Restriction Map of DAN4/YJR151C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DAN4/YJR151C on chromosome X from coordinates 715740 to 712255.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26559

EMBOSS_001 CviJI | DdeI | Bpu10I | | BbvI | | |AluI | | |CviJI | | || SetI | | || |SpeI | | || ||MaeI | | || ||| MwoI | | || ||| | AciI | | || ||| | |BisI | | || ||| | ||BlsI | | || ||| | |||TseI | | || ||| | |||TauI | | || ||| | |||CviJI SfaNI | | || ||| | ||||BisI MseI | TspEI | | || ||| | |||||BlsI \ \ \ \ \ \\ \\\ \ \\\\\\ ATGGTTAATATAAGCATCGTAGCAGGAATTGTAGCCTTAGCTACTAGTGCGGCTGCTATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAATTATATTCGTAGCATCGTCCTTAACATCGGAATCGATGATCACGCCGACGATAA / / / / /// / // /////// / / MseI | | | ||| | || ||||||| | BsaXI | | | ||| | || ||||||| MwoI | | | ||| | || ||||||TseI | | | ||| | || |||||BisI | | | ||| | || ||||BlsI | | | ||| | || |||CviJI | | | ||| | || ||BisI | | | ||| | || ||AciI | | | ||| | || |BlsI | | | ||| | || TauI | | | ||| | |SpeI | | | ||| | MaeI | | | ||| MwoI | | | ||| BbvI | | | ||CviJI | | | ||AluI | | | |Bpu10I | | | |DdeI | | | SetI | | CviJI | TspEI SfaNI M V N I S I V A G I V A L A T S A A A I W L I * A S * Q E L * P * L L V R L L L G * Y K H R S R N C S L S Y * C G C Y Y ----:----|----:----|----:----|----:----|----:----|----:----| X T L I L M T A P I T A K A V L A A A I X P * Y L C R L L F Q L R L * * H P Q * H N I Y A D Y C S N Y G * S S T R S S N BsaXI | HinfI | | HindII | | Hpy166II | | | PleI | | | |SetI | | | |MlyI MwoI | | | |TspDTI | BsaXI | | | || TspEI CviJI \ \ \ \ \ \\ \ \ ACAGCGACCACTACTTTATCTCCTTACGATGAAAGAGTCAACCTTATTGAATTGGCTGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGCTGGTGATGAAATAGAGGAATGCTACTTTCTCAGTTGGAATAACTTAACCGACAA / /// / / / / BsaXI ||| | PleI | CviJI ||| | MlyI TspEI ||| TspDTI ||SetI |Hpy166II |HindII HinfI T A T T T L S P Y D E R V N L I E L A V Q R P L L Y L L T M K E S T L L N W L F S D H Y F I S L R * K S Q P Y * I G C L ----:----|----:----|----:----|----:----|----:----|----:----| V A V V V K D G * S S L T L R I S N A T * L S W * K I E K R H F L * G * Q I P Q C R G S S * R R V I F S D V K N F Q S N HphI |BetI* Hpy188I |BspMII* | Hpy188I TatI ||HpaII | | CviJI |Csp6I ||Hpy178III* | | | SduI ||RsaI ||| TfiI | | | HgiJII* ||ScaI ||| HinfI \ \ \ \ \\\ \\\ \ TATGTTTCTGACATCAGAGCCCACATATTTCAGTACTACTCTTTCCGGAATCACCATAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATACAAAGACTGTAGTCTCGGGTGTATAAAGTCATGATGAGAAAGGCCTTAGTGGTATTC / / / / /// / // / | | | CviJI ||TatI HphI || HinfI | | HgiJII* |Csp6I || TfiI | | SduI ScaI |BspMII* | Hpy188I RsaI |BetI* Hpy188I Hpy178III* HpaII Y V S D I R A H I F Q Y Y S F R N H H K M F L T S E P T Y F S T T L S G I T I R C F * H Q S P H I S V L L F P E S P * D ----:----|----:----|----:----|----:----|----:----|----:----| * T E S M L A W M N * Y * E K R F * W L K H K Q C * L G C I E T S S K G S D G Y I N R V D S G V Y K L V V R E P I V M L BceAI | Hpy188I | | Hin4II* | | | TseI | | | |BisI | | | ||BlsI | | | |||TseI | | | ||||BisI EcoP15I | | | |||||BlsI BbvI | HphI | | | ||||||CviJI | BbvI Tsp4CI* | | TaqI \ \ \ \\\\\\\ \ \ \ \ \ \ ACTGAAACATATCCTTCGGAAATCGCAGCAGCCGTTTTTGACTACGGTGATTTCACTACT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTTGTATAGGAAGCCTTTAGCGTCGTCGGCAAAAACTGATGCCACTAAAGTGATGA // / ////// / // // || | |||||CviJI | |Tsp4CI* |EcoP15I || | |||||TseI | BbvI HphI || | ||||BisI BbvI || | |||BlsI || | ||TseI || | |BisI || | BlsI || Hin4II* |BceAI Hpy188I T E T Y P S E I A A A V F D Y G D F T T L K H I L R K S Q Q P F L T T V I S L L * N I S F G N R S S R F * L R * F H Y S ----:----|----:----|----:----|----:----|----:----|----:----| V S V Y G E S I A A A T K S * P S K V V S Q F M D K P F R L L R K Q S R H N * * S F C I R R F D C C G N K V V T I E S S MboI BsrI BclI TspRI AgeI MaeIII TspDTI | SecI* BetI* | HphI | DpnI | DsaI* Cfr10I | |MaeI | |TspGWI | | Csp6I |HpaII | ||TstI | |BstKTI | | |RsaI \\ \ \\\ \ \\ \ \ \\ CGATTGACCGGTATTTCGGGTGATGAAGTAACTAGAATGATCACTGGTGTTCCGTGGTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAACTGGCCATAAAGCCCACTACTTCATTGATCTTACTAGTGACCACAAGGCACCATG / // / / / / / // / / / /// TaqI |Cfr10I | | | | | || | BsrI | ||TstI |BetI* | | | | | || BclI | |Csp6I |AgeI | | | | | || MboI | RsaI HpaII | | | | | |DpnI DsaI* | | | | | BstKTI SecI* | | | | | TspGWI | | | | | TspRI | | | | TspDTI | | | MaeI | | MaeIII | HphI TstI R L T G I S G D E V T R M I T G V P W Y D * P V F R V M K * L E * S L V F R G T I D R Y F G * * S N * N D H W C S V V L ----:----|----:----|----:----|----:----|----:----|----:----| R N V P I E P S S T V L I I V P T G H Y E I S R Y K P H H L L * F S * Q H E T T S Q G T N R T I F Y S S H D S T N R P V MseI |Eco57I |Eco57MI || MroNI || CviJI Ksp632I* || Cfr10I |Hin6I || |HpaII ||GlaI || ||NaeI ||Eco47III || ||MboII |||HhaI FokI || ||Cac8I ||||HaeII | AjuI TstI || ||| CviJI ||||| BccI BseGI | |CviJI \ \\ \\\ \ \\\\\ \ \ \ \\ TCTACCAGATTAAAGCCGGCTATCTCTTCAGCGCTTTCAAAGGATGGTATTTACACGGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTCTAATTTCGGCCGATAGAGAAGTCGCGAAAGTTTCCTACCATAAATGTGCCGA / / ///// //// / / / // | | ||||Cfr10I |||| BccI BseGI AjuI |FokI | | ||||MroNI |||Ksp632I* CviJI | | ||||CviJI |||Hin6I | | |||HpaII ||Eco47III | | ||Cac8I ||GlaI | | ||NaeI |HhaI | | |MboII HaeII | | CviJI | MseI Eco57MI Eco57I S T R L K P A I S S A L S K D G I Y T A L P D * S R L S L Q R F Q R M V F T R L Y Q I K A G Y L F S A F K G W Y L H G Y ----:----|----:----|----:----|----:----|----:----|----:----| E V L N F G A I E E A S E F S P I * V A S * W I L A P * R K L A K L P H Y K C P R G S * L R S D R * R K * L I T N V R S MaeI | TatI | |Csp6I | ||RsaI SetI | ||ScaI |BceAI MnlI AjuI | ||| TaqI \\ \ \ \ \\\ \ ATCCCAACCTCTACTTCTACAACGACTACAAAATCTAGTACTTCGACTACTCCTACCACC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGTTGGAGATGAAGATGTTGCTGATGTTTTAGATCATGAAGCTGATGAGGATGGTGG / / / / / /// / SetI | MnlI AjuI | ||| TaqI BceAI | ||TatI | |Csp6I | ScaI | RsaI MaeI I P T S T S T T T T K S S T S T T P T T S Q P L L L Q R L Q N L V L R L L L P P P N L Y F Y N D Y K I * Y F D Y S Y H H ----:----|----:----|----:----|----:----|----:----|----:----| I G V E V E V V V V F D L V E V V G V V * G L R * K * L S * L I * Y K S * E * W D W G R S R C R S C F R T S R S S R G G TaqI SetI MnlI \ \ \ ACTATCACTTCTACTACTTCTACCACATCGACTACTCCTACAACCTCTACTACTTCTACC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAGTGAAGATGATGAAGATGGTGTAGCTGATGAGGATGTTGGAGATGATGAAGATGG / / / TaqI SetI MnlI T I T S T T S T T S T T P T T S T T S T L S L L L L L P H R L L L Q P L L L L P Y H F Y Y F Y H I D Y S Y N L Y Y F Y H ----:----|----:----|----:----|----:----|----:----|----:----| V I V E V V E V V D V V G V V E V V E V W * * K * * K * W M S * E * L R * * K * S D S R S S R G C R S S R C G R S S R G TaqI SetI MnlI \ \ \ ACTCCTACAACTTCTACCACATCGACTACTCCTACAACCTCTACTACTTCTACCACTCCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGATGTTGAAGATGGTGTAGCTGATGAGGATGTTGGAGATGATGAAGATGGTGAGGA / / / TaqI SetI MnlI T P T T S T T S T T P T T S T T S T T P L L Q L L P H R L L L Q P L L L L P L L S Y N F Y H I D Y S Y N L Y Y F Y H S Y ----:----|----:----|----:----|----:----|----:----|----:----| V G V V E V V D V V G V V E V V E V V G W E * L K * W M S * E * L R * * K * W E S R C S R G C R S S R C G R S S R G S R TaqI SetI MnlI \ \ \ ACAACTTCTACCACATCGACTACTCCTACAACCTCTACTACTTCTACCACTCCTACAACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGAAGATGGTGTAGCTGATGAGGATGTTGGAGATGATGAAGATGGTGAGGATGTTGA / / / TaqI SetI MnlI T T S T T S T T P T T S T T S T T P T T Q L L P H R L L L Q P L L L L P L L Q L N F Y H I D Y S Y N L Y Y F Y H S Y N F ----:----|----:----|----:----|----:----|----:----|----:----| V V E V V D V V G V V E V V E V V G V V * L K * W M S * E * L R * * K * W E * L C S R G C R S S R C G R S S R G S R C S TaqI SetI MnlI \ \ \ TCTACCACATCGACTACTCCTACAACCTCTACTACTTCTACCACTCCTACAACTTCTACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTGTAGCTGATGAGGATGTTGGAGATGATGAAGATGGTGAGGATGTTGAAGATGT / / / TaqI SetI MnlI S T T S T T P T T S T T S T T P T T S T L P H R L L L Q P L L L L P L L Q L L Q Y H I D Y S Y N L Y Y F Y H S Y N F Y N ----:----|----:----|----:----|----:----|----:----|----:----| E V V D V V G V V E V V E V V G V V E V K * W M S * E * L R * * K * W E * L K * R G C R S S R C G R S S R G S R C S R C SetI MnlI \ \ ACTTCTACCACTCCTACAACTTCTACCACTCCTACAACTTCTACAACCTCCACCACTTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGATGGTGAGGATGTTGAAGATGGTGAGGATGTTGAAGATGTTGGAGGTGGTGAAGA / / SetI MnlI T S T T P T T S T T P T T S T T S T T S L L P L L Q L L P L L Q L L Q P P P L L F Y H S Y N F Y H S Y N F Y N L H H F S ----:----|----:----|----:----|----:----|----:----|----:----| V E V V G V V E V V G V V E V V E V V E L K * W E * L K * W E * L K * L R W W K S R G S R C S R G S R C S R C G G G S R TaqI TaqI \ \ CAAACTTCCACCAAATCGACTACTCCTACTACTTCAAGCACATCGACTACTCCTACAACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGAAGGTGGTTTAGCTGATGAGGATGATGAAGTTCGTGTAGCTGATGAGGATGTTGA / / TaqI TaqI Q T S T K S T T P T T S S T S T T P T T K L P P N R L L L L L Q A H R L L L Q L N F H Q I D Y S Y Y F K H I D Y S Y N F ----:----|----:----|----:----|----:----|----:----|----:----| * V E V L D V V G V V E L V D V V G V V E F K W W I S * E * * K L C M S * E * L L S G G F R S S R S S * A C R S S R C S SetI | AciI | | BsrBI | | | MnlI \ \ \ \ TCTACCACTCCTACAACTTCTACAACCTCTACCGCTCCTACAACTTCTACAACTTCTACA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTGAGGATGTTGAAGATGTTGGAGATGGCGAGGATGTTGAAGATGTTGAAGATGT / // / SetI |MnlI SetI BsrBI AciI S T T P T T S T T S T A P T T S T T S T L P L L Q L L Q P L P L L Q L L Q L L Q Y H S Y N F Y N L Y R S Y N F Y N F Y N ----:----|----:----|----:----|----:----|----:----|----:----| E V V G V V E V V E V A G V V E V V E V K * W E * L K * L R * R E * L K * L K * R G S R C S R C G R G S R C S R C S R C AciI SetI MnlI | BsrBI SetI MnlI \ \ \ \ \ \ ACCTCTACCACTTCTACCATTTCTACCGCTCCCACGACCTCTACAACTTCAAGCACTTTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGATGGTGAAGATGGTAAAGATGGCGAGGGTGCTGGAGATGTTGAAGTTCGTGAAAG / / / / MnlI BsrBI SetI MnlI AciI T S T T S T I S T A P T T S T T S S T F P L P L L P F L P L P R P L Q L Q A L S L Y H F Y H F Y R S H D L Y N F K H F Q ----:----|----:----|----:----|----:----|----:----|----:----| V E V V E V M E V A G V V E V V E L V K L R * W K * W K * R E W S R * L K L C K G R G S R G N R G S G R G R C S * A S E TatI |Csp6I BseGI ||RsaI CviRI* ||ScaI | MnlI ||| FokI | | SfaNI ||| | MaeI | | | MnlI BtsI TspRI SetI MnlI \\\ \ \ \ \ \ \ \ \ \ \ AGTACTTCTAGTGCCTCTGCATCCTCTGTCATTTCTACCACTGCTACAACCTCTACCACT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCATGAAGATCACGGAGACGTAGGAGACAGTAAAGATGGTGACGATGTTGGAGATGGTGA /// / / / / / / / / ||TatI MaeI | | MnlI | TspRI SetI MnlI |Csp6I FokI | CviRI* | BtsI ScaI BseGI SfaNI RsaI MnlI S T S S A S A S S V I S T T A T T S T T V L L V P L H P L S F L P L L Q P L P L Y F * C L C I L C H F Y H C Y N L Y H F ----:----|----:----|----:----|----:----|----:----|----:----| L V E L A E A D E T M E V V A V V E V V * Y K * H R Q M R Q * K * W Q * L R * W T S R T G R C G R D N R G S S C G R G S AarI SetI BsrI SetI BspMI CviJI BceAI |MaeI \ \ \ \ \ \\ TTTGCCAGTCTTACTACACCTGCCACATCTACGGCTTCTACTGACCATACAACCTCTAGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGTCAGAATGATGTGGACGGTGTAGATGCCGAAGATGACTGGTATGTTGGAGATCA / / / / / / / BsrI SetI | CviJI | SetI MaeI BspMI BceAI AarI F A S L T T P A T S T A S T D H T T S S L P V L L H L P H L R L L L T I Q P L V C Q S Y Y T C H I Y G F Y * P Y N L * C ----:----|----:----|----:----|----:----|----:----|----:----| K A L R V V G A V D V A E V S W V V E L K Q W D * * V Q W M * P K * Q G Y L R * K G T K S C R G C R R S R S V M C G R T MnlI | BsmAI BsmI CviRI* BslFI \ \ \ \ \ GTCTCAACAACTAACGCATTCACTACTTCTGCAACTACTACTACTACGAGCGATACATAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGTTGTTGATTGCGTAAGTGATGAAGACGTTGATGATGATGATGCTCGCTATGTATA / / / / MnlI | BsmI CviRI* BsmAI V S T T N A F T T S A T T T T T S D T Y S Q Q L T H S L L L Q L L L L R A I H I L N N * R I H Y F C N Y Y Y Y E R Y I Y ----:----|----:----|----:----|----:----|----:----|----:----| T E V V L A N V V E A V V V V V L S V Y H R L L * R M * * K Q L * * * * S R Y M D * C S V C E S S R C S S S S R A I C I BseYI | FokI | | GsaI | | CviJI | | TspDTI | | | MaeIII | | | Tsp45I | | | | BseMII | | | | |BspCNI | | | | ||BseGI | | | | ||| AciI | | | | ||| | NspBII* MboII | | | | ||| | |DdeI |TspRI | | | | ||| | |EspI* Tsp4CI* |MaeIII | | | | ||| | || CviJI | HphI |Tsp45I \ \ \ \ \\\ \ \\ \ \ \ \\ ATCAGTTCAAGTAGTCCCAGCCAAGTCACTTCATCCGCTGAGCCTACTACTGTCAGTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCAAGTTCATCAGGGTCGGTTCAGTGAAGTAGGCGACTCGGATGATGACAGTCACTT / / / / / /// / // // / / BslFI | | | FokI ||Tsp45I | |CviJI || HphI MboII | | BseYI ||MaeIII | EspI* |TspRI | | CviJI ||BseGI | DdeI Tsp4CI* | TspDTI |BspCNI NspBII* GsaI BseMII AciI I S S S S P S Q V T S S A E P T T V S E S V Q V V P A K S L H P L S L L L S V K Q F K * S Q P S H F I R * A Y Y C Q * S ----:----|----:----|----:----|----:----|----:----|----:----| I L E L L G L W T V E D A S G V V T L S Y * N L Y D W G L * K M R Q A * * Q * H D T * T T G A L D S * G S L R S S D T F SetI |BssKI |SexAI |EcoRII || ScrFI || BseBI || | SetI || | |MaeI || | ||FokI || | ||| TspDTI BseGI Ksp632I* || | ||| | MaeIII | AciI SetI | MnlI || | ||| | Tsp45I | | NspBII* SetI \ \ \ \\ \ \\\ \ \ \ \ \ \ GTCACCTCTTCTGTTGAACCTACCAGGTCTAGTCAAGTCACTTCATCCGCTGAACCTACT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGGAGAAGACAACTTGGATGGTCCAGATCAGTTCAGTGAAGTAGGCGACTTGGATGA / / // / // / // / / / / | Tsp45I || SetI || | || FokI Tsp45I | SetI | MaeIII |Ksp632I* || | |MaeI MaeIII NspBII* SetI MnlI || | TspDTI BseGI AciI || EcoRII || SexAI || BssKI |BseBI |ScrFI SetI V T S S V E P T R S S Q V T S S A E P T S P L L L N L P G L V K S L H P L N L L H L F C * T Y Q V * S S H F I R * T Y Y ----:----|----:----|----:----|----:----|----:----|----:----| T V E E T S G V L D L * T V E D A S G V L * R K Q Q V * W T * D L * K M R Q V * D G R R N F R G P R T L D S * G S F R S SetI |BssKI |SexAI |EcoRII || ScrFI Tsp4CI* || BseBI | HphI || | SetI | | ApoI || | |MaeI | | TspEI || | ||FokI | | EcoRI || | ||| TspDTI | | |MboII Ksp632I* || | ||| | MaeIII BseGI | | ||TspRI SetI | MnlI || | ||| | Tsp45I | AciI \ \ \\\ \ \ \ \\ \ \\\ \ \ \ \ ACTGTCAGTGAATTCACCTCTTCTGTTGAACCTACCAGGTCTAGTCAAGTCACTTCATCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAGTCACTTAAGTGGAGAAGACAACTTGGATGGTCCAGATCAGTTCAGTGAAGTAGG // / / // // / // / // / / || HphI | |SetI || SetI || | || FokI Tsp45I |TspRI | EcoRI |Ksp632I* || | |MaeI MaeIII Tsp4CI* | TspEI MnlI || | TspDTI BseGI | ApoI || EcoRII MboII || SexAI || BssKI |BseBI |ScrFI SetI T V S E F T S S V E P T R S S Q V T S S L S V N S P L L L N L P G L V K S L H P C Q * I H L F C * T Y Q V * S S H F I R ----:----|----:----|----:----|----:----|----:----|----:----| V T L S N V E E T S G V L D L * T V E D * Q * H I * R K Q Q V * W T * D L * K M S D T F E G R R N F R G P R T L D S * G SetI |BssKI |SexAI |EcoRII || ScrFI Tsp4CI* || BseBI | HphI || | SetI | | ApoI || | |MaeI | | TspEI || | ||FokI | | EcoRI || | ||| TspDTI | | |MboII Ksp632I* || | ||| | MaeIII NspBII* SetI | | ||TspRI SetI | MnlI || | ||| | Tsp45I \ \ \ \ \\\ \ \ \ \\ \ \\\ \ \ GCTGAACCTACTACTGTCAGTGAATTCACCTCTTCTGTTGAACCTACCAGGTCTAGTCAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTGGATGATGACAGTCACTTAAGTGGAGAAGACAACTTGGATGGTCCAGATCAGTT / / // / / // // / // / // / | SetI || HphI | |SetI || SetI || | || FokI NspBII* |TspRI | EcoRI |Ksp632I* || | |MaeI AciI Tsp4CI* | TspEI MnlI || | TspDTI | ApoI || EcoRII MboII || SexAI || BssKI |BseBI |ScrFI SetI A E P T T V S E F T S S V E P T R S S Q L N L L L S V N S P L L L N L P G L V K * T Y Y C Q * I H L F C * T Y Q V * S S ----:----|----:----|----:----|----:----|----:----|----:----| A S G V V T L S N V E E T S G V L D L * R Q V * * Q * H I * R K Q Q V * W T * D S F R S S D T F E G R R N F R G P R T L Tsp4CI* | HphI SetI | | ApoI |BssKI | | TspEI |SexAI BseGI | | EcoRI |EcoRII | AciI | | |MboII Ksp632I* || ScrFI | | NspBII* SetI | | ||TspRI SetI | MnlI || BseBI \ \ \ \ \ \ \\\ \ \ \ \\ \ GTCACTTCATCCGCTGAACCTACTACTGTCAGTGAATTCACCTCTTCTGTTGAACCTACC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGAAGTAGGCGACTTGGATGATGACAGTCACTTAAGTGGAGAAGACAACTTGGATGG / / / // / / // // / / Tsp45I | SetI || HphI | |SetI || SetI SetI MaeIII NspBII* |TspRI | EcoRI |Ksp632I* BseGI AciI Tsp4CI* | TspEI MnlI | ApoI MboII V T S S A E P T T V S E F T S S V E P T S L H P L N L L L S V N S P L L L N L P H F I R * T Y Y C Q * I H L F C * T Y Q ----:----|----:----|----:----|----:----|----:----|----:----| T V E D A S G V V T L S N V E E T S G V L * K M R Q V * * Q * H I * R K Q Q V * D S * G S F R S S D T F E G R R N F R G Tsp4CI* SetI | HphI |MaeI | | ApoI ||FokI | | TspEI ||| TspDTI BseGI | | EcoRI ||| | MaeIII | AciI | | |MboII ||| | Tsp45I | | NspBII* SetI | | ||TspRI SetI Ksp632I* \\\ \ \ \ \ \ \ \ \ \\\ \ \ AGGTCTAGTCAAGTCACTTCATCCGCTGAACCTACTACTGTCAGTGAATTCACCTCTTCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAGATCAGTTCAGTGAAGTAGGCGACTTGGATGATGACAGTCACTTAAGTGGAGAAGA / / // / / / / // / / // | | || FokI Tsp45I | SetI || HphI | |SetI | | |MaeI MaeIII NspBII* |TspRI | EcoRI | | TspDTI BseGI AciI Tsp4CI* | TspEI | EcoRII | ApoI | SexAI MboII | BssKI BseBI ScrFI R S S Q V T S S A E P T T V S E F T S S G L V K S L H P L N L L L S V N S P L L V * S S H F I R * T Y Y C Q * I H L F C ----:----|----:----|----:----|----:----|----:----|----:----| L D L * T V E D A S G V V T L S N V E E W T * D L * K M R Q V * * Q * H I * R K P R T L D S * G S F R S S D T F E G R R SetI |BssKI |SexAI |EcoRII || ScrFI || BseBI Tsp4CI* || | SetI | HphI || | |MaeI | | ApoI || | ||FokI | | TspEI || | ||| TspDTI BseGI | | EcoRI || | ||| | MaeIII | AciI | | |MboII MnlI || | ||| | Tsp45I | | NspBII* SetI | | ||TspRI \ \\ \ \\\ \ \ \ \ \ \ \ \ \\\ GTTGAACCTACCAGGTCTAGTCAAGTCACTTCATCCGCTGAACCTACTACTGTCAGTGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTGGATGGTCCAGATCAGTTCAGTGAAGTAGGCGACTTGGATGATGACAGTCACTT // / // / // / / / / // / / || SetI || | || FokI Tsp45I | SetI || HphI MboII |Ksp632I* || | |MaeI MaeIII NspBII* |TspRI MnlI || | TspDTI BseGI AciI Tsp4CI* || EcoRII || SexAI || BssKI |BseBI |ScrFI SetI V E P T R S S Q V T S S A E P T T V S E L N L P G L V K S L H P L N L L L S V N * T Y Q V * S S H F I R * T Y Y C Q * I ----:----|----:----|----:----|----:----|----:----|----:----| T S G V L D L * T V E D A S G V V T L S Q Q V * W T * D L * K M R Q V * * Q * H N F R G P R T L D S * G S F R S S D T F SetI |MaeI ||FokI ||| TspDTI BseGI Ksp632I* ||| | MaeIII | AciI SetI | MnlI SetI ||| | Tsp45I | | NspBII* SetI \ \ \ \ \\\ \ \ \ \ \ \ TTCACCTCTTCTGTTGAACCTATCAGGTCTAGTCAAGTCACTTCATCCGCTGAACCTACT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGGAGAAGACAACTTGGATAGTCCAGATCAGTTCAGTGAAGTAGGCGACTTGGATGA // // / / // / / / / |SetI || SetI SetI || FokI Tsp45I | SetI EcoRI |Ksp632I* |MaeI MaeIII NspBII* TspEI MnlI TspDTI BseGI AciI ApoI F T S S V E P I R S S Q V T S S A E P T S P L L L N L S G L V K S L H P L N L L H L F C * T Y Q V * S S H F I R * T Y Y ----:----|----:----|----:----|----:----|----:----|----:----| N V E E T S G I L D L * T V E D A S G V I * R K Q Q V * * T * D L * K M R Q V * E G R R N F R D P R T L D S * G S F R S MboII Tsp4CI* |MaeIII Ksp632I* SetI MaeIII | HphI |Tsp45I SetI | MnlI SetI |MaeI Tsp45I \ \ \\ \ \ \ \ \\ \ ACTGTAAGTGAAGTCACCTCTTCTGTTGAACCTATCAGGTCTAGTCAAGTGACCACGACA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGACATTCACTTCAGTGGAGAAGACAACTTGGATAGTCCAGATCAGTTCACTGGTGCTGT / / / / / // / / / / | HphI | | Tsp45I || SetI SetI MaeI Tsp45I Tsp4CI* | | MaeIII |Ksp632I* MaeIII | SetI MnlI MboII T V S E V T S S V E P I R S S Q V T T T L * V K S P L L L N L S G L V K * P R Q C K * S H L F C * T Y Q V * S S D H D R ----:----|----:----|----:----|----:----|----:----|----:----| V T L S T V E E T S G I L D L * T V V V * Q L H L * R K Q Q V * * T * D L S W S S Y T F D G R R N F R D P R T L H G R C EcoP15I | AccI MboII | |Hpy166II | AlwNI | ||Hin4II* MboII Ksp632I* | | SetI | ||| HphI |TspRI SetI | MnlI SetI \ \ \ \ \\\ \ \\ \ \ \ \ GAACCTGTTTCTTCCTTCGGGTCTACTTTCAGTGAAATCACCTCTTCTGCTGAACCTCTC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGACAAAGAAGGAAGCCCAGATGAAAGTCACTTTAGTGGAGAAGACGACTTGGAGAG // / // / / / / // / |SetI | || | HphI | SetI || SetI AlwNI | || TspRI MboII |Ksp632I* MboII | |AccI MnlI | Hpy166II | Hin4II* EcoP15I E P V S S F G S T F S E I T S S A E P L N L F L P S G L L S V K S P L L L N L S T C F F L R V Y F Q * N H L F C * T S L ----:----|----:----|----:----|----:----|----:----|----:----| S G T E E K P D V K L S I V E E A S G R L V Q K K R R T * K * H F * R K Q Q V E F R N R G E P R S E T F D G R R S F R E AciI | BseRI | |TfiI MnlI | |HinfI HphI MnlI BsrI \ \ \\ \ \ \ TCTTTCAGTAAAGCAACCACTTCCGCAGAATCTATCTCCTCTAATCAAATCACCATTTCC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAGTCATTTCGTTGGTGAAGGCGTCTTAGATAGAGGAGATTAGTTTAGTGGTAAAGG / / / / / / MnlI BseRI HinfI HphI MnlI TspRI AciI TfiI BsrI S F S K A T T S A E S I S S N Q I T I S L S V K Q P L P Q N L S P L I K S P F P F Q * S N H F R R I Y L L * S N H H F Q ----:----|----:----|----:----|----:----|----:----|----:----| E K L L A V V E A S D I E E L * I V M E R K * Y L L W K R L I * R R * D F * W K R E T F C G S G C F R D G R I L D G N G DdeI |Hpy188I |Ksp632I* TspEI || MboII | MboII || |TfiI Hpy166II | | BseMII || |MnlI Hin4II* | TspRI MaeI | | |BspCNI || |HinfI | TatI \ \ \ \ \ \\ \\ \\ \ \ AGTGAACTAATAGTTTCTAGTGTAATTACTTCCTCTTCTGAGATTCCTTCTTCCATTGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTGATTATCAAAGATCACATTAATGAAGGAGAAGACTCTAAGGAAGAAGGTAACTT / / / // / /// / / Hpy166II MaeI | |BspCNI | ||| HinfI Hin4II* | BseMII | ||| TfiI | TspEI | ||Ksp632I* MboII | |MnlI | |DdeI | MboII Hpy188I S E L I V S S V I T S S S E I P S S I E V N * * F L V * L L P L L R F L L P L K * T N S F * C N Y F L F * D S F F H * S ----:----|----:----|----:----|----:----|----:----|----:----| L S S I T E L T I V E E E S I G E E M S W H V L L K * H L * K R K Q S E K K W Q T F * Y N R T Y N S G R R L N R R G N F AciI TspDTI BstXI | MboI | MboII | | DpnI | | AsuI* Csp6I | | |BstKTI | | AvaII |RsaI | | || BinI* | | |BmgT120I |ScaI FauI | | || | MmeI | | || SetI \\ \ \ \ \\ \ \ \ \ \\ \ GTACTTACTTCAAGCGGGATCAGTTCATCAGTTGAACCCACTTCTTTGGTTGGACCTTCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CATGAATGAAGTTCGCCCTAGTCAAGTAGTCAACTTGGGTGAAGAAACCAACCTGGAAGA /// / / / // / / / / / /// ||TatI | | | || MboI | MmeI BstXI | ||AvaII |Csp6I | | | |DpnI BinI* | ||AsuI* ScaI | | | BstKTI | |BmgT120I RsaI | | AciI | SetI | TspDTI MboII FauI V L T S S G I S S S V E P T S L V G P S Y L L Q A G S V H Q L N P L L W L D L L T Y F K R D Q F I S * T H F F G W T F F ----:----|----:----|----:----|----:----|----:----|----:----| T S V E L P I L E D T S G V E K T P G E L V * K L R S * N M L Q V W K K P Q V K Y K S * A P D T * * N F G S R Q N S R R Hpy188I | Hin4II* Eco57I | | TfiI Eco57MI | | HinfI | BseGI EcoP15I | | |MboII TspDTI FokI | | BceAI | CviJI \ \ \\ \ \ \ \ \ \ \ TCTGATGAATCCATTTCTTCTACTGAAAGTCTATCTGCCACATCCACTTTCACTTCAGCC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTACTTAGGTAAAGAAGATGACTTTCAGATAGACGGTGTAGGTGAAAGTGAAGTCGG / / / / / / / / / / / | | | HinfI TspDTI FokI | BseGI BceAI | CviJI | | | TfiI Eco57MI EcoP15I | | MboII Eco57I | Hin4II* Hpy188I S D E S I S S T E S L S A T S T F T S A L M N P F L L L K V Y L P H P L S L Q P * * I H F F Y * K S I C H I H F H F S R ----:----|----:----|----:----|----:----|----:----|----:----| E S S D M E E V S L R D A V D V K V E A K Q H I W K K * Q F D I Q W M W K * K L R I F G N R R S F T * R G C G S E S * G BbvI | AvaI | XhoI | SmlI | PspXI | |TaqI BinI* | |BmeT110I | MboI | || MnlI | XhoII | || |TseI | | DpnI | || |CviJI | | |BstKTI | || ||BisI | | || Tsp4CI* | || |||BlsI | | || | TspRI Hpy188I \ \\ \\\\ \ \ \\ \ \ \ GTTGTTTCCTCGAGCAAGGCTGCTGATTTCTTTACCAGATCCACTGTTTCTGCTAAATCT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAAGGAGCTCGTTCCGACGACTAAAGAAATGGTCTAGGTGACAAAGACGATTTAGA / // / //// / // / / / | || | |||TseI | || | Tsp4CI* Hpy188I | || | ||BisI | || XhoII | || | |BlsI | || MboI | || | CviJI | |TspRI | || MnlI | |DpnI | |PspXI | BstKTI | |SmlI BinI* | |XhoI | |AvaI | BmeT110I | TaqI BbvI V V S S S K A A D F F T R S T V S A K S L F P R A R L L I S L P D P L F L L N L C F L E Q G C * F L Y Q I H C F C * I * ----:----|----:----|----:----|----:----|----:----|----:----| T T E E L L A A S K K V L D V T E A L D R Q K R S C P Q Q N R * W I W Q K Q * I N N G R A L S S I E K G S G S N R S F R BseRI | BsmAI | |MaeIII MnlI SetI CspCI Hin4II* \ \\ \ \ \ \ GATGTCTCTGGTAACTCCTCTACCCAATCTACTACCTTTTTTGCTACGCCTTCCACTCCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGAGACCATTGAGGAGATGGGTTAGATGATGGAAAAAACGATGCGGAAGGTGAGGT / / / / / / / BseRI | MaeIII MnlI SetI CspCI Hin4II* BsmAI D V S G N S S T Q S T T F F A T P S T P M S L V T P L P N L L P F L L R L P L H C L W * L L Y P I Y Y L F C Y A F H S T ----:----|----:----|----:----|----:----|----:----|----:----| S T E P L E E V W D V V K K A V G E V G Q H R Q Y S R * G I * * R K Q * A K W E I D R T V G R G L R S G K K S R R G S W CspCI |Tsp4CI* || MaeIII || Tsp45I || | MaeI || | | AluI || | | CviJI TfiI Eco57I MboII || | | | SetI HinfI Eco57MI SspI \ \\ \ \ \ \ \ \ \ CTTGCTGTTTCTTCAACTGTGGTCACTAGCTCTACCGATTCAGTTTCTCCTAATATTCCC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGACAAAGAAGTTGACACCAGTGATCGAGATGGCTAAGTCAAAGAGGATTATAAGGG / / / //// / / / / MboII | Tsp4CI* |||CviJI | Eco57MI SspI TspRI CspCI |||AluI | Eco57I ||MaeI HinfI |SetI TfiI Tsp45I MaeIII L A V S S T V V T S S T D S V S P N I P L L F L Q L W S L A L P I Q F L L I F P C C F F N C G H * L Y R F S F S * Y S L ----:----|----:----|----:----|----:----|----:----|----:----| S A T E E V T T V L E V S E T E G L I G V Q Q K K L Q P * * S * R N L K E * Y E K S N R * S H D S A R G I * N R R I N G Hpy178III* | HinfI | | MnlI | | | AccI | | | |Hpy166II | | | ||PleI | | | |||MlyI | | | |||| FokI | | | |||| |CviRI* | | | |||| ||TspEI | | | |||| ||| MaeII | | | |||| ||| | AccI | | | |||| ||| | SetI | | | |||| ||| | TaiI | | | |||| ||| | |Hpy166II | | | |||| ||| | || BseGI | | | |||| ||| | || | TspDTI | | | |||| ||| | || | | MaeI GsuI | | | |||| ||| | || | | | AluI Eco57MI | | | |||| ||| | || | | | CviJI | TspRI | | | |||| ||| | || | | | BseMII | Hin4II* | | | |||| ||| | || | | | |BspCNI \ \ \ \ \ \\\\ \\\ \ \\ \ \ \ \\ TTCAGTGAAATCAGTTCCTCTCCAGAGTCGTCTACTGCAATTACGTCTACATCCACTAGC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCACTTTAGTCAAGGAGAGGTCTCAGCAGATGACGTTAATGCAGATGTAGGTGATCG / / / / / /// / / / / /// //// | Hin4II* | | | ||| | | | | ||TspDTI |||BsrDI Eco57MI | | | ||| | | | | |AccI ||CviJI GsuI | | | ||| | | | | Hpy166II ||AluI | | | ||| | | | | BseGI |BspCNI | | | ||| | | | MaeII |MaeI | | | ||| | | TspEI BseMII | | | ||| | | TaiI SetI | | | ||| | | SetI | | | ||| | FokI | | | ||| CviRI* | | | ||PleI | | | ||MlyI | | | |AccI | | | Hpy166II | | HinfI | MnlI Hpy178III* F S E I S S S P E S S T A I T S T S T S S V K S V P L Q S R L L Q L R L H P L A Q * N Q F L S R V V Y C N Y V Y I H * L ----:----|----:----|----:----|----:----|----:----|----:----| K L S I L E E G S D D V A I V D V D V L R * H F * N R E L T T * Q L * T * M W * E T F D T G R W L R R S C N R R C G S A DdeI EspI* | MboII SetI | |AciI FalI |BsrDI | |BsrBI FalI \\ \ \\ \ TTCATTGCTGAGCGGACTTCTTCCTTATATCTTTCGTCATCAAATATGTCAAGTTTCACT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAACGACTCGCCTGAAGAAGGAATATAGAAAGCAGTAGTTTATACAGTTCAAAGTGA /// / / ||| AciI FalI ||BsrBI FalI |EspI* |DdeI MboII F I A E R T S S L Y L S S S N M S S F T S L L S G L L P Y I F R H Q I C Q V S L H C * A D F F L I S F V I K Y V K F H F ----:----|----:----|----:----|----:----|----:----|----:----| K M A S R V E E K Y R E D D F I D L K V S * Q Q A S K K R I D K T M L Y T L N * E N S L P S R G * I K R * * I H * T E S TaqI ClaI |MboI |MboII MseI |TspDTI | TatI FalI || DpnI | |Csp6I FalI || |PvuI BsmAI | ||RsaI |Tsp4CI* || |McrI* Esp3I NlaIV | ||ScaI || TspRI || |BstKTI | Ksp632I* | SetI \ \\\ \\ \ \\ \\ \ \ \ \ TTAAGTACTTTCACTGTTTCCCAATCGATCGTCTCTTCATTTTCTATGGAACCTACATCG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCATGAAAGTGACAAAGGGTTAGCTAGCAGAGAAGTAAAAGATACCTTGGATGTAGC / //// / // // / / / / | |||| Tsp4CI* || || MboI | | NlaIV | |||TspRI || |DpnI | | SetI | |||FalI || BstKTI | Ksp632I* | |||FalI || McrI* Esp3I | ||TatI || ClaI BsmAI | |Csp6I || TaqI | ScaI || PvuI | RsaI |MboII MseI TspDTI L S T F T V S Q S I V S S F S M E P T S * V L S L F P N R S S L H F L W N L H R K Y F H C F P I D R L F I F Y G T Y I V ----:----|----:----|----:----|----:----|----:----|----:----| K L V K V T E W D I T E E N E I S G V D K L Y K * Q K G I S R R K M K * P V * M * T S E S N G L R D D R * K R H F R C R MnlI | SmlI | | Hpy178III* | | | BciVI MwoI | | | | MnlI BstAPI SfaNI | | | | SfaNI | SfaNI | Bce83I* | | | | TspEI | CviRI* | | DdeI | | | | | CviRI* \ \ \ \ \ \ \ \ \ \ \ TCAGTCGCATCTTTTGCATCAAGTTCCCCTCTCTTAGTATCCTCAAGAAGTAATTGCAGT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCAGCGTAGAAAACGTAGTTCAAGGGGAGAGAATCATAGGAGTTCTTCATTAACGTCA / / / / / // // / /// | | | | SfaNI |MnlI || | ||CviRI* | | | Bce83I* DdeI || | |TspEI | | SfaNI || | |SfaNI | CviRI* || | TspRI BstAPI || MnlI MwoI |BciVI Hpy178III* SmlI S V A S F A S S S P L L V S S R S N C S Q S H L L H Q V P L S * Y P Q E V I A V S R I F C I K F P S L S I L K K * L Q * ----:----|----:----|----:----|----:----|----:----|----:----| D T A D K A D L E G R K T D E L L L Q L T L R M K Q M L N G E R L I R L F Y N C * D C R K C * T G R E * Y G * S T I A T BtsI BccI TspRI |AciI MmeI XmnI \ \\ \ \ GATGCCAGAAGTTCCAACACCATCAGTAGCGGTCTGTTCAGCACGATAGAAAATGTTCGT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGGTCTTCAAGGTTGTGGTAGTCATCGCCAGACAAGTCGTGCTATCTTTTACAAGCA / / / / / BtsI | AciI MmeI XmnI BccI D A R S S N T I S S G L F S T I E N V R M P E V P T P S V A V C S A R * K M F V C Q K F Q H H Q * R S V Q H D R K C S * ----:----|----:----|----:----|----:----|----:----|----:----| S A L L E L V M L L P R N L V I S F T R H H W F N W C W * Y R D T * C S L F H E I G S T G V G D T A T Q E A R Y F I N T BsiI* Hpy178III* | TspDTI | | AluI CviRI* | | CviJI | SetI MnlI SetI TspEI | | | SetI \ \ \ \ \ \ \ \ \ AATGCAACCTCAACATTTACAAACCTATCAACAGATGAAATTGTCATCACGAGCTGTAAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTTGGAGTTGTAAATGTTTGGATAGTTGTCTACTTTAACAGTAGTGCTCGACATTC / / / / / / //// | SetI MnlI SetI TspEI | |||CviJI CviRI* | |||AluI | ||BsiI* | |SetI | Hpy178III* TspDTI N A T S T F T N L S T D E I V I T S C K M Q P Q H L Q T Y Q Q M K L S S R A V R C N L N I Y K P I N R * N C H H E L * E ----:----|----:----|----:----|----:----|----:----|----:----| L A V E V N V F R D V S S I T M V L Q L Y H L R L M * L G I L L H F Q * * S S Y I C G * C K C V * * C I F N D D R A T L Hin4I TatI | Bce83I* |Csp6I | | MboII Tsp4CI* ||RsaI | | |TspDTI SmlI | Hin4I \\\ \ \ \\ \ \ \ AGTAGTTGTACTAATGAAGATAGTGTTTTGACGAAAACTCAAGTTTCTACCGTTGAAACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCAACATGATTACTTCTATCACAAAACTGCTTTTGAGTTCAAAGATGGCAACTTTGA /// / / / / / / ||TatI | | TspDTI SmlI | Tsp4CI* |Csp6I | | MboII Hin4I RsaI | Bce83I* Hin4I S S C T N E D S V L T K T Q V S T V E T V V V L M K I V F * R K L K F L P L K L * L Y * * R * C F D E N S S F Y R * N Y ----:----|----:----|----:----|----:----|----:----|----:----| L L Q V L S S L T K V F V * T E V T S V S Y N Y * H L Y H K S S F E L K * R Q F T T T S I F I T N Q R F S L N R G N F S BetI* |HpaII SpeI Csp6I ||BsmAI MseI |MaeI |RsaI MslI |||MaeIII VspI \\ \\ \ \\\\ \ ACTATAACTAGTTGTTCGGGTGGTATTTGTACCACGCTGATGTCTCCGGTTACTACTATT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGATATTGATCAACAAGCCCACCATAAACATGGTGCGACTACAGAGGCCAATGATGATAA // // / // / / |SpeI |Csp6I MslI || | MaeIII MaeI RsaI || BsmAI |BetI* HpaII T I T S C S G G I C T T L M S P V T T I L * L V V R V V F V P R * C L R L L L L Y N * L F G W Y L Y H A D V S G Y Y Y * ----:----|----:----|----:----|----:----|----:----|----:----| V I V L Q E P P I Q V V S I D G T V V I * * L * N N P H Y K Y W A S T E P * * * S Y S T T R T T N T G R Q H R R N S S N SecI* DsaI* | Tsp4CI* DdeI | | TaqI Bpu10I MseI SfeI* | | McrI* \ \ \ \ \ \ AATGCTAAGGCGAACACATTAACAACTACAGAAACTTCCACGGTCGAAACAACTATAACA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGATTCCGCTTGTGTAATTGTTGATGTCTTTGAAGGTGCCAGCTTTGTTGATATTGT / / / / // / VspI Bpu10I MseI SfeI* || TaqI MseI DdeI |DsaI* |SecI* |McrI* Tsp4CI* N A K A N T L T T T E T S T V E T T I T M L R R T H * Q L Q K L P R S K Q L * Q C * G E H I N N Y R N F H G R N N Y N N ----:----|----:----|----:----|----:----|----:----|----:----| L A L A F V N V V V S V E V T S V V I V * H * P S C M L L * L F K W P R F L * L I S L R V C * C S C F S G R D F C S Y C FatI |CviAII || NspI || NlaIII || |BssKI || |SecI* Tsp4CI* || |EcoRII | BsrI || || ScrFI | | MaeIII || || BseBI TaqI | | | HphI \\ \\ \ \ \ \ \ \ ACATGCCCTGGTGGTGTTTGCTCGACCCTGACTGTTCCAGTTACTACAATCACCAGCGAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACGGGACCACCACAAACGAGCTGGGACTGACAAGGTCAATGATGTTAGTGGTCGCTT / // /// / / / / / | || ||EcoRII TaqI | BsrI | MaeIII | || ||BssKI Tsp4CI* HphI | || |SecI* | || BseBI | || ScrFI | |FatI | CviAII NlaIII NspI T C P G G V C S T L T V P V T T I T S E H A L V V F A R P * L F Q L L Q S P A K M P W W C L L D P D C S S Y Y N H Q R S ----:----|----:----|----:----|----:----|----:----|----:----| V H G P P T Q E V R V T G T V V I V L S L M G Q H H K S S G S Q E L * * L * W R C A R T T N A R G Q S N W N S C D G A F MboII | EcoRV | | MboII | | |TspDTI CviJI AciI | | || MboII \ \ \ \ \\ \ GCCACTACCACCGCTACCATTAGTTGCGAAGATAATGAAGAAGATATCACTTCTACTGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGATGGTGGCGATGGTAATCAACGCTTCTATTACTTCTTCTATAGTGAAGATGACTT / / / / / / CviJI AciI MboII | | MboII | TspDTI | MboII EcoRV A T T T A T I S C E D N E E D I T S T E P L P P L P L V A K I M K K I S L L L K H Y H R Y H * L R R * * R R Y H F Y * N ----:----|----:----|----:----|----:----|----:----|----:----| A V V V A V M L Q S S L S S S I V E V S L W * W R * W * N R L Y H L L Y * K * Q G S G G S G N T A F I I F F I D S R S F SpeI Csp6I |MaeI |RsaI \\ \\ ACCGAGTTGCTAACTTTGGAAACTACTATAACTAGTTGTTCGGGTGGTATTTGTACCACG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCTCAACGATTGAAACCTTTGATGATATTGATCAACAAGCCCACCATAAACATGGTGC // // |SpeI |Csp6I MaeI RsaI T E L L T L E T T I T S C S G G I C T T P S C * L W K L L * L V V R V V F V P R R V A N F G N Y Y N * L F G W Y L Y H A ----:----|----:----|----:----|----:----|----:----|----:----| V S N S V K S V V I V L Q E P P I Q V V F R T A L K P F * * L * N N P H Y K Y W G L Q * S Q F S S Y S T T R T T N T G R BetI* |HpaII ||BsmAI MseI DdeI MslI |||MaeIII VspI Bpu10I MseI SfeI* \ \\\\ \ \ \ \ CTGATGTCTCCGGTTACTACTATTAATGCTAAGGCGAACACATTAACAACTACAGAAACT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GACTACAGAGGCCAATGATGATAATTACGATTCCGCTTGTGTAATTGTTGATGTCTTTGA / // / / / / / / MslI || | MaeIII VspI Bpu10I MseI SfeI* || BsmAI MseI DdeI |BetI* HpaII L M S P V T T I N A K A N T L T T T E T * C L R L L L L M L R R T H * Q L Q K L D V S G Y Y Y * C * G E H I N N Y R N F ----:----|----:----|----:----|----:----|----:----|----:----| S I D G T V V I L A L A F V N V V V S V A S T E P * * * * H * P S C M L L * L F Q H R R N S S N I S L R V C * C S C F S SecI* DsaI* FatI | Tsp4CI* |CviAII | | TaqI || NspI | | McrI* || NlaIII TaqI Tsp4CI* \ \ \ \\ \ \ \ TCCACGGTCGAAACAACTATAACAACATGCTCTGGTGGTGTTTGCTCGACCCTGACTGTT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGCCAGCTTTGTTGATATTGTTGTACGAGACCACCACAAACGAGCTGGGACTGACAA // / / // / / / || TaqI | |FatI TaqI | BsrI |DsaI* | CviAII Tsp4CI* |SecI* NlaIII |McrI* NspI Tsp4CI* S T V E T T I T T C S G G V C S T L T V P R S K Q L * Q H A L V V F A R P * L F H G R N N Y N N M L W W C L L D P D C S ----:----|----:----|----:----|----:----|----:----|----:----| E V T S V V I V V H E P P T Q E V R V T K W P R F L * L L M S Q H H K S S G S Q G R D F C S Y C C A R T T N A R G Q S N BsrI | MaeIII | | HphI AciI Hin4I \ \ \ \ \ CCAGTTACTACAATCACCAGCGAAGCAACTACCACCGCTACCATTAGTTGCGAAGATAAT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAATGATGTTAGTGGTCGCTTCGTTGATGGTGGCGATGGTAATCAACGCTTCTATTA / / / / | MaeIII AciI Hin4I HphI P V T T I T S E A T T T A T I S C E D N Q L L Q S P A K Q L P P L P L V A K I M S Y Y N H Q R S N Y H R Y H * L R R * * ----:----|----:----|----:----|----:----|----:----|----:----| G T V V I V L S A V V V A V M L Q S S L E L * * L * W R L L * W R * W * N R L Y W N S C D G A F C S G G S G N T A F I I MboII |TspDTI SpeI MboII || MboII MnlI Hin4I |MaeI \ \\ \ \ \ \\ GAAGAAGATGTCGCCTCTACTAAAACCGAGTTGCTAACTATGGAAACTACTATTACTAGT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTACAGCGGAGATGATTTTGGCTCAACGATTGATACCTTTGATGATAATGATCA / / / / / // MboII | MboII | Hin4I |SpeI TspDTI MnlI MaeI MboII E E D V A S T K T E L L T M E T T I T S K K M S P L L K P S C * L W K L L L L V R R C R L Y * N R V A N Y G N Y Y Y * L ----:----|----:----|----:----|----:----|----:----|----:----| S S S T A E V L V S N S V I S V V I V L H L L H R R * * F R T A L * P F * * * * F F I D G R S F G L Q * S H F S S N S T BetI* |HpaII CviRI* MslI ||BsmAI CviJI \ \ \\\ \ TGTTCGGGTGGTATTTGCACCACGCTGATGTCTCCGGTTAGTAGTTTCAACTCCAAAGCC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGCCCACCATAAACGTGGTGCGACTACAGAGGCCAATCATCAAAGTTGAGGTTTCGG / / // / / CviRI* MslI || BsmAI CviJI |BetI* HpaII C S G G I C T T L M S P V S S F N S K A V R V V F A P R * C L R L V V S T P K P F G W Y L H H A D V S G * * F Q L Q S H ----:----|----:----|----:----|----:----|----:----|----:----| Q E P P I Q V V S I D G T L L K L E L A N N P H Y K C W A S T E P * Y N * S W L T R T T N A G R Q H R R N T T E V G F G FokI | CviRI* | | HinfI | | | SalI | | | |TaqI | | | |AccI | | | ||HindII | | | ||Hpy166II | | | ||| BseGI | | | ||| |PleI TaqI | | | ||| ||MlyI BccI MseI FauI AciI \ \ \ \ \\\ \\\ \ \ \ \ ACTACATCGAACAATGCAGAGTCGACCATCCCCAAAGCGATTAAAGTCAGTTGCTCTGCG 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGTAGCTTGTTACGTCTCAGCTGGTAGGGGTTTCGCTAATTTCAGTCAACGAGACGC / // //// / / / / / TaqI |FokI |||| PleI BccI MseI FauI AciI | |||| MlyI | |||SalI | ||BseGI | ||AccI | ||TaqI | |Hpy166II | |HindII | HinfI CviRI* T T S N N A E S T I P K A I K V S C S A L H R T M Q S R P S P K R L K S V A L R Y I E Q C R V D H P Q S D * S Q L L C G ----:----|----:----|----:----|----:----|----:----|----:----| V V D F L A S D V M G L A I L T L Q E A W * M S C H L T S W G W L S * L * N S Q S C R V I C L R G D G F R N F D T A R R FatI |CviAII || NspI || NlaIII || | Hpy166II HgiCI* SfaNI || | | Hin4I | NlaIV | PshAI || | | Hin4I | | Csp6I | | Tsp4CI* || | | | BetI* | | |RsaI | | | TaqI CviRI* || | | | |HpaII \ \ \\ \ \ \ \ \ \\ \ \ \ \\ GGTGCCTGTACCACCCTGACTACTGTCGATGCAGGGATTAGCATGTTTACCAGAACCGGA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGACATGGTGGGACTGATGACAGCTACGTCCCTAATCGTACAAATGGTCTTGGCCT / / // // / / / // / // | | |Csp6I || | CviRI* | || Hpy166II |BetI* | | RsaI || TaqI | |Hin4I HpaII | HgiCI* |Tsp4CI* | |Hin4I NlaIV PshAI | |FatI SfaNI | CviAII NlaIII NspI G A C T T L T T V D A G I S M F T R T G V P V P P * L L S M Q G L A C L P E P D C L Y H P D Y C R C R D * H V Y Q N R I ----:----|----:----|----:----|----:----|----:----|----:----| P A Q V V R V V T S A P I L M N V L V P P H R Y W G S * Q R H L S * C T * W F R T G T G G Q S S D I C P N A H K G S G S DdeI Bpu10I | SetI | | NlaIV | | | BsgI | | | | SetI | | | | BspCNI | | | | |Csp6I | | | | |BseMII | | | | ||RsaI | | | | ||| FatI | | | | ||| |CviAII MaeIII | | | | ||| || NlaIII Tsp45I | | | | ||| || |MseI Tsp4CI* | | | | ||| || ||HpaI |Hin4I | | | | ||| || ||HindII |Hin4I | | | | ||| || ||Hpy166II \\ \ \ \ \ \\\ \\ \\\ TTGTCTATCACTCAAACTACTGTGACCAACTGCTCAGGTGGAACCTGTACCATGTTAACT 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGATAGTGAGTTTGATGACACTGGTTGACGAGTCCACCTTGGACATGGTACAATTGA / / / // / // /// // // | | Tsp45I || | || ||| || |MseI | | MaeIII || | || ||| || Hpy166II | Tsp4CI* || | || ||| || HindII Hin4I || | || ||| || HpaI Hin4I || | || ||| |FatI || | || ||| CviAII || | || ||NlaIII || | || |Csp6I || | || RsaI || | |BseMII || | BspCNI || NlaIV || SetI || BsgI |Bpu10I |DdeI SetI L S I T Q T T V T N C S G G T C T M L T C L S L K L L * P T A Q V E P V P C * L V Y H S N Y C D Q L L R W N L Y H V N C ----:----|----:----|----:----|----:----|----:----|----:----| N D I V * V V T V L Q E P P V Q V M N V I T * * E F * Q S W S S L H F R Y W T L Q R D S L S S H G V A * T S G T G H * S CviRI* | MwoI CviJI | | Hpy178III* | SecI* | | |NruI | | BglI | | |FnuDII* NmeAIII | | MwoI | | || AciI | TspEI | | | CviJI | | || McrI* HphI | | BseRI | | | | MnlI \ \ \\ \ \ \ \ \ \ \ \ \ \ GCACCAATCGCGACCGCTACCAGCAAAGTCATCTCACCAATTCCAAAAGCCTCCTCGGCT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTTAGCGCTGGCGATGGTCGTTTCAGTAGAGTGGTTAAGGTTTTCGGAGGAGCCGA / / /// / / / / / / / /// | MwoI ||| AciI HphI NmeAIII | TspEI | MwoI ||MnlI CviRI* ||McrI* BseRI | BglI |CviJI |Hpy178III* CviJI SecI* FnuDII* NruI A P I A T A T S K V I S P I P K A S S A H Q S R P L P A K S S H Q F Q K P P R L T N R D R Y Q Q S H L T N S K S L L G Y ----:----|----:----|----:----|----:----|----:----|----:----| A G I A V A V L L T M E G I G F A E E A Q V L R S R * W C L * R V L E L L R R P C W D R G S G A F D D * W N W F G G R S MnlI HgiCI* | BsrDI Tsp4CI* | TspDTI Tsp4CI* | NlaIV TspEI \ \ \ \ \ \ ACTTCCATTGCTCATTCATCTGCTTCTTATACTGTCAGTATCAATACCAACGGTGCCTAT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGGTAACGAGTAAGTAGACGAAGAATATGACAGTCATAGTTATGGTTGCCACGGATA // / / / / |TspDTI Tsp4CI* | | HgiCI* |BsrDI | NlaIV MnlI Tsp4CI* T S I A H S S A S Y T V S I N T N G A Y L P L L I H L L L I L S V S I P T V P I F H C S F I C F L Y C Q Y Q Y Q R C L * ----:----|----:----|----:----|----:----|----:----|----:----| V E M A * E D A E * V T L I L V L P A * * K W Q E N M Q K K Y Q * Y * Y W R H R S G N S M * R S R I S D T D I G V T G I Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| AciI TaqI ||| KpnI MwoI MwoI \ \\\ \ \ \ AATTTCGATAAAGATAACATTTTTGGTACCGCTATCGTTGCTGTTGTCGCTTTATTACTG 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGCTATTTCTATTGTAAAAACCATGGCGATAGCAACGACAACAGCGAAATAATGAC / / / /// / / / | TaqI | ||| | MwoI MwoI TspEI | ||| AciI | ||HgiCI* | ||Acc65I | |Csp6I | NlaIV | RsaI KpnI N F D K D N I F G T A I V A V V A L L L I S I K I T F L V P L S L L L S L Y Y C F R * R * H F W Y R Y R C C C R F I T A ----:----|----:----|----:----|----:----|----:----|----:----| L K S L S L M K P V A I T A T T A K N S Y N R Y L Y C K Q Y R * R Q Q Q R K I V I E I F I V N K T G S D N S N D S * * Q SfeI* \ CTATAG ----:- GATATC / SfeI* L * Y X I X ----:- S Y A I * L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AccI 4 FblI,XmiI AciI 19 BspACI,SsiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 1 AluI 4 AluBI AlwNI 1 CaiI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 4 BseXI,BstV1I,Lsp1109I BccI 3 Bce83I* 2 BpuEI BceAI 4 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 6 BsaWI BglI 1 BinI* 2 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 1 BmgT120I 1 Bpu10I 4 BsaXI 1 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 12 BstF5I,BtsCI BseMII 4 BseRI 3 BseYI 1 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BslFI 1 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 4 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 3 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstKTI 4 BstXI 1 BtsI 2 Cac8I 1 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 21 CviKI-1 CviRI* 10 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 4 MalI DsaI* 3 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 4 EcoP15I 3 EcoRI 5 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 4 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 12 GlaI 1 GsaI 1 GsuI 1 BpmI HaeII 1 BstH2I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 8 HpaI 1 KspAI HpaII 7 HapII,BsiSI,MspI HphI 15 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 KpnI 1 Ksp632I* 11 Eam1104I,EarI,Bst6I MaeI 18 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 18 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 24 McrI* 4 BsiEI,BstMCI,Bsh1285I MlyI 3 SchI MmeI 2 MnlI 33 MroNI 1 NgoMIV MseI 9 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspBII* 7 MspA1I NspI 3 BstNSI,XceI PleI 3 PpsI PshAI 1 BstPAI,BoxI PspXI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 12 AfaI SalI 1 ScaI 5 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 55 SexAI 5 MabI SfaNI 6 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 3 SmoI SpeI 4 BcuI,AhlI SspI 1 TaiI 1 TaqI 18 TatI 6 TauI 1 TfiI 5 PfeI TseI 4 ApeKI Tsp45I 12 NmuCI Tsp4CI* 20 HpyCH4III,TaaI,Bst4CI TspDTI 18 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 14 TscAI TstI 1 VspI 2 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflII AflIII AhaIII* AlfI AloI ApaI ApaLI AscI AsuII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BcgI BdaI BfiI BglII BmtI BplI BsaAI BsaBI BsePI BseSI BsiYI* Bsp120I Bsp1407I BspHI BspLU11I* BspOI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI CauII* Cfr9I CfrI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoT22I EgeI EheI FseI FspAI HaeIII HgaI HgiAI* HindIII Hpy99I KasI MauBI MfeI MluI Mph1103I MstI* NarI NcoI NdeI NheI NotI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PsrI PstI PvuII RsrII SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TsoI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769