Restriction Map of BAT2/YJR148W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

BAT2/YJR148W on chromosome X from coordinates 705744 to 706874.


StyI FatI SecI* |CviAII | SetI || NspI | | HgiCI* || CviRI* | | | NlaIV HgaI || NlaIII | | | | MaeI | MseI || | EcoT22I | | | | | AcyI | |MnlI || | | DdeI \ \ \ \ \ \ \ \\ \\ \ \ \ ATGACCTTGGCACCCCTAGACGCCTCCAAAGTTAAGATAACTACCACACAACATGCATCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGAACCGTGGGGATCTGCGGAGGTTTCAATTCTATTGATGGTGTGTTGTACGTAGA / / / / / / /// / /// SetI | | | | AcyI ||MseI | ||CviRI* | | | MaeI |HgaI | ||FatI | | HgiCI* MnlI | |CviAII | NlaIV | EcoT22I SecI* NlaIII StyI NspI M T L A P L D A S K V K I T T T Q H A S * P W H P * T P P K L R * L P H N M H L D L G T P R R L Q S * D N Y H T T C I * ----:----|----:----|----:----|----:----|----:----|----:----| X V K A G R S A E L T L I V V V C C A D X S R P V G L R R W L * S L * W V V H M H G Q C G * V G G F N L Y S G C L M C R AsuI* AvaII |BmgT120I || FatI || AflIII || BspLU11I* || |CviAII || || NspI || || NlaIII || || |MseI || || ||HpaI AluI || || ||HindII CviJI Tsp4CI* CviJI || || ||Hpy166II |SfaNI | TspRI | SetI || || ||| TspGWI \\ \ \ \ \ \\ \\ \\\ \ AAGCCAAAACCGAACAGTGAGTTAGTGTTTGGCAAGAGCTTCACGGACCACATGTTAACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGTTTTGGCTTGTCACTCAATCACAAACCGTTCTCGAAGTGCCTGGTGTACAATTGA // / / / / / // / // // || | | Tsp4CI* | CviJI || | || |MseI || | TspRI | AluI || | || Hpy166II || SfaNI SetI || | || TspGWI |CviJI || | || HindII DdeI || | || HpaI || | |BspLU11I* || | |AflIII || | |FatI || | CviAII || NlaIII || NspI |AvaII |AsuI* BmgT120I K P K P N S E L V F G K S F T D H M L T S Q N R T V S * C L A R A S R T T C * L A K T E Q * V S V W Q E L H G P H V N C ----:----|----:----|----:----|----:----|----:----|----:----| L G F G F L S N T N P L L K V S W M N V * A L V S C H T L T Q C S S * P G C T L L W F R V T L * H K A L A E R V V H * S Acc65I AluI HgiCI* CviJI |Csp6I PvuII ||RsaI NspBII* ||NlaIV AciI | SetI ||| KpnI MseI SetI \ \ \ \\\ \ \ \ GCGGAATGGACAGCTGAAAAAGGGTGGGGTACCCCAGAGATTAAACCTTATCAAAATCTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTACCTGTCGACTTTTTCCCACCCCATGGGGTCTCTAATTTGGAATAGTTTTAGAC / / / / /// // AciI | NspBII* | ||HgiCI* |SetI | PvuII | ||Acc65I MseI | CviJI | |Csp6I | AluI | NlaIV SetI | RsaI KpnI A E W T A E K G W G T P E I K P Y Q N L R N G Q L K K G G V P Q R L N L I K I C G M D S * K R V G Y P R D * T L S K S V ----:----|----:----|----:----|----:----|----:----|----:----| A S H V A S F P H P V G S I L G * * F R Q P I S L Q F L T P Y G L S * V K D F D R F P C S F F P P T G W L N F R I L I Q AciI SecI* DsaI* AluI |BsiYI* CviJI ||AciI |Hin4II* ||FnuDII* ||SetI ||NspBII* ||| TaqI |||SacII ||| AsuII |||| Hin4II* ||| | Hin4II* BseGI \\\\ \ \\\ \ \ \ TCTTTAGACCCTTCCGCGGTGGTTTTCCATTATGCTTTTGAGCTATTCGAAGGGATGAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATCTGGGAAGGCGCCACCAAAAGGTAATACGAAAACTCGATAAGCTTCCCTACTTC / // // / / // / | || |Hin4II* | | || BseGI | || DsaI* | | |Hin4II* | || SecI* | | AsuII | || AciI | | TaqI | |NspBII* | Hin4II* | |FnuDII* | CviJI | |AciI | AluI | SacII SetI BsiYI* S L D P S A V V F H Y A F E L F E G M K L * T L P R W F S I M L L S Y S K G * R F R P F R G G F P L C F * A I R R D E G ----:----|----:----|----:----|----:----|----:----|----:----| D K S G E A T T K W * A K S S N S P I F T K L G K R P P K G N H K Q A I R L S S R * V R G R H N E M I S K L * E F P H L CviJI | FokI Hin6I | | TspDTI |GlaI | | | Tsp4CI* ||FatI | | | | Hpy166II ||HhaI | | | | | TspEI Hpy178III* |||CviAII \ \ \ \ \ \ \ \\\\ GCTTACAGAACGGTGGACAACAAAATTACAATGTTTCGTCCAGATATGAATATGAAGCGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAATGTCTTGCCACCTGTTGTTTTAATGTTACAAAGCAGGTCTATACTTATACTTCGCG / / // / / / /// CviJI | || Hpy166II TspEI Hpy178III* ||TspDTI | |Tsp4CI* ||NlaIII | FokI ||Hin6I TspDTI |GlaI HhaI A Y R T V D N K I T M F R P D M N M K R L T E R W T T K L Q C F V Q I * I * S A L Q N G G Q Q N Y N V S S R Y E Y E A H ----:----|----:----|----:----|----:----|----:----|----:----| A * L V T S L L I V I N R G S I F I F R P K C F P P C C F * L T E D L Y S Y S A S V S R H V V F N C H K T W I H I H L A BspCNI |BseMII || AclI DdeI || MaeII | TspDTI || | SetI TspDTI | |Hpy188I || | TaiI | NlaIII | || TfiI || | |TaqI | | TspDTI | || HinfI || | || Ksp632I* MboII \ \ \ \ \\ \ \\ \ \\ \ \ ATGAATAAGTCTGCTCAGAGAATCTGTTTGCCAACGTTCGACCCAGAAGAGTTGATTACC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATTCAGACGAGTCTCTTAGACAAACGGTTGCAAGCTGGGTCTTCTCAACTAATGG // / / // / // / / / / / || TspDTI | |DdeI | |BseMII | | | Ksp632I* MboII |FatI | | | BspCNI | | TaqI CviAII | | HinfI | MaeII | | TfiI | AclI | Hpy188I TaiI TspDTI SetI M N K S A Q R I C L P T F D P E E L I T * I S L L R E S V C Q R S T Q K S * L P E * V C S E N L F A N V R P R R V D Y P ----:----|----:----|----:----|----:----|----:----|----:----| M F L D A * L I Q K G V N S G S S N I V C S Y T Q E S F R N A L T R G L L T S * H I L R S L S D T Q W R E V W F L Q N G TspEI | BsiYI* | | BinI* | | | MboI DdeI | | | | DpnI | Hin4II* MaeIII | | | | |BstKTI | | Hpy178III* | SetI \ \ \ \ \\ \ \ \ \ \ CTAATTGGGAAACTGATCCAGCAAGATAAGTGCTTAGTTCCTGAAGGAAAAGGTTACTCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATTAACCCTTTGACTAGGTCGTTCTATTCACGAATCAAGGACTTCCTTTTCCAATGAGA / / / // / / / / / / | | | || MboI | | SetI | Eco57MI | | | |DpnI | Hpy178III* | Eco57I | | | BstKTI Hin4II* MaeIII | | BinI* DdeI | TspEI BsiYI* L I G K L I Q Q D K C L V P E G K G Y S * L G N * S S K I S A * F L K E K V T L N W E T D P A R * V L S S * R K R L L F ----:----|----:----|----:----|----:----|----:----|----:----| R I P F S I W C S L H K T G S P F P * E G L Q S V S G A L Y T S L E Q L F L N S * N P F Q D L L I L A * N R F S F T V R CfrI XmaIII* | CviJI | Cfr10I StuI | HaeIII Eco57I CviJI MseI | |HpaII BsiYI* Eco57MI HaeIII VspI | |McrI* | BceAI \ \ \ \ \\ \ \ TTATATATCAGGCCTACATTAATCGGCACTACGGCCGGTTTAGGGGTTTCCACGCCTGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATATATAGTCCGGATGTAATTAGCCGTGATGCCGGCCAAATCCCCAAAGGTGCGGACTA / / // /// / HaeIII VspI || ||Cfr10I BceAI CviJI MseI || ||BsiYI* StuI || |HpaII || XmaIII* || CfrI |HaeIII |CviJI McrI* L Y I R P T L I G T T A G L G V S T P D Y I S G L H * S A L R P V * G F P R L I I Y Q A Y I N R H Y G R F R G F H A * * ----:----|----:----|----:----|----:----|----:----|----:----| K Y I L G V N I P V V A P K P T E V G S K I Y * A * M L R C * P R N L P K W A Q * I D P R C * D A S R G T * P N G R R I AsuI* AvaII DraII TseI PpuMI |BisI |NlaIV BsrI CviJI BbvI ||BlsI |BmgT120I | MseI \ \ \\\ \\ \ \ AGAGCCTTGCTATATGTCATTTGCTGCCCTGTGGGTCCTTATTACAAAACTGGATTTAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGGAACGATATACAGTAAACGACGGGACACCCAGGAATAATGTTTTGACCTAAATTC / / /// /// / / CviJI BbvI ||TseI ||PpuMI BsrI MseI |BisI ||DraII BlsI ||AvaII ||AsuI* |BmgT120I NlaIV R A L L Y V I C C P V G P Y Y K T G F K E P C Y M S F A A L W V L I T K L D L R S L A I C H L L P C G S L L Q N W I * G ----:----|----:----|----:----|----:----|----:----|----:----| L A K S Y T M Q Q G T P G * * L V P N L Y L R A I H * K S G Q P D K N C F Q I * S G Q * I D N A A R H T R I V F S S K L MwoI | AluI | CviJI | | SetI | | |MnlI | | |CfrI | | || BalI | | || BssKI | | || CviJI | | || EcoRII Hpy188I | | || HaeIII CviJI | BsrI | | || | ScrFI | MaeIII AciI | | CviJI TspRI | | || | BseBI | Tsp45I \ \ \ \ \ \ \ \\ \ \ \ \ GCGGTCAGACTGGAAGCCACTGATTATGCCACAAGAGCTTGGCCAGGAGGCTGTGGTGAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCAGTCTGACCTTCGGTGACTAATACGGTGTTCTCGAACCGGTCCTCCGACACCACTG / / / // / / / / / // / / / | | | |CviJI | | | | | || | CviJI Tsp45I | | | TspRI | | | | | || EcoRII MaeIII | | BsrI | | | | | || BssKI | Hpy188I | | | | | |BseBI AciI | | | | | |ScrFI | | | | | CfrI | | | | HaeIII | | | | CviJI | | | | BalI | | | MnlI | | CviJI | | AluI | SetI MwoI A V R L E A T D Y A T R A W P G G C G D R S D W K P L I M P Q E L G Q E A V V T G Q T G S H * L C H K S L A R R L W * Q ----:----|----:----|----:----|----:----|----:----|----:----| A T L S S A V S * A V L A Q G P P Q P S P P * V P L W Q N H W L L K A L L S H H R D S Q F G S I I G C S S P W S A T T V BbvI | MfeI | TspEI | | MwoI | | | CviRI* | | | | Cac8I | | | | | TseI | | | | | AluI SetI | | | | | CviJI |CviRI* | | | | | |BisI MaeI || HgaI | | | | | ||BlsI HphI || |MwoI | | | | | ||SetI \ \\ \\ \ \ \ \ \ \\\ AAGAAACTAGGTGCAAACTACGCCCCCTGCGTCCTGCCACAATTGCAAGCTGCTTCAAGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTGATCCACGTTTGATGCGGGGGACGCAGGACGGTGTTAACGTTCGACGAAGTTCC / // / / / // // / //// | || | MwoI HgaI || || | |||TseI | || CviRI* || || | ||BisI | |MaeI || || | |BlsI | SetI || || | CviJI HphI || || | AluI || || Cac8I || || SetI || |CviRI* || TspEI || MfeI |BbvI MwoI K K L G A N Y A P C V L P Q L Q A A S R R N * V Q T T P P A S C H N C K L L Q G E T R C K L R P L R P A T I A S C F K G ----:----|----:----|----:----|----:----|----:----|----:----| L F S P A F * A G Q T R G C N C A A E L C S V L H L S R G R R G A V I A L Q K L L F * T C V V G G A D Q W L Q L S S * P HgiCI* TsoI AsuI* | NlaIV MaeIII | ApoI AvaII | | FatI BstEII | TspEI CviJI |BmgT120I | | |CviAII \ \ \ \ \\ \ \ \\ GGTTACCAACAAAATTTATGGCTATTTGGTCCAAATAACAACATTACTGAAGTCGGCACC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATGGTTGTTTTAAATACCGATAAACCAGGTTTATTGTTGTAATGACTTCAGCCGTGG // / / // / / |TsoI | CviJI |AvaII | HgiCI* BstEII TspEI |AsuI* | NlaIII MaeIII ApoI BmgT120I NlaIV G Y Q Q N L W L F G P N N N I T E V G T V T N K I Y G Y L V Q I T T L L K S A P L P T K F M A I W S K * Q H Y * S R H H ----:----|----:----|----:----|----:----|----:----|----:----| P * W C F K H S N P G F L L M V S T P V P N G V F N I A I Q D L Y C C * Q L R C T V L L I * P * K T W I V V N S F D A G NlaIII | Eco57I TspDTI SpeI | Eco57MI | MseI |MaeI | |BsmI | |AhaIII* Hin4II* || MaeIII \ \\ \ \\ \ \\ \ ATGAATGCTTTTTTCGTGTTTAAAGATAGTAAAACGGGCAAGAAGGAACTAGTTACTGCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTACGAAAAAAGCACAAATTTCTATCATTTTGCCCGTTCTTCCTTGATCAATGACGA // // / // / // / || |BsmI TspDTI |MseI Hin4II* || MaeIII || Eco57MI AhaIII* |SpeI || Eco57I MaeI |FatI CviAII M N A F F V F K D S K T G K K E L V T A * M L F S C L K I V K R A R R N * L L L E C F F R V * R * * N G Q E G T S Y C S ----:----|----:----|----:----|----:----|----:----|----:----| M F A K K T N L S L L V P L F S S T V A W S H K K R T * L Y Y F P C S P V L * Q H I S K E H K F I T F R A L L F * N S S MaeI | BsiYI* | | Acc65I | | HgiCI* | | Tsp4CI* | | |Csp6I | | ||RsaI | | ||NlaIV SetI | | ||| KpnI MaeIII TfiI MseI MlyI | | ||| | Hin4II* | MaeI HinfI |AhaIII* PleI \ \ \\\ \ \ \ \ \ \\ \ CCACTAGACGGTACCATTTTGGAAGGTGTTACTAGGGATTCCATTTTAAATCTTGCTAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGATCTGCCATGGTAAAACCTTCCACAATGATCCCTAAGGTAAAATTTAGAACGATTT / / // //// / / / / // // | | || |||Hin4II* SetI | MaeI HinfI |MseI |PleI | | || ||HgiCI* MaeIII TfiI AhaIII* MlyI | | || ||Acc65I | | || |Csp6I | | || NlaIV | | || RsaI | | |KpnI | | Tsp4CI* | MaeI BsiYI* P L D G T I L E G V T R D S I L N L A K H * T V P F W K V L L G I P F * I L L K T R R Y H F G R C Y * G F H F K S C * R ----:----|----:----|----:----|----:----|----:----|----:----| G S S P V M K S P T V L S E M K F R A L E V L R Y W K P L H * * P N W K L D Q * W * V T G N Q F T N S P I G N * I K S F BstXI | AsuI* BseMII HinfI | AvaII TstI |BspCNI | TaqI TstI | |BmgT120I Hpy166II SfeI* || MaeIII \ \ \ \ \\ \ \ \\ \ GAAAGACTCGAACCAAGTGAATGGACCATTAGTGAACGCTACTTCACTATAGGCGAAGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTGAGCTTGGTTCACTTACCTGGTAATCACTTGCGATGAAGTGATATCCGCTTCAA / / / // / / // | TaqI BstXI |AvaII | TstI |BspCNI | TstI |AsuI* Hpy166II BseMII HinfI BmgT120I SfeI* E R L E P S E W T I S E R Y F T I G E V K D S N Q V N G P L V N A T S L * A K L K T R T K * M D H * * T L L H Y R R S Y ----:----|----:----|----:----|----:----|----:----|----:----| S L S S G L S H V M L S R * K V I P S T L F V R V L H I S W * H V S S * * L R L F S E F W T F P G N T F A V E S Y A F N DdeI Csp6I BinI* |RsaI | MboI |Hin4I | XhoII Tsp4CI* HphI || TseI | | DpnI | EcoP15I | CviJI || |BisI | | |BstKTI | Hpy166II | | BbvI || ||BlsI \ \ \\ \ \ \ \ \ \\ \\\ ACTGAGAGATCCAAGAACGGTGAACTACTTGAAGCCTTTGGTTCTGGTACTGCTGCGATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCTCTAGGTTCTTGCCACTTGATGAACTTCGGAAACCAAGACCATGACGACGCTAA // / // / / / / / / / // /// || | || XhoII | | | | CviJI | || ||TseI || | || MboI | | | HphI | || |BisI || | |DpnI | | EcoP15I | || BlsI || | BstKTI | Hpy166II | |Csp6I || DdeI Tsp4CI* | RsaI |BinI* Hin4I MaeIII BbvI T E R S K N G E L L E A F G S G T A A I L R D P R T V N Y L K P L V L V L L R L * E I Q E R * T T * S L W F W Y C C D C ----:----|----:----|----:----|----:----|----:----|----:----| V S L D L F P S S S S A K P E P V A A I * Q S I W S R H V V Q L R Q N Q Y Q Q S S L S G L V T F * K F G K T R T S S R N TspEI TspGWI BssKI | MseI | HpaII Hin4I | VspI | ScrFI MseI | CviJI MwoI | | SspI | CauII* \ \ \ \ \ \ \ \ \ GTTTCTCCCATTAAGGAAATCGGCTGGAAAGGCGAACAAATTAATATTCCGTTGTTGCCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAGGGTAATTCCTTTAGCCGACCTTTCCGCTTGTTTAATTATAAGGCAACAACGGG / / / / / // / / | Hin4I | MwoI | || SspI CauII* MseI CviJI | |VspI ScrFI | |MseI | TspEI TspGWI V S P I K E I G W K G E Q I N I P L L P F L P L R K S A G K A N K L I F R C C P F S H * G N R L E R R T N * Y S V V A R ----:----|----:----|----:----|----:----|----:----|----:----| T E G M L S I P Q F P S C I L I G N N G Q K E W * P F R S S L R V F * Y E T T A N R G N L F D A P F A F L N I N R Q Q G AgeI BetI* Cfr10I |HpaII || AsuI* || AvaII || |BmgT120I || || CfrI || || | BalI BsmAI || || | CviJI MseI TfiI |BseMII || || | HaeIII CviRI* VspI HinfI ||BspCNI \\ \\ \ \ \ \ \ \\\ GGCGAACAAACCGGTCCATTGGCCAAAGAAGTTGCACAATGGATTAATGGAATCCAATAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTGTTTGGCCAGGTAACCGGTTTCTTCAACGTGTTACCTAATTACCTTAGGTTATA // //// / / / / / // |BssKI |||AvaII | CfrI CviRI* VspI | |BspCNI HpaII |||AsuI* HaeIII MseI | BseMII ||| CviJI HinfI ||| BalI TfiI ||BmgT120I |Cfr10I |BetI* |AgeI HpaII G E Q T G P L A K E V A Q W I N G I Q Y A N K P V H W P K K L H N G L M E S N M R T N R S I G Q R S C T M D * W N P I W ----:----|----:----|----:----|----:----|----:----|----:----| P S C V P G N A L S T A C H I L P I W Y R R V F R D M P W L L Q V I S * H F G I A F L G T W Q G F F N C L P N I S D L I DdeI | FatI | |CviAII | || NlaIII | || | MfeI | || | TspEI MaeIII \ \\ \ \ \ GGCGAGACTGAGCATGGCAATTGGTCAAGGGTTGTTACTGATTTGAACTGA 1090 1100 1110 1120 1130 ----:----|----:----|----:----|----:----|----:----|- CCGCTCTGACTCGTACCGTTAACCAGTTCCCAACAATGACTAAACTTGACT / // // / / BsmAI || |FatI TspEI MaeIII || CviAII MfeI |NlaIII DdeI G E T E H G N W S R V V T D L N * A R L S M A I G Q G L L L I * T X R D * A W Q L V K G C Y * F E L X ----:----|----:----|----:----|----:----|----:----|- P S V S C P L Q D L T T V S K F Q H R S Q A H C N T L P Q * Q N S S A L S L M A I P * P N N S I Q V S # Enzymes that cut Frequency Isoschizomers Acc65I 2 Asp718I AciI 4 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AluI 5 AluBI ApoI 1 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 5 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BceAI 1 BetI* 1 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 5 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspLU11I* 1 PscI,PciI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BstXI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 5 CviJI 17 CviKI-1 CviRI* 4 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 1 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 KpnI 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 7 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 1 SchI MnlI 2 MseI 10 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 2 BstNSI,XceI PleI 1 PpsI PpuMI 1 Psp5II,PspPPI PvuII 1 RsaI 3 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 3 TfiI 3 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 2 TscAI TstI 1 VspI 3 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AflII AjuI AlfI AloI AlwNI ApaI ApaLI AscI AvaI AvrII BaeI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI BtsI Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FaqI FauI FseI FspAI GsaI GsuI HaeII HgiAI* HgiJII* HindIII Hpy99I KasI MauBI MluI MmeI MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TatI TauI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769