Restriction Map of RPS4A/YJR145C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPS4A/YJR145C on chromosome X from coordinates 703068 to 702027.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.4338

EMBOSS_001 AsuI* AvaII CviJI |BmgT120I PsiI |MaeI || Tsp4CI* SfeI* |TspEI BseGI \\ \\ \ \ \\ \ ATGGCTAGAGGACCGTATGTTTGACTATAGACTTTGATTATAATTACGCAAGGATGAGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATCTCCTGGCATACAAACTGATATCTGAAACTAATATTAATGCGTTCCTACTCTT / / // / / / / | MaeI |Tsp4CI* SfeI* PsiI TspEI BseGI CviJI |AvaII |AsuI* BmgT120I M A R G P Y V * L * T L I I I T Q G * E W L E D R M F D Y R L * L * L R K D E K G * R T V C L T I D F D Y N Y A R M R R ----:----|----:----|----:----|----:----|----:----|----:----| X A L P G Y T Q S Y V K I I I V C P H S X P * L V T H K V I S K S * L * A L I L H S S S R I N S * L S Q N Y N R L S S F HinfI | MseI | | PleI FokI MboII | | |MlyI TsoI BsrI \ \ \ \ \\ \ \ GAATGATAGACAAGAAACAAGTGGAGTCTTAACCAAACGAATAGGAACAACAATGAACCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACTATCTGTTCTTTGTTCACCTCAGAATTGGTTTGCTTATCCTTGTTGTTACTTGGT / / / / / / MboII | | PleI TsoI BsrI FokI | | MlyI | MseI HinfI E * * T R N K W S L N Q T N R N N N E P N D R Q E T S G V L T K R I G T T M N Q M I D K K Q V E S * P N E * E Q Q * T S ----:----|----:----|----:----|----:----|----:----|----:----| S H Y V L F L H L R L W V F L F L L S G L I I S L F C T S D * G F S Y S C C H V F S L C S V L P T K V L R I P V V I F W MboI | DpnI | |BseGI | |BstKTI | || BssKI TspDTI | || EcoRII TatI | FokI | || |SecI* Bsp1407I | | MseI | || ||ScrFI |Csp6I | | |TspEI | || ||BseBI ||RsaI SspI \ \ \\ \ \\ \\\ \\\ \ GTTTATGTCCATTTAATTTTAGATCATCCTGGGATTGTACAAATATTTTACGAGTAATGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAAATACAGGTAAATTAAAATCTAGTAGGACCCTAACATGTTTATAAAATGCTCATTACT / / / // / / / /// / TspDTI | | || MboI | | ||| SspI | | |DpnI | | ||Bsp1407I | | BstKTI | | ||TatI | | BseGI | | |Csp6I | TspEI | | RsaI MseI | EcoRII FokI | BssKI | SecI* BseBI ScrFI V Y V H L I L D H P G I V Q I F Y E * * F M S I * F * I I L G L Y K Y F T S N D L C P F N F R S S W D C T N I L R V M I ----:----|----:----|----:----|----:----|----:----|----:----| T * T W K I K S * G P I T C I N * S Y H L K H G N L K L D D Q S Q V F I K R T I N I D M * N * I M R P N Y L Y K V L L S SduI MboII HgiAI* TspDTI TspDTI \ \ \ TTTACTAACGAGCACAATGAAAAAAATAAAATGTCTGTATCTTCATTATACATTCATTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGATTGCTCGTGTTACTTTTTTTATTTTACAGACATAGAAGTAATATGTAAGTAAAA / // / HgiAI* |MboII TspDTI SduI TspDTI F T N E H N E K N K M S V S S L Y I H F L L T S T M K K I K C L Y L H Y T F I F Y * R A Q * K K * N V C I F I I H S F L ----:----|----:----|----:----|----:----|----:----|----:----| N V L S C L S F F L I D T D E N Y M * K I * * R A C H F F Y F T Q I K M I C E N K S V L V I F F I F H R Y R * * V N M K TseI |BisI ||BlsI |||AluI |||CviJI Csp6I |||| TsoI TspGWI |RsaI SfaNI |||| SetI \ \\ \ \\\\ \ TGCCCTTTTTTCTCATTTTTTTCCGTACAGAAAGAAGCATCTAAAAAGATTAGCAGCTCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ACGGGAAAAAAGAGTAAAAAAAGGCATGTCTTTCTTCGTAGATTTTTCTAATCGTCGAGG / // / /// TspGWI |Csp6I | ||CviJI RsaI | ||TseI | ||AluI | ||TsoI | |BisI | BlsI | SetI SfaNI C P F F S F F S V Q K E A S K K I S S S A L F S H F F P Y R K K H L K R L A A P P F F L I F F R T E R S I * K D * Q L H ----:----|----:----|----:----|----:----|----:----|----:----| Q G K K E N K E T C F S A D L F I L L E K G K K R M K K R V S L L M * F S * C S A R K E * K K G Y L F F C R F L N A A G CspCI | PflMI BbvI | BsiYI* |BstXI Eam1105I | | BccI || Hin4I |EcoP15I | | |AsuI* || Hin4I || BetI* | | |AvaII || | BsrI || |HpaII Hin4I | | ||BmgT120I || | TspRI || || MaeIII Hin4I | | ||| Hpy166II \\ \ \ \\ \\ \ \ \ \ \\\ \ ACACCACTGGTTATTGGACAAGTTGTCCGGTTGTTACGCCCCAAGACCATCTGCTGGTCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTGACCAATAACCTGTTCAACAGGCCAACAATGCGGGGTTCTGGTAGACGACCAGG // / / / // / / / / / // |Hin4I BbvI | | || | MaeIII | | | |Hpy166II |Hin4I BsrI | | || Hin4I | | | |AvaII BstXI | | || Hin4I | | | |AsuI* TspRI | | |BetI* | | | BmgT120I | | HpaII | | BccI | EcoP15I | BsiYI* Eam1105I | PflMI CspCI T P L V I G Q V V R L L R P K T I C W S H H W L L D K L S G C Y A P R P S A G P T T G Y W T S C P V V T P Q D H L L V H ----:----|----:----|----:----|----:----|----:----|----:----| V G S T I P C T T R N N R G L V M Q Q D W V V P * Q V L Q G T T V G W S W R S T C W Q N N S L N D P Q * A G L G D A P G TfiI MseI TspEI HinfI CspCI DdeI | BceAI \ \ \ \ \ \ ACACAAATTGCGTGAATCCTTGCCATTGATTGTCTTTCTAAGAAACAGATTAAAGTATGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTTAACGCACTTAGGAACGGTAACTAACAGAAAGATTCTTTGTCTAATTTCATACG / / / / / / TspEI | CspCI DdeI | BceAI HinfI MseI TfiI T Q I A * I L A I D C L S K K Q I K V C H K L R E S L P L I V F L R N R L K Y A T N C V N P C H * L S F * E T D * S M L ----:----|----:----|----:----|----:----|----:----|----:----| V C I A H I R A M S Q R E L F C I L T H W V F Q T F G Q W Q N D K * S V S * L I C L N R S D K G N I T K R L F L N F Y A SfaNI |Hin4I |Hin4I |BceAI ||CviJI ||| Hpy178III* ||| | CviRI* ||| | | MaeII ||| | | |MaeIII ||| | | |Tsp45I ||| | | || SetI CfrI ||| | | || TaiI XmaIII* ||| | | || | MaeII | CviJI ||| | | || | |FalI Hpy166II | HaeIII ||| | | || | |FalI | Hin4I | |McrI* ||| | | || | || MseI | Hin4I | ||FalI ||| | | || | || SetI | | Tsp4CI* | ||FalI ||| | | || | || TaiI | | | PsrI \ \\\ \\\ \ \ \\ \ \\ \ \ \ \ \ TTTGAACGGCCGTGAAGTCAAGGCTATCTTGATGCAACGTCACGTTAAAGTGGACGGTAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTGCCGGCACTTCAGTTCCGATAGAACTACGTTGCAGTGCAATTTCACCTGCCATT / // / / /// / / / // / // / / // / / | || | Hin4I ||| | | | || | || | | || | SetI | || | Hin4I ||| | | | || | || | | || Tsp4CI* | || XmaIII* ||| | | | || | || | | |PsrI | || CfrI ||| | | | || | || | | Hpy166II | |HaeIII ||| | | | || | || | Hin4I | |CviJI ||| | | | || | || | Hin4I | McrI* ||| | | | || | || MseI FalI ||| | | | || | |MaeII FalI ||| | | | || | Tsp45I ||| | | | || | MaeIII ||| | | | || TaiI ||| | | | || SetI ||| | | | |MaeII ||| | | | FalI ||| | | | FalI ||| | | TaiI ||| | | SetI ||| | CviRI* ||| Hpy178III* ||SfaNI |BceAI CviJI F E R P * S Q G Y L D A T S R * S G R * L N G R E V K A I L M Q R H V K V D G K * T A V K S R L S * C N V T L K W T V R ----:----|----:----|----:----|----:----|----:----|----:----| K S R G H L * P * R S A V D R * L P R Y S Q V A T F D L S D Q H L T V N F H V T K F P R S T L A I K I C R * T L T S P L SetI | BseYI | TspDTI | | AluI | | GsaI | | CviJI | | PvuII | | NspBII* | | | SetI XbaI | | | | PsrI |MaeI | | | | | FatI |FokI | | | | | |CviAII |Hpy178III* | | | | | || NlaIII || AjuI | | | | | || | SfaNI || | Eco57I SetI | | | | | || | BseGI || | Eco57MI \ \ \ \ \ \ \\ \ \ \\ \ \ GGTTAGAACCGACACTACCTACCCAGCTGGTTTCATGGATGTCATCACTCTAGATGCCAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATCTTGGCTGTGATGGATGGGTCGACCAAAGTACCTACAGTAGTGAGATCTACGGTG / / / /// / // / // /// | | | ||| | || BseGI || ||FokI | | | ||| | |FatI || |Eco57MI | | | ||| | CviAII || |Eco57I | | | ||| NlaIII || |XbaI | | | ||NspBII* || Hpy178III* | | | ||BseYI || MaeI | | | ||PvuII |AjuI | | | ||CviJI SfaNI | | | ||AluI | | | |PsrI | | | SetI | | GsaI | TspDTI SetI G * N R H Y L P S W F H G C H H S R C H V R T D T T Y P A G F M D V I T L D A T L E P T L P T Q L V S W M S S L * M P P ----:----|----:----|----:----|----:----|----:----|----:----| P * F R C * R G L Q N * P H * * E L H W L N S G V S G V W S T E H I D D S * I G T L V S V V * G A P K M S T M V R S A V Hpy188I | TspDTI | | AccI | | |Hpy166II HphI | | || Hin4I TfiI Hpy166II | | || AjuI Hin4I HinfI | Tsp4CI* \ \ \\ \ \ \ \ \ CAATGAAAACTTCAGATTGGTCTACGATGTCAAGGGTAGATTCGCTGTCCACCGTATCAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTACTTTTGAAGTCTAACCAGATGCTACAGTTCCCATCTAAGCGACAGGTGGCATAGTG / / / // / / // / / | | | || Hin4I HinfI || | Hin4I | | | || Hin4I TfiI || | Hin4I | | | |AccI || Tsp4CI* | | | Hpy166II |Hpy166II | | AjuI HphI | TspDTI Hpy188I Q * K L Q I G L R C Q G * I R C P P Y H N E N F R L V Y D V K G R F A V H R I T M K T S D W S T M S R V D S L S T V S P ----:----|----:----|----:----|----:----|----:----|----:----| W H F S * I P R R H * P Y I R Q G G Y * G I F V E S Q D V I D L T S E S D V T D L S F K L N T * S T L P L N A T W R I V Hin4II* HindIII | SetI | AluI | |Hpy178III* | CviJI | || SetI | | SetI | || | TspEI Hin4I | | | MboII | || | | Hin4II* Hin4I | | | |TspDTI | || | | | SetI \ \ \ \ \\ \ \\ \ \ \ \ CGATGAAGAAGCTTCTTACAAGTTGGGTAAGGTCAAGAAGGTTCAATTAGGTAAGAAGGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GCTACTTCTTCGAAGAATGTTCAACCCATTCCAGTTCTTCCAAGTTAATCCATTCTTCCC / / / / // / / / | | | TspDTI || | SetI Hin4II* | | | MboII || Hpy178III* TspEI | | HindIII |Hin4II* SetI | CviJI SetI | AluI SetI R * R S F L Q V G * G Q E G S I R * E G D E E A S Y K L G K V K K V Q L G K K G M K K L L T S W V R S R R F N * V R R V ----:----|----:----|----:----|----:----|----:----|----:----| R H L L K K C T P Y P * S P E I L Y S P G I F F S R V L Q T L D L L N L * T L L S S S A E * L N P L T L F T * N P L F P MaeII | SetI | TaiI | |MaeIII | || BccI Hpy188I \ \\ \ \ TGTTCCATACGTTGTTACCCACGATGGTAGAACTATCAGATACCCAGACCCAAACATCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGGTATGCAACAATGGGTGCTACCATCTTGATAGTCTATGGGTCTGGGTTTGTAGTT / / / / / | MaeII MaeIII Hpy188I SetI TaiI BccI SetI C S I R C Y P R W * N Y Q I P R P K H Q V P Y V V T H D G R T I R Y P D P N I K F H T L L P T M V E L S D T Q T Q T S R ----:----|----:----|----:----|----:----|----:----|----:----| H E M R Q * G R H Y F * * I G L G L C * T N W V N N G V I T S S D S V W V W V D T G Y T T V W S P L V I L Y G S G F M L Tsp4CI* |Hin4I ||MseI |||TspRI MnlI |||| MboI FalI |||| | DpnI FalI FalI |||| | |TaqI CviJI TspDTI SetI FalI |||| | |BstKTI HaeIII | Hin4I SfaNI TaqI \ \ \\\\ \ \\ \ \ \ \ \ GGTCAATGACACTGTTAAGATCGACTTGGCCTCTGGTAAGATTACTGATTTCATCAAGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTTACTGTGACAATTCTAGCTGAACCGGAGACCATTCTAATGACTAAAGTAGTTCAA / / / / / // // / / // / / | | | | | || |TaqI | | || Hin4I SfaNI | | | | | || MboI | | |MnlI | | | | | |DpnI | | TspDTI | | | | | BstKTI | FalI | | | | MseI | FalI | | | Tsp4CI* HaeIII | | Hin4I CviJI | TspRI FalI FalI G Q * H C * D R L G L W * D Y * F H Q V V N D T V K I D L A S G K I T D F I K F S M T L L R S T W P L V R L L I S S S S ----:----|----:----|----:----|----:----|----:----|----:----| P * H C Q * S R S P R Q Y S * Q N * * T L D I V S N L D V Q G R T L N S I E D L T L S V T L I S K A E P L I V S K M L N Hpy166II | MaeII | |MaeIII Cfr10I | || SetI BsrI Csp6I |HpaII | || TaiI | MaeIII BaeI |RsaI \\ \ \\ \ \ \ \ \\ CGATGCCGGTAAGTTGGTTTACGTTACTGGTGGTCGTAACTTGGGTCGTATCGGTACTAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GCTACGGCCATTCAACCAAATGCAATGACCACCAGCATTGAACCCAGCATAGCCATGATA / // // / / / / // TaqI |Cfr10I || | | BsrI MaeIII |Csp6I HpaII || | MaeIII BaeI RsaI || MaeII |TaiI |SetI Hpy166II R C R * V G L R Y W W S * L G S Y R Y Y D A G K L V Y V T G G R N L G R I G T I M P V S W F T L L V V V T W V V S V L S ----:----|----:----|----:----|----:----|----:----|----:----| R H R Y T P K R * Q H D Y S P D Y R Y * E I G T L Q N V N S T T T V Q T T D T S S A P L N T * T V P P R L K P R I P V I FalI BccI FalI | BaeI | Hpy166II HinfI | | OliI | | MlyI | StyI Hpy166II | | MslI TaqI | | PleI | SecI* \ \ \ \ \ \ \ \ \ \ CGTTCACAAGGAAAGACACGATGGTGGTTTCGATTTAGTTCACATCAAGGACTCCTTGGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAGTGTTCCTTTCTGTGCTACCACCAAAGCTAAATCAAGTGTAGTTCCTGAGGAACCT / / / / // / // / / Hpy166II | BccI MslI |FalI | |PleI | SecI* BaeI OliI |FalI | MlyI | StyI TaqI Hpy166II HinfI R S Q G K T R W W F R F S S H Q G L L G V H K E R H D G G F D L V H I K D S L D F T R K D T M V V S I * F T S R T P W T ----:----|----:----|----:----|----:----|----:----|----:----| R E C P F V R H H N R N L E C * P S R P D N V L F S V I T T E I * N V D L V G Q T * L S L C S P P K S K T * M L S E K S FalI FalI Hpy166II MaeIII | SetI Tsp45I MboII | |HphI | MaeI BbvII* | || CviJI \ \ \ \ \\ \ CAACACTTTCGTCACTAGATTGAACAATGTCTTCGTCATCGGTGAACAAGGTAAGCCTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTGAAAGCAGTGATCTAACTTGTTACAGAAGCAGTAGCCACTTGTTCCATTCGGAAT / / / / / / / / / FalI | | | BbvII* | | | CviJI FalI | | MboII | | HphI | MaeI | SetI Tsp45I Hpy166II MaeIII Q H F R H * I E Q C L R H R * T R * A L N T F V T R L N N V F V I G E Q G K P Y T L S S L D * T M S S S S V N K V S L T ----:----|----:----|----:----|----:----|----:----|----:----| C C K R * * I S C H R R * R H V L Y A K V V S E D S S Q V I D E D D T F L T L R L V K T V L N F L T K T M P S C P L G * MaeII |MaeIII |Tsp45I || SetI || TaiI || | SapI || | Ksp632I* || | |MboII \\ \ \\ CATTTCTTTGCCAAAGGGTAAGGGTATCAAGTTGTCTATTGCTGAAGAACGTGACAGAAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAGAAACGGTTTCCCATTCCCATAGTTCAACAGATAACGACTTCTTGCACTGTCTTC / / / / | | | Ksp632I* | | | SapI | | Tsp45I | | MaeIII | | MboII | MaeII TaiI SetI H F F A K G * G Y Q V V Y C * R T * Q K I S L P K G K G I K L S I A E E R D R R F L C Q R V R V S S C L L L K N V T E E ----:----|----:----|----:----|----:----|----:----|----:----| C K K A L P Y P Y * T T * Q Q L V H C F V N R Q W L T L T D L Q R N S F F T V S M E K G F P L P I L N D I A S S R S L L Eco57I Eco57MI | AluI | CviJI | Ecl136II | | SetI | | SduI | | SacI | | HgiAI* | | HgiJII* | | | MboII | | | | MboII | | | | | SetI | | | | | | PsiI \ \ \ \ \ \ \ AAGAGCTCAACAAGGTTTATAA 1030 1040 ----:----|----:----|-- TTCTCGAGTTGTTCCAAATATT / / / / // / | | | | |SetI PsiI | | | | MboII | | | MboII | | Ecl136II | | CviJI | | AluI | HgiJII* | HgiAI* | SacI | SduI | SetI Eco57MI Eco57I K S S T R F I X R A Q Q G L * E L N K V Y X ----:----|----:----|-- F L E V L N I S S S L L T * L L A * C P K Y # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AjuI 1 AluI 4 AluBI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 2 BetI* 1 BsaWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI Bsp1407I 1 BsrGI,BstAUI BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 BstXI 1 Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 1 CviJI 9 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FalI 6 FatI 1 FokI 3 GsaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 7 Hin4II* 2 HpyAV HindIII 1 HinfI 4 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MnlI 1 MseI 5 Tru1I,Tru9I MslI 1 RseI,SmiMI NlaIII 1 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PsiI 2 AanI PsrI 1 PvuII 1 RsaI 3 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 17 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 3 TatI 1 TfiI 2 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI XbaI 1 XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AciI AclI AcyI AflII AflIII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseSI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I ClaI DinI DraII DraIII DrdI DsaI* EciI Eco31I Eco47III EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FnuDII* FseI FspAI GlaI GsuI HaeII HgaI HgiCI* HhaI Hin6I HindII HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI MfeI MluI MmeI Mph1103I MroNI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI RsrII SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769