Restriction Map of DAN1/YJR150C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DAN1/YJR150C on chromosome X from coordinates 709707 to 708811.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21522

EMBOSS_001 MwoI | BbvI AluI | | FokI CviJI | | | CviRI* | SetI | | | | TspGWI | | MwoI | | | | | AciI | | |AciI | | | | | | MwoI | | |BisI | | | | | | |AciI | | ||BlsI | | | | | | |BisI XbaI | | |||TseI | | | | | | ||BlsI |MaeI | | |||TauI | | | | | | ||Hin4I |Hpy178III* | | ||||BisI | | | | | | |||TauI || TspEI | | |||||BlsI | | | | | | |||BseGI \\ \ \ \ \\\\\\ \ \ \ \ \ \ \\\\ ATGTCTAGAATTAGTATATTAGCTGTCGCCGCAGCATTAGTGGCAAGTGCAACCGCCGCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATCTTAATCATATAATCGACAGCGGCGTCGTAATCACCGTTCACGTTGGCGGCGT // / / / / /////// / / / / //// || TspEI | | | ||||||| MwoI | | | |||AciI |XbaI | | | ||||||TseI | | | ||BisI Hpy178III* | | | |||||BisI | | | |BseGI MaeI | | | ||||BlsI | | | |BlsI | | | |||AciI | | | AciI | | | ||BisI | | | TauI | | | |BlsI | | Hin4I | | | TauI | | MwoI | | MwoI | CviRI* | CviJI | TspGWI | AluI | FokI SetI BbvI M S R I S I L A V A A A L V A S A T A A C L E L V Y * L S P Q H * W Q V Q P P H V * N * Y I S C R R S I S G K C N R R I ----:----|----:----|----:----|----:----|----:----|----:----| X D L I L I N A T A A A N T A L A V A A X T * F * Y I L Q R R L M L P L H L R R H R S N T Y * S D G C C * H C T C G G C MaeIII TspEI Tsp45I | TspDTI CviJI | SfaNI Hin4I | | TspEI | Hpy166II \ \ \ \ \ \ \ \ TCCGTGACCACCACTCTATCCCCTTATGATGAAAGGGTCAATTTGATTGAATTGGCTGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCACTGGTGGTGAGATAGGGGAATACTACTTTCCCAGTTAAACTAACTTAACCGACAA / / / // / / / | SfaNI Hin4I |TspEI | | Hpy166II Tsp45I TspDTI | CviJI MaeIII TspEI S V T T T L S P Y D E R V N L I E L A V P * P P L Y P L M M K G S I * L N W L F R D H H S I P L * * K G Q F D * I G C L ----:----|----:----|----:----|----:----|----:----|----:----| D T V V V R D G * S S L T L K I S N A T M R S W W E I G K H H F P * N S Q I P Q G H G G S * G R I I F P D I Q N F Q S N MaeII | SetI | TaiI | | Hpy188I | | | KasI | | | HgiCI* | | | |AcyI | | | |NarI BssKI | | | |Hin6I EcoRII | | | ||GlaI | MwoI | | | ||DinI | ScrFI | | | ||NlaIV | BseBI | | | |||HhaI Hpy188I | | CviJI | | | ||||HaeII | SspI | | | CviRI* \ \ \ \\\\\ \ \ \ \ \ \ TACGTTTCTGATATTGGCGCCCATTTATCTGAATATTACGCTTTCCAGGCTTTGCATAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCAAAGACTATAACCGCGGGTAAATAGACTTATAATGCGAAAGGTCCGAAACGTATTC / / / ///// / / / / / / | | Hpy188I ||||HgiCI* | SspI | | | CviRI* | MaeII ||||KasI Hpy188I | | EcoRII TaiI |||Hin6I | | BssKI SetI |||NarI | | CviJI |||AcyI | BseBI ||NlaIV | ScrFI ||DinI MwoI ||GlaI |HhaI HaeII Y V S D I G A H L S E Y Y A F Q A L H K T F L I L A P I Y L N I T L S R L C I R R F * Y W R P F I * I L R F P G F A * D ----:----|----:----|----:----|----:----|----:----|----:----| * T E S I P A W K D S Y * A K W A K C L K R K Q Y Q R G N I Q I N R K G P K A Y V N R I N A G M * R F I V S E L S Q M L MwoI StyI | Cfr10I MslI SetI SecI* | |HpaII |FatI | TspEI | CviJI | || HphI ||CviAII \ \ \ \ \ \\ \ \\\ ACTGAAACATACCCACCTGAAATTGCCAAGGCTGTTTTTGCCGGTGGCGATTTCACCACC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTTGTATGGGTGGACTTTAACGGTTCCGACAAAAACGGCCACCGCTAAAGTGGTGG / / // / // // SetI TspEI || MwoI |Cfr10I |NlaIII |CviJI |HphI MslI SecI* HpaII StyI T E T Y P P E I A K A V F A G G D F T T L K H T H L K L P R L F L P V A I S P P * N I P T * N C Q G C F C R W R F H H H ----:----|----:----|----:----|----:----|----:----|----:----| V S V Y G G S I A L A T K A P P S K V V S Q F M G V Q F Q W P Q K Q R H R N * W S F C V W R F N G L S N K G T A I E G G MboI BclI TspDTI | DpnI FatI | |BstKTI NcoI | || AgeI StyI | || BetI* SecI* | || SgrAI DsaI* NlaIII MaeIII | || Cfr10I |CviAII | HindII Tsp45I | || |HpaII || NlaIII | Hpy166II | HphI | || || OliI || |Csp6I | | BsrI SetI | | HphI | || || MslI || ||RsaI \ \ \ \ \ \ \ \ \\ \\ \ \\ \\\ ATGTTGACTGGTATTTCAGGTGATGAAGTGACCAGAATGATCACCGGTGTGCCATGGTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACTGACCATAAAGTCCACTACTTCACTGGTCTTACTAGTGGCCACACGGTACCATG // / / / / / / // / // / // // || | BsrI SetI | | | || | || | || |Csp6I || Hpy166II | | | || | || | || RsaI || HindII | | | || | || | |DsaI* |FatI | | | || | || | |SecI* CviAII | | | || | || | |StyI | | | || | || | |NcoI | | | || | || | |FatI | | | || | || | CviAII | | | || | || NlaIII | | | || | |Cfr10I | | | || | |SgrAI | | | || | |BetI* | | | || | |AgeI | | | || | HpaII | | | || | MslI | | | || | OliI | | | || BclI | | | || MboI | | | |DpnI | | | BstKTI | | TspDTI | Tsp45I | MaeIII | HphI HphI M L T G I S G D E V T R M I T G V P W Y C * L V F Q V M K * P E * S P V C H G T V D W Y F R * * S D Q N D H R C A M V L ----:----|----:----|----:----|----:----|----:----|----:----| M N V P I E P S S T V L I I V P T G H Y W T S Q Y K L H H L S W F S * R H A M T H Q S T N * T I F H G S H D G T H W P V Hin4II* SfeI* TaqII | BaeI TspDTI |MaeI | | SetI | CviRI* ||BccI BcgI Hpy188I | | | BcgI | | PstI \\\ \ \ \ \ \ \ \ \ \ TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGAAGGTATTGCTACTGCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGATCTAACTACCCACGATAAAGGCTTCGTGAACGCTTACTTCCATAACGATGACGT / / / / / / / / / / / / | MaeI BcgI Hpy188I | BaeI | BcgI | | | SfeI* | BccI Hin4II* SetI | | CviRI* TaqII | PstI TspDTI S T R L M G A I S E A L A N E G I A T A L L D * W V L F P K H L R M K V L L L Q Y * I D G C Y F R S T C E * R Y C Y C S ----:----|----:----|----:----|----:----|----:----|----:----| E V L N I P A I E S A S A F S P I A V A S * * I S P H * K R L V Q S H L Y Q * Q R S S Q H T S N G F C K R I F T N S S C MnlI Hpy188I | HindIII | | AluI | | CviJI | | | SetI | | | | MaeI | | | | | MwoI | | | | | |BseMII Csp6I | | | | | ||BspCNI |RsaI | | | | | ||| AciI || MwoI BaeI | | | | | ||| BisI || | AluI MboII | | | | | ||| |BlsI || | CviJI | CviJI | | | | | ||| ||TauI || | | SetI | |Eco57I | | | | | ||| |||MboII || | | | MnlI | |Eco57MI SetI | | | | | ||| |||BbvII* \\ \ \ \ \ \ \\ \ \ \ \ \ \ \\\ \\\\ GTACCAGCTTCTACCACAGAGGCTTCTTCCACCTCCACTTCAGAAGCTTCTAGTGCCGCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CATGGTCGAAGATGGTGTCTCCGAAGAAGGTGGAGGTGAAGTCTTCGAAGATCACGGCGG /// / / // / // / / / / // // //// ||| | | || | |CviJI SetI | | | || || |||MboII ||| | | || | Eco57MI | | | || || |||AciI ||| | | || | Eco57I | | | || || ||TspRI ||| | | || MboII | | | || || ||BisI ||| | | |BaeI | | | || || |BlsI ||| | | MnlI | | | || || TauI ||| | CviJI | | | || |BspCNI ||| | AluI | | | || |MaeI ||| SetI | | | || BseMII ||Csp6I | | | |MwoI |RsaI | | | HindIII MwoI | | CviJI | | AluI | SetI Hpy188I MnlI V P A S T T E A S S T S T S E A S S A A Y Q L L P Q R L L P P P L Q K L L V P P T S F Y H R G F F H L H F R S F * C R H ----:----|----:----|----:----|----:----|----:----|----:----| T G A E V V S A E E V E V E S A E L A A L V L K * W L P K K W R W K L L K * H R Y W S R G C L S R G G G S * F S R T G G DdeI | HinfI | | BseRI | | TspRI | | | MaeI Hpy188I | | | |PleI | BplI | | | ||MlyI | BplI | | | |||AluI | | MnlI AluI TseI BplI | | | |||CviJI | | |BsmAI CviJI |BisI BplI | | | |||| SetI | | |Eco31I BbvI | SetI ||BlsI | EcoP15I \ \ \ \\\\ \ \ \ \\ \ \ \ \\\ \ \ ACTGAGTCTTCTAGCTCCTCTGAAAGTTCAGCAGAGACCAGCTCAAACGCTGCTTCCACC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCAGAAGATCGAGGAGACTTTCAAGTCGTCTCTGGTCGAGTTTGCGACGAAGGTGG /// / /// / / / /// /// / ||| | ||CviJI | MnlI Eco31I ||CviJI ||BplI TspDTI ||| | ||AluI Hpy188I BsmAI ||AluI ||BplI ||| | |PleI BplI |BbvI ||TseI ||| | |MlyI BplI SetI |BisI ||| | |MaeI BlsI ||| | SetI ||| HinfI ||DdeI |BseRI BbvII* T E S S S S S E S S A E T S S N A A S T L S L L A P L K V Q Q R P A Q T L L P P * V F * L L * K F S R D Q L K R C F H P ----:----|----:----|----:----|----:----|----:----|----:----| V S D E L E E S L E A S V L E F A A E V W Q T K * S R Q F N L L S W S L R Q K W S L R R A G R F T * C L G A * V S S G G EcoP15I |TspDTI || AluI || CviJI || | SetI || | | Tsp4CI* || | | | TaqII || | | | | BbvI || | | | | Hpy188I || | | | | |TfiI || | | | | |HinfI || | | | | || MaeI || | | | | || | EcoP15I || | | | | || | |AluI || | | | | || | |CviJI || | | | | || | || SetI || | | | | || | || | TseI || | | | | || | || | |BisI || | | | | || | || | ||BlsI || | | | | || | || | |||CviRI* || | | | | || | || | |||| Cac8I || | | | | || | || | |||| | BsrDI || | | | | || | || | |||| | | CviRI* || | | | | || | || | |||| | | | MwoI || | | | | || | || | |||| | | | BstAPI \\ \ \ \ \ \\ \ \\ \ \\\\ \ \ \ \ CAAGCTACTGTTTCATCTGAATCTAGCTCTGCTGCAAGCACCATTGCAAGTTCTGCTGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGATGACAAAGTAGACTTAGATCGAGACGACGTTCGTGGTAACGTTCAAGACGACTT //// / / / / //// /// / / / / |||| | TaqII | | |||| ||| | BsrDI | BstAPI |||| Tsp4CI* | | |||| ||| Cac8I | MwoI |||CviJI | | |||| ||CviRI* CviRI* |||AluI | | |||| ||TseI ||EcoP15I | | |||| |BisI |SetI | | |||| BlsI EcoP15I | | |||EcoP15I | | ||CviJI | | ||AluI | | |MaeI | | SetI | HinfI | TfiI | BbvI Hpy188I Q A T V S S E S S S A A S T I A S S A E K L L F H L N L A L L Q A P L Q V L L K S Y C F I * I * L C C K H H C K F C * K ----:----|----:----|----:----|----:----|----:----|----:----| W A V T E D S D L E A A L V M A L E A S G L * Q K M Q I * S Q Q L C W Q L N Q Q L S S N * R F R A R S C A G N C T R S F CviRI* | Cac8I | | AluI | | CviJI | | | SetI | | | MwoI | | | BstAPI CviRI* CviRI* | | | | MaeI | Cac8I | Cac8I | | | | | BsaXI | | AluI | | AluI | | | | | |MwoI | | CviJI | | CviJI | | | | | ||GsuI | | | SetI | | | SetI | | | | | ||Eco57MI \ \ \ \ \ \ \ \ \ \ \ \ \ \\\ AGTTCTGTTGCAAGCTCTGTTGCAAGCTCTGTTGCAAGCTCTGCTAGTTTTGCCAATACC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGACAACGTTCGAGACAACGTTCGAGACAACGTTCGAGACGATCAAAACGGTTATGG / / / / / / / /// // / | | CviJI | | CviJI | ||CviJI || Eco57MI | | AluI | | AluI | ||AluI || GsuI | Cac8I | Cac8I | |BstAPI |MwoI | SetI | SetI | |MwoI |MaeI CviRI* CviRI* | Cac8I BsaXI | SetI CviRI* S S V A S S V A S S V A S S A S F A N T V L L Q A L L Q A L L Q A L L V L P I P F C C K L C C K L C C K L C * F C Q Y H ----:----|----:----|----:----|----:----|----:----|----:----| L E T A L E T A L E T A L E A L K A L V F N Q Q L S Q Q L S Q Q L S Q * N Q W Y T R N C A R N C A R N C A R S T K G I G BsrI OliI MboII MslI | BsaXI | BspCNI AluI | | GsuI | |BseMII CviJI | | Eco57MI | ||AsuI* |MboII | | | DdeI | ||AvaII ||SetI | | | | MaeIII | |||BmgT120I Csp6I |||BsrI | | | | Tsp45I | ||||TspRI |RsaI \\\\ \ \ \ \ \ \ \\\\\ \\ ACAGCTCCAGTTTCTTCTACATCTTCTATCTCAGTCACTCCAGTGGTCCAAAATGGTACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGAGGTCAAAGAAGATGTAGAAGATAGAGTCAGTGAGGTCACCAGGTTTTACCATGA / // / / / / / /// // // | |BsrI | BsaXI Eco57MI DdeI | ||| |AvaII |Csp6I | CviJI MboII GsuI | ||| |AsuI* RsaI | MboII | ||| BmgT120I | AluI | ||BseMII SetI | |BspCNI | MslI | OliI Tsp45I MaeIII TspRI BsrI T A P V S S T S S I S V T P V V Q N G T Q L Q F L L H L L S Q S L Q W S K M V L S S S F F Y I F Y L S H S S G P K W Y * ----:----|----:----|----:----|----:----|----:----|----:----| V A G T E E V D E I E T V G T T W F P V W L E L K K * M K * R L * E L P G F H Y C S W N R R C R R D * D S W H D L I T S Bce83I* | DrdI HinfI | | MaeIII | SmlI | | Tsp45I | | HindIII | | Tsp4CI* | | | AluI | | | MlyI | | | CviJI Tsp4CI* SpeI | | | PleI | | | | SetI | TspRI |MaeI \ \ \ \ \ \ \ \ \ \ \ \\ GACAGCACCGTCACAAAGACTCAAGCTTCCACTGTTGAAACTACCATAACTAGTTGTTCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCGTGGCAGTGTTTCTGAGTTCGAAGGTGACAACTTTGATGGTATTGATCAACAAGT / / / /// / /// / / // | | | ||Tsp45I | ||| | Tsp4CI* |SpeI | | | ||MaeIII | ||| HindIII MaeI | | | |PleI | ||| TspRI | | | MlyI | ||CviJI | | Tsp4CI* | ||AluI | DrdI | |SmlI Bce83I* | SetI HinfI D S T V T K T Q A S T V E T T I T S C S T A P S Q R L K L P L L K L P * L V V Q Q H R H K D S S F H C * N Y H N * L F K ----:----|----:----|----:----|----:----|----:----|----:----| S L V T V F V * A E V T S V V M V L Q E Q C C R * L S E L K W Q Q F * W L * N N V A G D C L S L S G S N F S G Y S T T * MaeIII Tsp45I Tsp4CI* | DdeI AluI SfeI* MaeII | |BseRI CviJI | AluI | SetI | || CviJI | SetI | CviJI | TaiI | || |BsrI BsmAI | MnlI | | SetI \ \ \ \\ \\ \ \ \ \ \ \ AATAACGTCTGTTCAACTGTGACTAAGCCAGTCTCCTCCAAAGCTCAATCTACAGCTACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGCAGACAAGTTGACACTGATTCGGTCAGAGGAGGTTTCGAGTTAGATGTCGATGA / / / // // // // /// | MaeII | || |CviJI || |MnlI ||CviJI TaiI | || DdeI || CviJI ||AluI SetI | || BsrI || AluI |SfeI* | |Tsp45I |SetI SetI | |MaeIII BsmAI | BseRI Tsp4CI* N N V C S T V T K P V S S K A Q S T A T I T S V Q L * L S Q S P P K L N L Q L L * R L F N C D * A S L L Q S S I Y S Y F ----:----|----:----|----:----|----:----|----:----|----:----| F L T Q E V T V L G T E E L A * D V A V L Y R R N L Q S * A L R R W L E I * L * I V D T * S H S L W D G G F S L R C S S MaeII |MaeIII MaeIII BsiI* || SetI Tsp45I | SfaNI || TaiI Tsp4CI* \ \ \ \\ \ \ TCTGTCACATCGTCAGCATCTCGTGTTATTGACGTTACCACTAACGGTGCTAACAAGTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAGTGTAGCAGTCGTAGAGCACAATAACTGCAATGGTGATTGCCACGATTGTTCAAG / / / / / / / Tsp45I | | | | MaeIII Tsp4CI* MaeIII | | | MaeII | | TaiI | | SetI | SfaNI BsiI* S V T S S A S R V I D V T T N G A N K F L S H R Q H L V L L T L P L T V L T S S C H I V S I S C Y * R Y H * R C * Q V Q ----:----|----:----|----:----|----:----|----:----|----:----| E T V D D A D R T I S T V V L P A L L N K Q * M T L M E H * Q R * W * R H * C T R D C R * C R T N N V N G S V T S V L E HgiCI* HgiCI* | NlaIV | NlaIV | |MwoI | | AciI | ||AciI | | BisI | ||BisI | | |BlsI | |||BlsI | | ||TseI | ||||TauI | | ||TauI | |||||AciI | | ||NspBII* | |||||BisI | | |||BisI | ||||||BlsI Tsp4CI* | | ||||BlsI | |||||||TauI | BbvI | | ||||| MwoI | |||||||BsrBI \ \ \ \ \\\\\ \ \ \\\\\\\\ AATAACGGTGTTTTCGGTGCCGCTGCTATTGCTGGTGCCGCCGCTCTATTGTTATAG 850 860 870 880 890 ----:----|----:----|----:----|----:----|----:----|----:-- TTATTGCCACAAAAGCCACGGCGACGATAACGACCACGGCGGCGAGATAACAATATC / / //////// / //////// | BbvI |||||||MwoI | |||||||BsrBI Tsp4CI* |||||||TseI | |||||||AciI ||||||BisI | ||||||BisI |||||BlsI | |||||BlsI ||||NspBII* | ||||AciI ||||AciI | ||||TauI |||BisI | |||BisI ||HgiCI* | ||HgiCI* ||BlsI | ||BlsI |TauI | |TauI NlaIV | NlaIV MwoI N N G V F G A A A I A G A A A L L L * I T V F S V P L L L L V P P L Y C Y X * R C F R C R C Y C W C R R S I V I X ----:----|----:----|----:----|----:----|----:----|----:-- L L P T K P A A A I A P A A A R N N Y * Y R H K R H R Q * Q Q H R R E I T I I V T N E T G S S N S T G G S * Q * L # Enzymes that cut Frequency Isoschizomers AciI 7 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 14 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BcgI 1 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 1 BplI 2 BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BsmAI 2 Alw26I,BstMAI BspCNI 2 BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 2 BstKTI 1 Cac8I 4 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 19 CviKI-1 CviRI* 8 HpyCH4V DdeI 3 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 1 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 3 EcoP15I 3 EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FokI 1 GlaI 1 GsuI 2 BpmI HaeII 1 BstH2I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 3 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 6 KasI 1 MaeI 7 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 7 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 2 SchI MnlI 4 MslI 3 RseI,SmiMI MwoI 12 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 2 AleI PleI 2 PpsI PstI 1 RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 21 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SgrAI 1 SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqII 2 TauI 6 TfiI 1 PfeI TseI 4 ApeKI Tsp45I 6 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BalI BamHI BarI BbvCI BceAI BciVI BdaI BfiI BglI BglII BinI* BmeT110I BmtI Bpu10I BsaAI BsaBI BsePI BseSI BseYI BsgI BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DraII DraIII Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI HaeIII HgaI HgiAI* HgiJII* HpaI Hpy99I KpnI Ksp632I* MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MseI MstI* NaeI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SgfI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqI TatI TsoI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769