Restriction Map of TTI2/YJR136C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TTI2/YJR136C on chromosome X from coordinates 678706 to 677441.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.30465

EMBOSS_001 CfrI TfiI XmaIII* HinfI | CviJI EcoRV | TaqI | HaeIII | BceAI | |MboII | |McrI* | | TaqI | |TspDTI PleI | ||MaeIII | | ClaI TspEI | ||HinfI |MlyI CviJI \ \\\ \ \ \ \ \ \\\ \\ \ ATGACGGCCGTAACTGATATCATCGATGAATTGAATGATTCGAGTCTTTCTTCTACAAGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGCCGGCATTGACTATAGTAGCTACTTAACTTACTAAGCTCAGAAAGAAGATGTTCC // / / / / / / // / / / // || | | | | ClaI TspEI || | HinfI PleI |CviJI || | | | | TaqI || TaqI MlyI Eco57MI || | | | BceAI |HinfI GsuI || | | EcoRV |MboII || | MaeIII |TfiI || XmaIII* TspDTI || CfrI |HaeIII |CviJI McrI* M T A V T D I I D E L N D S S L S S T R * R P * L I S S M N * M I R V F L L Q G D G R N * Y H R * I E * F E S F F Y K A ----:----|----:----|----:----|----:----|----:----|----:----| X V A T V S I M S S N F S E L R E E V L X S P R L Q Y * R H I S H N S D K K * L H R G Y S I D D I F Q I I R T K R R C P BbvII* | AlwNI | | MboII GsuI | | | BsrI Eco57MI BsrI | | | | BseGI FokI | TaqI |BsmAI | | | | CviRI* |Tsp4CI* | |Hpy178III* ||MaeIII | | | | |TspEI || MnlI \ \\ \\\ \ \ \ \ \\ \\ \ CTTCGAGAGTTGTGTCTCCAGTTACGAAAGAAGACAGATACTGGATGTGCAATTACGGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGCTCTCAACACAGAGGTCAATGCTTTCTTCTGTCTATGACCTACACGTTAATGCCAC // / / / / / / / / / / // || BsrI | MaeIII | | | | | | | |FokI |Hpy178III* BsmAI | | | | | | | MnlI TaqI | | | | | | Tsp4CI* | | | | | TspEI | | | | CviRI* | | | BseGI | | BsrI | BbvII* | MboII AlwNI L R E L C L Q L R K K T D T G C A I T V F E S C V S S Y E R R Q I L D V Q L R C S R V V S P V T K E D R Y W M C N Y G V ----:----|----:----|----:----|----:----|----:----|----:----| S R S N H R W N R F F V S V P H A I V T A E L T T D G T V F S S L Y Q I H L * P K S L Q T E L * S L L C I S S T C N R H PfoI SetI BssKI |HindII EcoRII |Hpy166II TfiI GsuI | ScrFI AccI Hpy188I || SetI HinfI Eco57MI | BseBI |Hpy166II \ \\ \ \ \ \ \ \\ TCCGATGAGGTCAACCTTATTGAATCTCTCTCATATCACTCCATATCTCCAGGAGTAGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTACTCCAGTTGGAATAACTTAGAGAGAGTATAGTGAGGTATAGAGGTCCTCATCTG / / // / / / / // | SetI |SetI | Eco57MI | | |AccI Hpy188I Hpy166II | GsuI | | Hpy166II HindII HinfI | EcoRII TfiI | BssKI | PfoI BseBI ScrFI S D E V N L I E S L S Y H S I S P G V D P M R S T L L N L S H I T P Y L Q E * T R * G Q P Y * I S L I S L H I S R S R H ----:----|----:----|----:----|----:----|----:----|----:----| D S S T L R I S D R E Y * E M D G P T S T R H P * G * Q I E R M D S W I E L L L G I L D V K N F R E * I V G Y R W S Y V CviRI* | SfeI* MaeIII \ \ \ ATACAAATCAACACAGATGTTTTGCAGACTATAGATTACTACTTTCAGCGTAACAAAAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTTTAGTTGTGTCTACAAAACGTCTGATATCTAATGATGAAAGTCGCATTGTTTTCA / / / CviRI* SfeI* MaeIII I Q I N T D V L Q T I D Y Y F Q R N K S Y K S T Q M F C R L * I T T F S V T K V T N Q H R C F A D Y R L L L S A * Q K * ----:----|----:----|----:----|----:----|----:----|----:----| M C I L V S T K C V I S * * K * R L L L C V F * C L H K A S * L N S S E A Y C F Y L D V C I N Q L S Y I V V K L T V F T Hpy166II | FatI | |CviAII | || NlaIII | || | HgaI DdeI MseI | || | | TspEI | MaeIII CviJI |AhaIII* \ \\ \ \ \ \ \ \ \\ GAACATGACGAAATTATGTGCGTCCTTATTTCTAAGTTACAGCCACTACTTTTAAAACGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTACTGCTTTAATACACGCAGGAATAAAGATTCAATGTCGGTGATGAAAATTTTGCG / / // // / / / // | | |FatI |TspEI DdeI | CviJI |MseI | | CviAII HgaI MaeIII AhaIII* | NlaIII Hpy166II E H D E I M C V L I S K L Q P L L L K R N M T K L C A S L F L S Y S H Y F * N A T * R N Y V R P Y F * V T A T T F K T Q ----:----|----:----|----:----|----:----|----:----|----:----| S C S S I I H T R I E L N C G S S K F R H V H R F * T R G * K * T V A V V K L V F M V F N H A D K N R L * L W * K * F A MaeII TaqI | SetI BsmAI AsuII | TaiI Eco31I BsiYI* \ \ \ \ \ AAAAGCAACTTCGAACTCAAAGAGCAACGTAATCTTGGTCTCAAACCCACGCTTGGAATG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGTTGAAGCTTGAGTTTCTCGTTGCATTAGAACCAGAGTTTGGGTGCGAACCTTAC / / / / / AsuII | MaeII | BsiYI* TaqI TaiI Eco31I SetI BsmAI K S N F E L K E Q R N L G L K P T L G M K A T S N S K S N V I L V S N P R L E C K Q L R T Q R A T * S W S Q T H A W N V ----:----|----:----|----:----|----:----|----:----|----:----| L L L K S S L S C R L R P R L G V S P I C F C S R V * L A V Y D Q D * V W A Q F F A V E F E F L L T I K T E F G R K S H SetI | EcoNI | MboII CviJI | | CviRI* | TspGWI | | BsiYI* | | MwoI | | | Cac8I | | | BsmI \ \ \ \ \ \ \ \ TCTTTGAAAGAAGATAACCTAATGCAGGCGTGGGTAAGTCAGGGTGGCTTGAAAGGCATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAACTTTCTTCTATTGGATTACGTCCGCACCCATTCAGTCCCACCGAACTTTCCGTAA / / // / // / / SetI | || Cac8I || | BsmI | |CviRI* || MwoI | EcoNI |TspGWI BsiYI* CviJI MboII S L K E D N L M Q A W V S Q G G L K G I L * K K I T * C R R G * V R V A * K A F F E R R * P N A G V G K S G W L E R H S ----:----|----:----|----:----|----:----|----:----|----:----| D K F S S L R I C A H T L * P P K F P M T K S L L Y G L A P T P L D P H S S L C R Q F F I V * H L R P Y T L T A Q F A N MaeII |BsaAI |SnaBI || SetI || TaiI TfiI || TspEI MaeIII BsmAI HinfI \\ \ \ \ \ CCGTTATTCTACGTAATTCTGTTACATTTGAAAAGGAGAGACATATCTACGAATCTTTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAATAAGATGCATTAAGACAATGTAAACTTTTCCTCTCTGTATAGATGCTTAGAAAGA / // / / / / | || TspEI MaeIII BsmAI HinfI | |MaeII TfiI | SnaBI | BsaAI TaiI SetI P L F Y V I L L H L K R R D I S T N L S R Y S T * F C Y I * K G E T Y L R I F L V I L R N S V T F E K E R H I Y E S F L ----:----|----:----|----:----|----:----|----:----|----:----| G N N * T I R N C K F L L S M D V F R E E T I R R L E T V N S F S L C I * S D K R * E V Y N Q * M Q F P S V Y R R I K R PfoI BssKI EcoRII | ScrFI | BseBI | | ApoI | | TspEI TspEI | | EcoRI MaeI TspRI | MseI \ \ \ \ \ \ \ TGGATTATTCCAGGAATTCTAAACATACTAGATGATACCACTGATATAAGAAGAATTAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTAATAAGGTCCTTAAGATTTGTATGATCTACTATGGTGACTATATTCTTCTTAATTT / / / / / // | | EcoRI MaeI TspRI |MseI | | TspEI TspEI | | ApoI | EcoRII | BssKI | PfoI BseBI ScrFI W I I P G I L N I L D D T T D I R R I K G L F Q E F * T Y * M I P L I * E E L N D Y S R N S K H T R * Y H * Y K K N * T ----:----|----:----|----:----|----:----|----:----|----:----| Q I I G P I R F M S S S V V S I L L I L K S * E L F E L C V L H Y W Q Y L F F * P N N W S N * V Y * I I G S I Y S S N F MseI MlyI MboII SfeI* | HgaI SetI PleI \ \ \ \ \ \ CTTCGTGGTGTTCTGCTCCTACAGACGCTATTAAATCATACCTTTATGAACGAAACCAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGCACCACAAGACGAGGATGTCTGCGATAATTTAGTATGGAAATACTTGCTTTGGTTA / / / // // / MboII SfeI* MseI |SetI || TspDTI HgaI |PleI MlyI L R G V L L L Q T L L N H T F M N E T N F V V F C S Y R R Y * I I P L * T K P M S W C S A P T D A I K S Y L Y E R N Q * ----:----|----:----|----:----|----:----|----:----|----:----| S R P T R S R C V S N F * V K I F S V L V E H H E A G V S A I L D Y R * S R F W K T T N Q E * L R * * I M G K H V F G I Tsp4CI* | MaeI | | TatI Tsp4CI* HinfI | | |Csp6I | TaqI TspDTI | | ||RsaI | AsuII | BciVI | | ||ScaI BsrI | TspRI \ \ \ \ \\\ \ \ \ GACTCAAAATGGATACAGTTCTCTAGTACTGGTTTATTTCCACTGTTCGAAAAGACGCTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTTTTACCTATGTCAAGAGATCATGACCAAATAAAGGTGACAAGCTTTTCTGCGAT / / / /// / / / / HinfI Tsp4CI* | ||| BsrI | | AsuII BciVI | ||TatI | | TaqI | |Csp6I | Tsp4CI* | ScaI TspRI | RsaI MaeI D S K W I Q F S S T G L F P L F E K T L T Q N G Y S S L V L V Y F H C S K R R * L K M D T V L * Y W F I S T V R K D A N ----:----|----:----|----:----|----:----|----:----|----:----| S E F H I C N E L V P K N G S N S F V S H S L I S V T R * Y Q N I E V T R F S A V * F P Y L E R T S T * K W Q E F L R * CviJI |FauI || NdeI || |TspDTI MnlI || || BsiYI* HgaI | MnlI || || |AciI \ \ \ \\ \\ \\ ATCAATATGTGCTATTTTCTCCCTCCCTCATACAATGCTGATGAAACAATAGCCATATGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTATACACGATAAAAGAGGGAGGGAGTATGTTACGACTACTTTGTTATCGGTATACC / / / / //// HgaI | MnlI | |||NdeI MnlI | ||BsiYI* | |FauI | TspDTI CviJI I N M C Y F L P P S Y N A D E T I A I W S I C A I F S L P H T M L M K Q * P Y G Q Y V L F S P S L I Q C * * N N S H M A ----:----|----:----|----:----|----:----|----:----|----:----| I L I H * K R G G E Y L A S S V I A M H L * Y T S N E G E R M C H Q H F L L W I D I H A I K E R G * V I S I F C Y G Y P ApoI TsoI TspEI | BaeI Tsp4CI* | BaeI TspEI \ \ \ \ \ \ CGGGTCGTTTTCCCAACGATACAGTCGTTATATAAAGTAGAATTTTTGGACAATTACACA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCCCAGCAAAAGGGTTGCTATGTCAGCAATATATTTCATCTTAAAAACCTGTTAATGTGT / // / / / / | |BaeI Tsp4CI* BaeI TspEI TspEI | TsoI ApoI AciI R V V F P T I Q S L Y K V E F L D N Y T G S F S Q R Y S R Y I K * N F W T I T Q G R F P N D T V V I * S R I F G Q L H K ----:----|----:----|----:----|----:----|----:----|----:----| R T T K G V I C D N Y L T S N K S L * V A P R K G L S V T T I Y L L I K P C N C P D N E W R Y L R * I F Y F K Q V I V C BssKI EcoRII TspEI |TspDTI FatI | StyI ||ScrFI |CviAII | AvrII ||BseBI || NlaIII | SecI* HphI |||SetI || | Hpy188I CviRI* | |MaeI \ \\\\ \\ \ \ \ \ \\ AAGTATCAATATCACCTGGAAAAGTTCATGTCAGAGATAATCTTGCAAAACATAATTCCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATAGTTATAGTGGACCTTTTCAAGTACAGTCTCTATTAGAACGTTTTGTATTAAGGA / / / / / // / / / HphI | | EcoRII | || Hpy188I CviRI* TspEI | | BssKI | |FatI | BseBI | CviAII | ScrFI NlaIII TspDTI SetI K Y Q Y H L E K F M S E I I L Q N I I P S I N I T W K S S C Q R * S C K T * F L V S I S P G K V H V R D N L A K H N S * ----:----|----:----|----:----|----:----|----:----|----:----| F Y * Y * R S F N M D S I I K C F M I G L T D I D G P F T * T L S L R A F C L E L I L I V Q F L E H * L Y D Q L V Y N R NheI CviJI ApoI CviRI* |MaeI TspEI | BsmI ||Cac8I | AlfI | | BseMII ||| BmtI | AlfI | | |BspCNI ||| CviJI | | MaeII | | || BsmAI ||| | MwoI | | | SetI | | || | AlfI ||| | | CviRI* | | | TaiI MslI | | || | AlfI \\\ \ \ \ \ \ \ \ \ \ \ \\ \ \ AGGGCTAGCCTTGCATACGAAAATTTGACGTTATACGCATTGGAATGCACAATGAACATA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGATCGGAACGTATGCTTTTAAACTGCAATATGCGTAACCTTACGTGTTACTTGTAT // / /// / // / / / / // / || | ||| CviRI* || | MaeII MslI | |BspCNI AlfI || | ||CviJI || TaiI | BseMII AlfI || | ||NheI || SetI CviRI* || | |MwoI |TspEI BsmI || | |MaeI |ApoI || | Cac8I AlfI || CviJI AlfI || BmtI |SecI* |AvrII |StyI MaeI R A S L A Y E N L T L Y A L E C T M N I G L A L H T K I * R Y T H W N A Q * T Y G * P C I R K F D V I R I G M H N E H T ----:----|----:----|----:----|----:----|----:----|----:----| L A L R A Y S F K V N Y A N S H V I F M * P * G Q M R F N S T I R M P I C L S C P S A K C V F I Q R * V C Q F A C H V Y TatI Bsp1407I |Csp6I ||RsaI ||| MnlI ||| | Hpy178III* TspDTI GsuI ||| | | CviJI DdeI | Hin4II* Eco57MI ||| | | AlwNI SetI \ \ \ \ \\\ \ \ \ \ CTGAGACTTCAAAGAGAAGGGTCTGTTGTACATCTCCAGAGGCTGATTTTTGTTTTAGGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCTGAAGTTTCTCTTCCCAGACAACATGTAGAGGTCTCCGACTAAAAACAAAATCCA / // / / /// // / / | || Hin4II* Eco57MI ||| || CviJI SetI | |TspDTI GsuI ||| |AlwNI | DdeI ||| Hpy178III* BsmAI ||Bsp1407I ||TatI ||MnlI |Csp6I RsaI L R L Q R E G S V V H L Q R L I F V L G * D F K E K G L L Y I S R G * F L F * V E T S K R R V C C T S P E A D F C F R * ----:----|----:----|----:----|----:----|----:----|----:----| S L S * L S P D T T C R W L S I K T K P V S V E F L L T Q Q V D G S A S K Q K L Q S K L S F P R N Y M E L P Q N K N * T HphI Csp6I |RsaI TstI AjuI TstI \\ \ \ \ GAATATATTGTACGAAATCCTTTTTACACAACTTTTCCAAAACTTATTTCAAAAACTCTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATATAACATGCTTTAGGAAAAATGTGTTGAAAAGGTTTTGAATAAAGTTTTTGAGAA / /// / / / / | ||TstI AjuI TstI | TspRI | |Csp6I AjuI | RsaI HphI E Y I V R N P F Y T T F P K L I S K T L N I L Y E I L F T Q L F Q N L F Q K L F I Y C T K S F L H N F S K T Y F K N S F ----:----|----:----|----:----|----:----|----:----|----:----| S Y I T R F G K * V V K G F S I E F V R H I Y Q V F D K K C L K E L V * K L F E F I N Y S I R K V C S K W F K N * F S K CviJI |TspDTI TspRI || Hin4I | TatI || Hin4I | |Csp6I || | TfiI | ||RsaI || | HinfI AjuI | ||ScaI SetI || | | TaqI \ \ \\\ \ \\ \ \ \ TCAGTGGTAAGTACTCTCATAAAGGTTTGCCCGAATGAAAGAATAGTGGCTCACAGATTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCACCATTCATGAGAGTATTTCCAAACGGGCTTACTTTCTTATCACCGAGTGTCTAAG /// / /// / ||TatI SetI ||CviJI HinfI |Csp6I |TspDTI TfiI ScaI Hin4I RsaI Hin4I S V V S T L I K V C P N E R I V A H R F Q W * V L S * R F A R M K E * W L T D S S G K Y S H K G L P E * K N S G S Q I R ----:----|----:----|----:----|----:----|----:----|----:----| E T T L V R M F T Q G F S L I T A * L N K L P L Y E * L P K G S H F F L P E C I * H Y T S E Y L N A R I F S Y H S V S E MseI VspI |TspEI || MaeI || | MaeIII || | | Hin4I AlfI MnlI || | | Hin4I AlfI SfaNI BseGI \\ \ \ \ \ \ \ GACATTTTATCATTAATTCTAGTTACATACGATAAGTGTTCGCAAGAGGATGCGTTGAAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAAAATAGTAATTAAGATCAATGTATGCTATTCACAAGCGTTCTCCTACGCAACTTG / / // / / / / / / TaqI | || MaeI | AlfI MnlI SfaNI BseGI | |Hin4I | AlfI | |Hin4I MaeIII | TspEI VspI MseI D I L S L I L V T Y D K C S Q E D A L N T F Y H * F * L H T I S V R K R M R * T H F I I N S S Y I R * V F A R G C V E R ----:----|----:----|----:----|----:----|----:----|----:----| S M K D N I R T V Y S L H E C S S A N F R C K I M L E L * M R Y T N A L P H T S V N * * * N * N C V I L T R L L I R Q V TspEI | MaeIII TfiI | Tsp45I FokI | | TaqII HinfI AluI | | | Hin6I | AlfI CviJI | | | |GlaI | AlfI | SetI | | | ||HhaI \ \ \ \ \ \ \ \\\ GAATCAATACTACAACAATGTAAGGAAACGATAAGCTGGTTGCTGAATTGTGACTGCGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGTTATGATGTTGTTACATTCCTTTGCTATTCGACCAACGACTTAACACTGACGCGA /// / / // / /// ||FokI | CviJI || | ||Hin6I |HinfI | AluI || | |GlaI |TfiI SetI || | HhaI AlfI || Tsp45I AlfI || MaeIII |TaqII TspEI E S I L Q Q C K E T I S W L L N C D C A N Q Y Y N N V R K R * A G C * I V T A L I N T T T M * G N D K L V A E L * L R Y ----:----|----:----|----:----|----:----|----:----|----:----| S D I S C C H L S V I L Q N S F Q S Q A R I L V V V I Y P F S L S T A S N H S R F * Y * L L T L F R Y A P Q Q I T V A S Hpy166II AciI | Tsp4CI* SecI* | |MlyI DsaI* | |PleI | AciI | || TaqI | FnuDII* | || HphI | NspBII* | || | HinfI DdeI | |SacII MaeIII \ \\ \ \ \ \ \\ \ ATGGGTGAACAGTTATCGACTCTATCTAAGCAACCGCGGTTTCAGTTACTTTTTGAGTTC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCACTTGTCAATAGCTGAGATAGATTCGTTGGCGCCAAAGTCAATGAAAAACTCAAG / / // / / / / // / / | | || | | HinfI DdeI || DsaI* MaeIII | | || | TaqI || SecI* | | || HphI || AciI | | |PleI |NspBII* | | MlyI |FnuDII* | Tsp4CI* |AciI Hpy166II SacII M G E Q L S T L S K Q P R F Q L L F E F W V N S Y R L Y L S N R G F S Y F L S S G * T V I D S I * A T A V S V T F * V L ----:----|----:----|----:----|----:----|----:----|----:----| I P S C N D V R D L C G R N * N S K S N * P H V T I S E I * A V A T E T V K Q T H T F L * R S * R L L R P K L * K K L E TCATAG ----:- AGTATC S * H X I X ----:- E Y R M * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AhaIII* 1 DraI AjuI 1 AlfI 4 AluI 1 AluBI AlwNI 2 CaiI ApoI 3 AcsI,XapI AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvrII 1 AspA2I,BlnI,XmaJI BaeI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BceAI 1 BciVI 1 BfuI BmtI 1 BspOI BsaAI 1 BstBAI,Ppu21I BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 4 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I Cac8I 2 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 10 CviKI-1 CviRI* 6 HpyCH4V DdeI 3 BstDEI,HpyF3I DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 3 EcoNI 1 BstENI,XagI EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 GsuI 3 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 8 HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 MaeI 5 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 8 MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 3 SchI MnlI 5 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PfoI 2 PleI 3 PpsI RsaI 4 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII ScaI 2 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 7 TaqII 1 TatI 3 TfiI 5 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 VspI 1 PshBI,AseI XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AloI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII BalI BamHI BarI BbvCI BbvI BccI Bce83I* BcgI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BplI Bpu10I BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstKTI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CspCI DinI DpnI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FalI FaqI Fnu4HI FseI FspAI GsaI HaeII HgiAI* HgiCI* HgiJII* HindIII HpaI HpaII Hpy99I KasI KpnI Ksp632I* MauBI MboI MfeI MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SalI SanDI SapI SauI* SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TauI TseI TspMI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769