V F S P F K T S W T L W T * I Y V L L F * Csp6I |RsaI |SetI ||FatI |||CviAII |||| NlaIII |||| | TspDTI |||| | | CviRI* |||| | | | AluI AluI |||| | | | CviJI CviJI MboII |||| | | | | SetI |MaeI | Hin4II* |||| | | | | TspDTI SetI ||SetI | |MboII |||| | | | | |MmeI |MaeI \\\ \ \\ \\\\ \ \ \ \ \\ \\ GAGCTAGAAGAAGATGATTACAAAATGAAGGTACATGAAATGCAAAAGCTGATAGGTCTA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGATCTTCTTCTACTAATGTTTTACTTCCATGTACTTTACGTTTTCGACTATCCAGAT / / / / // / // /// / / // / / | | MaeI | |MboII | || ||| | | || SetI MaeI | CviJI | Hin4II* | || ||| | | |MmeI | AluI MboII | || ||| | | TspDTI SetI | || ||| | | CviJI | || ||| | | AluI | || ||| | SetI | || ||| CviRI* | || ||TspDTI | || |FatI | || CviAII | |NlaIII | |Csp6I | RsaI SetI E L E E D D Y K M K V H E M Q K L I G L S * K K M I T K * R Y M K C K S * * V * A R R R * L Q N E G T * N A K A D R S S ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S * L I F T C S I C F S I P R L A L L L H N C F S P V H F A F A S L D L * F F I I V F H L Y M F H L L Q Y T * NdeI ApoI | SfaNI TspEI SetI CviRI* \ \ \ \ \ GCATCATATGTTGGATATAAATTTAGATTTGACCTATTATACTACATCAACACACTTGCA 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGTATACAACCTATATTTAAATCTAAACTGGATAATATGATGTAGTTGTGTGAACGT / / / / / NdeI SfaNI TspEI SetI CviRI* ApoI A S Y V G Y K F R F D L L Y Y I N T L A H H M L D I N L D L T Y Y T T S T H L H I I C W I * I * I * P I I L H Q H T C T ----:----|----:----|----:----|----:----|----:----|----:----| A D Y T P Y L N L N S R N Y * M L V S A L M M H Q I Y I * I Q G I I S C * C V Q C * I N S I F K S K V * * V V D V C K C BdaI BdaI | NdeI | | TspEI Tsp4CI* TspGWI | | | TspDTI | TspDTI \ \ \ \ \ \ \ CAACATATACTATTTCCGTCCAAGCAAGTGTTAGATATGACATATGAATTGATACAGTTC 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTATATGATAAAGGCAGGTTCGTTCACAATCTATACTGTATACTTAACTATGTCAAG / / / / / / / TspGWI BdaI | | | | TspDTI BdaI | | | Tsp4CI* | | TspEI | TspDTI NdeI Q H I L F P S K Q V L D M T Y E L I Q F N I Y Y F R P S K C * I * H M N * Y S S T Y T I S V Q A S V R Y D I * I D T V H ----:----|----:----|----:----|----:----|----:----|----:----| C C I S N G D L C T N S I V Y S N I C N V V Y V I E T W A L T L Y S M H I S V T L M Y * K R G L L H * I H C I F Q Y L E TspEI SetI BdaI | MseI | MseI NdeI BdaI | VspI | | CviJI \ \ \ \ \ \ \ ATATGGAATACGAGAGATAAGCAATTAATATGGCACAAAAGCAAACCTGTTAAGCCAACA 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TATACCTTATGCTCTCTATTCGTTAATTATACCGTGTTTTCGTTTGGACAATTCGGTTGT / / // / / / NdeI BdaI |VspI SetI | CviJI BdaI |MseI MseI TspEI I W N T R D K Q L I W H K S K P V K P T Y G I R E I S N * Y G T K A N L L S Q Q M E Y E R * A I N M A Q K Q T C * A N K ----:----|----:----|----:----|----:----|----:----|----:----| M H F V L S L C N I H C L L L G T L G V * I S Y S L Y A I L I A C F C V Q * A L Y P I R S I L L * Y P V F A F R N L W C SfaNI BtgZI Tsp4CI* TspEI | PsiI |MnlI | PsiI TspEI \ \ \ \\ \ \ \ AATAAATTAGTTGTTATAAGCGATGCCTCGTATGGCAACCAACCGTATTATAAATCACAA 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTAATCAACAATATTCGCTACGGAGCATACCGTTGGTTGGCATAATATTTAGTGTT / / / / / / TspEI SfaNI | | | PsiI PsiI | | Tsp4CI* | BtgZI MnlI N K L V V I S D A S Y G N Q P Y Y K S Q I N * L L * A M P R M A T N R I I N H K * I S C Y K R C L V W Q P T V L * I T N ----:----|----:----|----:----|----:----|----:----|----:----| F L N T T I L S A E Y P L W G Y * L D C L Y I L Q * L R H R T H C G V T N Y I V I F * N N Y A I G R I A V L R I I F * L TspDTI Hpy166II MnlI | StyI |SetI | SecI* MseI |TspEI | | CviJI \ \\ \ \ \ ATTGGCAACATATATTTACTTAATGGAAAGGTAATTGGAGGAAAGTCCACCAAGGCTTCA 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCGTTGTATATAAATGAATTACCTTTCCATTAACCTCCTTTCAGGTGGTTCCGAAGT / / / / / / / // TspEI MseI | MnlI TspEI | | |CviJI SetI | | SecI* | | StyI | Hpy166II TspDTI I G N I Y L L N G K V I G G K S T K A S L A T Y I Y L M E R * L E E S P P R L H W Q H I F T * W K G N W R K V H Q G F I ----:----|----:----|----:----|----:----|----:----|----:----| I P L M Y K S L P F T I P P F D V L A E F Q C C I N V * H F P L Q L F T W W P K N A V Y I * K I S L Y N S S L G G L S * MseI | MslI | |FatI | |AflIII | |BspLU11I* | ||CviAII | ||| TatI | ||| |NspI | ||| |Csp6I TspGWI TfiI | ||| |NlaIII | BslFI BarI | ||| ||RsaI BarI | FnuDII* HinfI \ \\\ \\\ \ \ \ \ TTAACATGTACTTCAACTACGGAAGCAGAAATACACGCGATAAGTGAATCTGTCCCATTA 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTACATGAAGTTGATGCCTTCGTCTTTATGTGCGCTATTCACTTAGACAGGGTAAT // ///// / / / / || ||||TatI | | BslFI HinfI || |||Csp6I | | BarI TfiI || ||RsaI | FnuDII* || ||BarI TspGWI || |BspLU11I* || |AflIII || |FatI || CviAII |NlaIII |NspI MslI MseI L T C T S T T E A E I H A I S E S V P L * H V L Q L R K Q K Y T R * V N L S H Y N M Y F N Y G S R N T R D K * I C P I I ----:----|----:----|----:----|----:----|----:----|----:----| N V H V E V V S A S I C A I L S D T G N M L M Y K L * P L L F V R S L H I Q G M * C T S * S R F C F Y V R Y T F R D W * DdeI Hin4I MseI | MaeIII SetI TspEI Hin4I \ \ \ \ \ \ TTAAATAATCTAAGTTACCTGATACAAGAACTTGACAAGAAACCAATTACCAAAGGATTA 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTATTAGATTCAATGGACTATGTTCTTGAACTGTTCTTTGGTTAATGGTTTCCTAAT / / / / / / MseI | | MaeIII | Hin4I | SetI | Hin4I DdeI TspEI L N N L S Y L I Q E L D K K P I T K G L * I I * V T * Y K N L T R N Q L P K D Y K * S K L P D T R T * Q E T N Y Q R I T ----:----|----:----|----:----|----:----|----:----|----:----| N F L R L * R I C S S S L F G I V L P N I L Y D L N G S V L V Q C S V L * W L I * I I * T V Q Y L F K V L F W N G F S * TspEI |Hin4I ApoI MboII Tsp4CI* |Hin4I Ksp632I* TspEI |TspDTI \ \\ \ \ \\ CTAACCGACAGTAAATCTACAATCAGTATAATTATATCCAATAATGAAGAGAAATTTAGG 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| GATTGGCTGTCATTTAGATGTTAGTCATATTAATATAGGTTATTACTTCTCTTTAAATCC / / / / // Tsp4CI* Hin4I TspEI Ksp632I* |TspDTI Hin4I |MboII TspEI ApoI L T D S K S T I S I I I S N N E E K F R * P T V N L Q S V * L Y P I M K R N L G N R Q * I Y N Q Y N Y I Q * * R E I * E ----:----|----:----|----:----|----:----|----:----|----:----| S V S L L D V I L I I I D L L S S F N L V L R C Y I * L * Y L * I W Y H L S I * * G V T F R C D T Y N Y G I I F L F K P Hin4I BsgI Hin4I Csp6I Hin4I | Hpy178III* Hin4I |RsaI |BsrDI | | TspDTI CviRI* \\ \\ \ \ \ \ AACAGATTTTTTGGTACTAAAGCAATGAGATTGAGAGATGAAGTATCAGGAAATCATCTG 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTAAAAAACCATGATTTCGTTACTCTAACTCTCTACTTCATAGTCCTTTAGTAGAC // / / / / / / / |Csp6I | BsrDI BsgI | | | CviRI* RsaI Hin4I | | Hin4I Hin4I | | Hin4I | TspDTI Hpy178III* N R F F G T K A M R L R D E V S G N H L T D F L V L K Q * D * E M K Y Q E I I C Q I F W Y * S N E I E R * S I R K S S A ----:----|----:----|----:----|----:----|----:----|----:----| F L N K P V L A I L N L S S T D P F * R S C I K Q Y * L L S I S L H L I L F D D V S K K T S F C H S Q S I F Y * S I M Q SspI | CviRI* MaeII | | Hin4I |BsaAI | | | MaeII || SetI | | | | SetI Hpy188I || TaiI TaqI | | | | TaiI MboII SetI Ksp632I* \\ \ \ \ \ \ \ \ \ \ \ CACGTATGCTATATCGAAACCAAAAAGAATATTGCAGACGTAATGACCAAACCTCTTCCG 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCATACGATATAGCTTTGGTTTTTCTTATAACGTCTGCATTACTGGTTTGGAGAAGGC / // / // / / / / / / | |MaeII TaqI || | | | | SetI Hpy188I | BsaAI || | | | MboII TaiI || | | MaeII SetI || | TaiI || | SetI || CviRI* |Hin4I SspI H V C Y I E T K K N I A D V M T K P L P T Y A I S K P K R I L Q T * * P N L F R R M L Y R N Q K E Y C R R N D Q T S S D ----:----|----:----|----:----|----:----|----:----|----:----| C T H * I S V L F F I A S T I V L G R G A R I S Y R F W F S Y Q L R L S W V E E V Y A I D F G F L I N C V Y H G F R K R MboI BglII XhoII | DpnI | |BstKTI TfiI | || TaqII MnlI Hin4I MseI TspDTI HinfI | || |MmeI \ \ \ \ \ \ \\ \\ ATAAAAACATTCAAACTATTAACAAACAAATGGATTCATTAGATCTATTACATTATGGGT 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTTGTAAGTTTGATAATTGTTTGTTTACCTAAGTAATCTAGATAATGTAATACCCA /// / / / //// ||Hin4I | TspDTI HinfI |||XhoII |Ksp632I* MseI TfiI |||BglII MnlI |||MboI |||MmeI ||TaqII |DpnI BstKTI I K T F K L L T N K W I H * I Y Y I M G * K H S N Y * Q T N G F I R S I T L W V K N I Q T I N K Q M D S L D L L H Y G W ----:----|----:----|----:----|----:----|----:----|----:----| I F V N L S N V F L H I * * I * * M I P S L F M * V I L L C I S E N S R N C * P Y F C E F * * C V F P N M L D I V N H T GGTATGTTGGAATAAAAATCCACTATCGTCTATCAACTAATAGTTATATTATCAATATAT 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACAACCTTATTTTTAGGTGATAGCAGATAGTTGATTATCAATATAATAGTTATATA G M L E * K S T I V Y Q L I V I L S I Y V C W N K N P L S S I N * * L Y Y Q Y I Y V G I K I H Y R L S T N S Y I I N I L ----:----|----:----|----:----|----:----|----:----|----:----| P I N S Y F D V I T * * S I T I N D I Y H Y T P I F I W * R R D V L L * I I L I T H Q F L F G S D D I L * Y N Y * * Y I AluI Tsp4CI* CviJI TaqI | MseI Hin4I | SetI | MnlI Hin4I \ \ \ \ \ \ \ \ TATCATATACGGTGTTAAGATGATGACATAAGTTATGAGAAGCTGTCATCGAAGTTAGAG 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTATATGCCACAATTCTACTACTGTATTCAATACTCTTCGACAGTAGCTTCAATCTC / / / / / // / | MseI Hin4I | CviJI || Hin4I Tsp4CI* | AluI |TaqI SetI MnlI Y H I R C * D D D I S Y E K L S S K L E I I Y G V K M M T * V M R S C H R S * R S Y T V L R * * H K L * E A V I E V R G ----:----|----:----|----:----|----:----|----:----|----:----| * * I R H * S S S M L * S F S D D F N S N D Y V T N L H H C L N H S A T M S T L I M Y P T L I I V Y T I L L Q * R L * L MboI AluI | DpnI TspDTI CviJI | |BstKTI | Hin4I | SetI | || BinI* | | MnlI \ \ \ \\ \ \ \ \ GAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAAAACG 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATATTTGTATATTTTGC / / // / / // / | CviJI || MboI BinI* || MnlI | AluI |DpnI |TspDTI SetI BstKTI Hin4I E A E T Q G L I M * * D Q * I * T Y K T K L K R K D * * C N R I N E Y K H I K R S * N A R I D N V I G S M N I N I * N G ----:----|----:----|----:----|----:----|----:----|----:----| S A S V C P N I I Y Y S * H I Y V Y L V P L Q F A L I S L T I P D I F I F M Y F F S F R L S Q Y H L L I L S Y L C I F R TfiI BsiYI* HinfI | TfiI TspGWI SspI Hin4I | MnlI | HinfI \ \ \ \ \ \ \ GAATGAGGAATAATCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCT 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACTCCTTATTAGCATTATAATCATACATCTTTATATCTAAGGTAAAACTCCTAAGGA / / / / / / TspGWI | Hin4I | BsiYI* HinfI SspI HinfI TfiI TfiI MnlI E * G I I V I L V C R N I D S I L R I P N E E * S * Y * Y V E I * I P F * G F L M R N N R N I S M * K Y R F H F E D S Y ----:----|----:----|----:----|----:----|----:----|----:----| S H P I I T I N T H L F I S E M K L I G P I L F L R L I L I Y F Y L N W K S S E F S S Y D Y Y * Y T S I Y I G N Q P N R MnlI | AvaI | XhoI | SmlI | AbsI AccI | PspXI |BssNAI | |TaqI |Hpy166II | |BmeT110I MaeI || SetI | || MnlI | BseRI || | SspI CviJI \ \\ \ \ \ \\ \ \ \ ATATCCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAAC 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGGAGCTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATAGTTG / // / / // / / MnlI || MnlI BseRI |AccI SspI CviJI |PspXI MaeI |SetI |AbsI Hpy166II |SmlI BssNAI |XhoI |AvaI BmeT110I TaqI I S S R R T S S I F C I P N I I A F I N Y P R G E L L V Y S V Y L I L * P L S T I L E E N F * Y I L Y T * Y Y S L Y Q Q ----:----|----:----|----:----|----:----|----:----|----:----| I D E L L V E L I N Q I G L I I A K I L * I R S S F K * Y I R Y V * Y * L R * * Y G R P S S R T Y E T Y R I N Y G K D V TfiI HinfI TspEI \ \ AATGGAATCCCAACAATTATCTCAACATTCACATATTTCTCA 5890 5900 5910 5920 ----:----|----:----|----:----|----:----|-- TTACCTTAGGGTTGTTAATAGAGTTGTAAGTGTATAAAGAGT / / HinfI TspEI TfiI N G I P T I I S T F T Y F S M E S Q Q L S Q H S H I S X W N P N N Y L N I H I F L X ----:----|----:----|----:----|----:----|-- L P I G V I I E V N V Y K E C H F G L L * R L M * M N R I S D W C N D * C E C I E * # Enzymes that cut Frequency Isoschizomers AarI 2 AbsI 1 Acc65I 1 Asp718I AccI 5 FblI,XmiI AciI 4 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 3 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 3 DraI AjuI 1 AlfI 2 AluI 15 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 16 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 13 Bce83I* 1 BpuEI BceAI 4 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 10 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 3 BinI* 5 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 2 BmgT120I 4 Bpu10I 2 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 9 Bst2UI,BstNI,BstOI,MvaI BseGI 12 BstF5I,BtsCI BseMII 11 BseRI 3 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 11 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 9 BstSCI,StyD4I BssNAI 4 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 17 BstXI 2 BtgZI 3 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 7 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 23 CviQI,RsaNI CviAII 20 CviJI 34 CviKI-1 CviRI* 26 HpyCH4V DdeI 19 BstDEI,HpyF3I DpnI 17 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 9 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 20 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 12 GlaI 3 GsaI 1 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 22 Hin4II* 7 HpyAV Hin6I 3 HinP1I,HspAI HindII 6 HincII HindIII 1 HinfI 35 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 11 AsuHPI Hpy166II 21 Hpy8I Hpy178III* 20 Hpy188III Hpy188I 21 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 13 FspBI,BfaI,XspI MaeII 13 HpyCH4IV MaeIII 12 MboI 17 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 23 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 9 SchI MmeI 6 MnlI 32 MseI 28 Tru1I,Tru9I MslI 7 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 5 HpyF10VI,BstMWI NdeI 3 FauNDI NlaIII 20 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 4 MspA1I NspI 6 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 9 PpsI PpiI 1 PsiI 4 AanI PspXI 1 PstI 2 PvuII 2 RsaI 23 AfaI SalI 1 ScaI 2 BmcAI,AssI,ZrmI ScrFI 9 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 78 SexAI 1 MabI SfaNI 10 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 3 SmoI SpeI 2 BcuI,AhlI SphI 4 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 10 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 13 TaqI 23 TaqII 5 TatI 7 TfiI 26 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 9 NmuCI Tsp4CI* 27 HpyCH4III,TaaI,Bst4CI TspDTI 30 TspEI 51 TasI,Tsp509I,Sse9I TspGWI 15 TspRI 6 TscAI TstI 2 VspI 3 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AclI AcyI AloI ApaI AscI AvrII BalI BamHI BcgI BglI BmtI BplI BsaBI BsePI Bsp120I Bsp1407I BspMII* BspOI BsrBI BstAPI CauII* Cfr9I CfrI CspCI DinI DraII DraIII Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EgeI EheI EspI* FalI FauI FseI FspAI KasI MauBI MluI MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI PacI PasI PmaCI PmeI PpuMI PshAI PspOMI PsrI PvuI RsrII SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769