Restriction Map of SGM1/YJR134C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SGM1/YJR134C on chromosome X from coordinates 675852 to 673729.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16290

EMBOSS_001 BplI BplI |Ksp632I* HinfI || BsmAI | MboII DdeI || | MlyI | |StyI | BplI TspEI || | PleI | |SecI* | BplI \ \\ \ \ \ \\ \ \ ATGAGTAAAAAATTATCGTTGGAAGAGAGACTCTCCTTGGCAACTAAGAAAGGAAGAAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCATTTTTTAATAGCAACCTTCTCTCTGAGAGGAACCGTTGATTCTTTCCTTCTTTC / / / /// // / / / | TspEI | ||BsmAI |MboII | | DdeI BplI | |PleI HinfI | BplI BplI | MlyI | BplI Ksp632I* SecI* StyI M S K K L S L E E R L S L A T K K G R K * V K N Y R W K R D S P W Q L R K E E R E * K I I V G R E T L L G N * E R K K E ----:----|----:----|----:----|----:----|----:----|----:----| X L L F N D N S S L S E K A V L F P L F X S Y F I I T P L S V R R P L * S L F F H T F F * R Q F L S E G Q C S L F S S L SetI |HindII |Hpy166II || MaeII || | SetI || | TaiI || | |BtgZI || | ||ApoI BsmAI BccI MboII || | ||TspEI Esp3I | MwoI \ \\ \ \\\ \ \ \ AAAAATAAAAGGTCAACGTCAAATTTGTCGTCTCCATCGCCTGTGGTGCTGTCAAACAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTATTTTCCAGTTGCAGTTTAAACAGCAGAGGTAGCGGACACCACGACAGTTTGTTA / / // / // / // | SetI || MaeII |TspEI | |BccI MboII |TaiI |ApoI | MwoI |SetI BtgZI Esp3I Hpy166II BsmAI HindII K N K R S T S N L S S P S P V V L S N N K I K G Q R Q I C R L H R L W C C Q T M K * K V N V K F V V S I A C G A V K Q * ----:----|----:----|----:----|----:----|----:----|----:----| F F L L D V D F K D D G D G T T S D F L S F Y F T L T L N T T E M A Q P A T L C F I F P * R * I Q R R W R R H H Q * V I AciI |BisI TspDTI ||BlsI |SduI |||TseI |HgiAI* |||TauI || Csp6I |||CviJI || |RsaI ||||BisI || ||BseGI |||||BlsI || ||| SfaNI ||||||Cfr10I MfeI FokI || ||| | BbvI |||||||HpaII TspEI \ \\ \\\ \ \ \\\\\\\\ \ GAACAAGAAAGTGCTCGTACATCCATTGATGATGCGGCTGCCGGTGTGGTGTCAATTGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTCTTTCACGAGCATGTAGGTAACTACTACGCCGACGGCCACACCACAGTTAACTG /// /// / / /////// // / ||| ||Csp6I | BbvI ||||||| |Cfr10I TspEI ||| |RsaI SfaNI ||||||| HpaII MfeI ||| BseGI ||||||TseI ||TspDTI |||||BisI |HgiAI* ||||BlsI |SduI |||CviJI FokI ||BisI ||AciI |BlsI TauI E Q E S A R T S I D D A A A G V V S I D N K K V L V H P L M M R L P V W C Q L T T R K C S Y I H * * C G C R C G V N * Q ----:----|----:----|----:----|----:----|----:----|----:----| S C S L A R V D M S S A A A P T T D I S H V L F H E Y M W Q H H P Q R H P T L Q F L F T S T C G N I I R S G T H H * N V BinI* | MboI | | DpnI | | |BstKTI | | || AciI | | || | Csp6I | | || | |RsaI | | || | || MboI | | || | || | DpnI | | || | || | |BstKTI | | || | || | || Hpy188I | | || | || | || | Hin4II* | | || | || | || | | Tsp4CI* | | || | || | || | | | TspRI \ \ \\ \ \\ \ \\ \ \ \ \ AATGCTGAAAACATAGATGATCCTGCGGTACGATCAGAAAGCACTGTGGAAGGCGATACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGACTTTTGTATCTACTAGGACGCCATGCTAGTCTTTCGTGACACCTTCCGCTATGT / // / / // // / / / / / | || MboI | || || | | | Tsp4CI* SetI | |DpnI | || || | | Hin4II* | BstKTI | || || | TspRI BinI* | || || Hpy188I | || || MboI | || |DpnI | || BstKTI | |Csp6I | RsaI AciI N A E N I D D P A V R S E S T V E G D T M L K T * M I L R Y D Q K A L W K A I Q C * K H R * S C G T I R K H C G R R Y R ----:----|----:----|----:----|----:----|----:----|----:----| L A S F M S S G A T R D S L V T S P S V C H Q F C L H D Q P V I L F C Q P L R Y I S F V Y I I R R Y S * F A S H F A I C MaeII |BtrI || SetI || TaiI || | BseGI || | CviRI* || | | Hpy178III* || | | | MboI || | | | | DpnI TfiI FokI || | | | | |SfaNI SetI HinfI TaqI || | | | | |BstKTI \ \ \ \\ \ \ \ \ \\ GGTAAGGCAGATTCAATCGCTGTCGATGACGTGGTGCATCCCGATCACAATAGGACTGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTCCGTCTAAGTTAGCGACAGCTACTGCACCACGTAGGGCTAGTGTTATCCTGACTA / / // // / / /// / / / HinfI | || || | | ||| | SfaNI BaeI TfiI | || || | | ||| MboI | || || | | ||DpnI | || || | | |BstKTI | || || | | Hpy178III* | || || | CviRI* | || || BseGI | || |MaeII | || BtrI | |TaiI | |SetI | FokI TaqI G K A D S I A V D D V V H P D H N R T D V R Q I Q S L S M T W C I P I T I G L I * G R F N R C R * R G A S R S Q * D * L ----:----|----:----|----:----|----:----|----:----|----:----| P L A S E I A T S S T T C G S * L L V S L Y P L N L R Q R H R P A D R D C Y S Q T L C I * D S D I V H H M G I V I P S I TspRI | FatI | |CviAII | ||BglI | ||MwoI | ||| BaeI ApoI BaeI BtsI | ||| NlaIII SetI TspEI | TaqI Hpy99I | TsoI | ||| |CviJI | TspEI | TspRI \ \ \ \ \ \ \\\ \\ \ \ \ \ TGCTTCGACGACACTATGGTATCACTGCCTACATGGCTACCTAAAAATTACACTGAATTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAAGCTGCTGTGATACCATAGTGACGGATGTACCGATGGATTTTTAATGTGACTTAAA / / / / // /// / // / | TaqI | TsoI || ||| SetI |TspEI TspEI Hpy99I TspRI || ||CviJI TspRI ApoI BtsI || |FatI || CviAII |NlaIII BaeI MwoI BglI C F D D T M V S L P T W L P K N Y T E F A S T T L W Y H C L H G Y L K I T L N L L R R H Y G I T A Y M A T * K L H * I Y ----:----|----:----|----:----|----:----|----:----|----:----| Q K S S V I T D S G V H S G L F * V S N N S R R C * P I V A * M A V * F N C Q I A E V V S H Y * Q R C P * R F I V S F K Hpy178III* Tsp4CI* MboII | SspI | TspEI | TspEI | | MseI MseI \ \ \ \ \ \ \ \ ACTGTTGAAGAATTAGTCAAAGAAATTAGTCCTGAATATTTAAGATTAAACAAACAGATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAACTTCTTAATCAGTTTCTTTAATCAGGACTTATAAATTCTAATTTGTTTGTCTAA / / / / / / / / Tsp4CI* | MboII TspEI | SspI MseI MseI TspEI Hpy178III* T V E E L V K E I S P E Y L R L N K Q I L L K N * S K K L V L N I * D * T N R L C * R I S Q R N * S * I F K I K Q T D * ----:----|----:----|----:----|----:----|----:----|----:----| V T S S N T L S I L G S Y K L N F L C I * Q Q L I L * L F * D Q I N L I L C V S S N F F * D F F N T R F I * S * V F L N SecI* DsaI* | TfiI | HinfI SetI TaqI | | MaeI \ \ \ \ \ GATGACCTAACTAACGAACTAAACAGAAAATCACAAATCGAAACCACGGATTCTAGTTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGGATTGATTGCTTGATTTGTCTTTTAGTGTTTAGCTTTGGTGCCTAAGATCAAAA / / / / / / SetI TaqI | | | TspGWI | | MaeI | HinfI | TfiI DsaI* SecI* D D L T N E L N R K S Q I E T T D S S F M T * L T N * T E N H K S K P R I L V F * P N * R T K Q K I T N R N H G F * F F ----:----|----:----|----:----|----:----|----:----|----:----| S S R V L S S F L F D C I S V V S E L K Q H G L * R V L C F I V F R F W P N * N I V * S V F * V S F * L D F G R I R T K MboI | DpnI FalI | |BstKTI AluI FalI | || FalI CviJI TspGWI |MseI | || FalI | SetI | TspEI ||Hin4II* | || |Hin4II* | |TspEI \ \ \\\ \ \\ \\ \ \\ TTCAAATTGATTAAAGAGAAGGACGACTTGATAGATCAGTTGAGAAAAGAAGGAGCTAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTAACTAATTTCTCTTCCTGCTGAACTATCTAGTCAACTCTTTTCTTCCTCGATTT / / / / // / / / / / / | | | MseI || FalI Hin4II* | | | BseMII | | Hin4II* || FalI | | MwoI | TspEI || MboI | CviJI FalI |DpnI | AluI FalI BstKTI SetI F K L I K E K D D L I D Q L R K E G A K S N * L K R R T T * * I S * E K K E L N Q I D * R E G R L D R S V E K R R S * I ----:----|----:----|----:----|----:----|----:----|----:----| K L N I L S F S S K I S * N L F S P A L K * I S * L S P R S S L D T S F L L L * E F Q N F L L V V Q Y I L Q S F F S S F MwoI |BseMII ||BspCNI |||AciI |||| BseMII |||| |BspCNI |||| || MnlI |||| || DdeI |||| || | AluI |||| || | CviJI HindIII |||| || | |DdeI | AluI |||| || | |BbvCI | CviJI |||| || | |Bpu10I | | SetI |||| || | ||SetI | | |MseI \\\\ \\ \ \\\ \ \ \\ TTAGCGGAAACTGAGCTGAGGCAATCAAATCAAATCAAAGCTTTAAGAACAAAAGTGAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGCCTTTGACTCGACTCCGTTAGTTTAGTTTAGTTTCGAAATTCTTGTTTTCACTTT // // / /// / / / / / || || | ||| Bpu10I | | | MseI || || | ||| BbvCI | | HindIII || || | ||| DdeI | CviJI || || | ||CviJI | AluI || || | ||AluI SetI || || | |DdeI || || | SetI || || MnlI || |BspCNI || |AciI || BseMII |TspEI BspCNI L A E T E L R Q S N Q I K A L R T K V K * R K L S * G N Q I K S K L * E Q K * K S G N * A E A I K S N Q S F K N K S E R ----:----|----:----|----:----|----:----|----:----|----:----| N A S V S S L C D F * I L A K L V F T F I L P F Q A S A I L D F * L K L F L L S * R F S L Q P L * I L D F S * S C F H F DdeI | Hpy188I | | TaqI | | | BbvI | | | BcgI SetI | | | |BspCNI DdeI | BcgI | | | ||Hin4I | MnlI | | Hpy188I | | | ||BseMII \ \ \ \ \ \ \ \ \\\ GACTTAGAGTATGAGGTATCTGAACTAAACGATAGTTCTGCTCAGAGTGTCGAAAACTAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAATCTCATACTCCATAGACTTGATTTGCTATCAAGACGAGTCTCACAGCTTTTGATA // / / / // //// / |DdeI | | Hpy188I |DdeI |||| BbvI MnlI | BcgI | |||BseMII SetI | ||BspCNI | ||TaqI | |BcgI | Hin4I Hpy188I D L E Y E V S E L N D S S A Q S V E N Y T * S M R Y L N * T I V L L R V S K T I L R V * G I * T K R * F C S E C R K L * ----:----|----:----|----:----|----:----|----:----|----:----| S K S Y S T D S S F S L E A * L T S F * L S L T H P I Q V L R Y N Q E S H R F S V * L I L Y R F * V I T R S L T D F V I TseI AluI CviJI |BisI ||BlsI AluI ||SetI CviJI CviJI SfaNI |||CviRI* Hin4I |BsrI | SetI |TspEI \\\\ \ \\ \ \ \\ AATGAGCTGCAATCATTGTATCACAACATACAAGGACAACTGGCTGAAGCTACAAATAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCGACGTTAGTAACATAGTGTTGTATGTTCCTGTTGACCGACTTCGATGTTTATTT / //// / // / / | |||CviRI* Hin4I || | CviJI | |||TseI || | AluI | ||BisI || SetI | |BlsI |CviJI | CviJI BsrI | AluI SetI N E L Q S L Y H N I Q G Q L A E A T N K M S C N H C I T T Y K D N W L K L Q I N * A A I I V S Q H T R T T G * S Y K * I ----:----|----:----|----:----|----:----|----:----|----:----| L S S C D N Y * L M C P C S A S A V F L Y H A A I M T D C C V L V V P Q L * L Y I L Q L * Q I V V Y L S L Q S F S C I F MseI | Eco57I | Eco57MI | | CviRI* | | | BseGI HinfI | | | | FalI |MaeIII PleI FalI | | | | FalI FokI |Tsp45I |MlyI FalI \ \ \ \ \ \ \\ \\ \ TTAAAGGATGCAGATAAACAAAAAGAGTCACTTGAAACATTAGAGAAAAATATAAAAGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCCTACGTCTATTTGTTTTTCTCAGTGAACTTTGTAATCTCTTTTTATATTTTCTT /// // / / / / / ||| |CviRI* FokI | | PleI FalI ||| |BseGI | | MlyI FalI ||| FalI | Tsp45I ||| FalI | MaeIII ||Eco57MI HinfI ||Eco57I ||MseI |TspEI SfaNI L K D A D K Q K E S L E T L E K N I K E * R M Q I N K K S H L K H * R K I * K K K G C R * T K R V T * N I R E K Y K R K ----:----|----:----|----:----|----:----|----:----|----:----| N F S A S L C F S D S S V N S F F I F S I L P H L Y V F L T V Q F M L S F Y L L * L I C I F L F L * K F C * L F I Y F F TspEI BsrDI \ \ AAAGATGATTTGATAACAATTTTACAGCAATCTTTAGATAATATGAGAACATTGCTTGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACTAAACTATTGTTAAAATGTCGTTAGAAATCTATTATACTCTTGTAACGAACTT / / TspEI BsrDI K D D L I T I L Q Q S L D N M R T L L E K M I * * Q F Y S N L * I I * E H C L K R * F D N N F T A I F R * Y E N I A * K ----:----|----:----|----:----|----:----|----:----|----:----| F S S K I V I K C C D K S L I L V N S S F L H N S L L K V A I K L Y Y S F M A Q F I I Q Y C N * L L R * I I H S C Q K F Tsp4CI* | MboI | BclI | | DpnI ApoI | | |BstKTI TspEI TspGWI | | || MaeIII \ \ \ \ \\ \ AAAGAAAAAAGTGAATTTCAAACGGAAAAGAAAGCACTACAAGAAGCAACAGTTGATCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTTTTCACTTAAAGTTTGCCTTTTCTTTCGTGATGTTCTTCGTTGTCAACTAGTT / / / // / TspEI TspGWI | || BclI ApoI | || MboI | |DpnI | BstKTI Tsp4CI* K E K S E F Q T E K K A L Q E A T V D Q K K K V N F K R K R K H Y K K Q Q L I K R K K * I S N G K E S T T R S N S * S S ----:----|----:----|----:----|----:----|----:----|----:----| F S F L S N * V S F F A S C S A V T S * F L F F H I E F P F S L V V L L L L Q D F F F T F K L R F L F C * L F C C N I L BsmAI Hin4I | XbaI AluI Hin4I | |MaeI CviJI | ApoI | |Hpy178III* MaeI DdeI TspEI | SetI | TspEI \ \\ \ \ \ \ \ \ \ GTTACCACTCTAGAGACTAAACTAGAACAACTAAGAATAGAATTAGATAGCTCTACTCAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGGTGAGATCTCTGATTTGATCTTGTTGATTCTTATCTTAATCTATCGAGATGAGTT / /// / / / / / / | ||XbaI MaeI DdeI | | | Hin4I | |Hpy178III* | | | Hin4I | |MaeI | | CviJI | BsmAI | | AluI MaeIII | SetI TspEI V T T L E T K L E Q L R I E L D S S T Q L P L * R L N * N N * E * N * I A L L K Y H S R D * T R T T K N R I R * L Y S K ----:----|----:----|----:----|----:----|----:----|----:----| T V V R S V L S S C S L I S N S L E V * L * W E L S * V L V V L F L I L Y S * E N G S * L S F * F L * S Y F * I A R S L Hin4I Hin4I Hin4I | HgaI | TaqI Hin4I \ \ \ \ \ AATTTAGACGCTAAATCAAATAGAGATTTTGTCGATGACCAACAAAGTTATGAAGAAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATCTGCGATTTAGTTTATCTCTAAAACAGCTACTGGTTGTTTCAATACTTCTTTTT / / / / / / | Hin4I | Hin4I TaqI Hin4I TspEI | Hin4I ApoI HgaI N L D A K S N R D F V D D Q Q S Y E E K I * T L N Q I E I L S M T N K V M K K N F R R * I K * R F C R * P T K L * R K T ----:----|----:----|----:----|----:----|----:----|----:----| F K S A L D F L S K T S S W C L * S S F F N L R * I L Y L N Q R H G V F N H L F I * V S F * I S I K D I V L L T I F F F PleI AluI |MlyI CviJI || FalI FalI |SmlI || FalI MboII FalI ||SetI || CviJI |TspDTI SfaNI | CviJI ||| HinfI || HaeIII \\ \ \ \ \\\ \ \\ \ CAACACGCATCTTTCCAATACAATCGGCTCAAAGAACAGCTTGAGTCATCAAAGGCCAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTGCGTAGAAAGGTTATGTTAGCCGAGTTTCTTGTCGAACTCAGTAGTTTCCGGTTG / / / / / / / / / / / / TspDTI | SfaNI CviJI | | | | | | | Bce83I* MboII FalI | | | | | | HaeIII FalI | | | | | | CviJI | | | | | PleI | | | | | MlyI | | | | FalI | | | | FalI | | | HinfI | | SmlI | CviJI | AluI SetI Q H A S F Q Y N R L K E Q L E S S K A N N T H L S N T I G S K N S L S H Q R P T T R I F P I Q S A Q R T A * V I K G Q L ----:----|----:----|----:----|----:----|----:----|----:----| C C A D K W Y L R S L S C S S D D F A L V V R M K G I C D A * L V A Q T M L P W L V C R E L V I P E F F L K L * * L G V Bce83I* TfiI | BsrI BfiI TspEI Hpy166II AciI HinfI \ \ \ \ \ \ \ TGGGATAGTATTGAATACGCTTTGAACACTAAAATTGTGAACTTGGAAAACCGCTTTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTATCATAACTTATGCGAAACTTGTGATTTTAACACTTGAACCTTTTGGCGAAACTT / / / / / BsrI BfiI | Hpy166II AciI TspEI W D S I E Y A L N T K I V N L E N R F E G I V L N T L * T L K L * T W K T A L N G * Y * I R F E H * N C E L G K P L * I ----:----|----:----|----:----|----:----|----:----|----:----| Q S L I S Y A K F V L I T F K S F R K S S P Y Y Q I R K S C * F Q S S P F G S Q P I T N F V S Q V S F N H V Q F V A K F MaeII MboII | SetI TspDTI | TspDTI | TaiI Hpy188I \ \ \ \ \ \ TCTACAATGAAAGAAAAAAATGATATTGAAGAAAAATATCAAACTGCCTTACGTTCATCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGTTACTTTCTTTTTTTACTATAACTTCTTTTTATAGTTTGACGGAATGCAAGTAGA / / / / / / / HinfI TspDTI | TspDTI | MaeII Hpy188I TfiI MboII TaiI SetI S T M K E K N D I E E K Y Q T A L R S S L Q * K K K M I L K K N I K L P Y V H L Y N E R K K * Y * R K I S N C L T F I * ----:----|----:----|----:----|----:----|----:----|----:----| D V I F S F F S I S S F Y * V A K R E D I * L S L F F H Y Q L F I D F Q R V N M R C H F F F I I N F F F I L S G * T * R TfiI HinfI |AjuI || Hin4II* SetI || | TaqI | TspEI || | AsuII \ \ \\ \ \ GAAACATTAGGTAAGCAATTAGAAAAAGAAAAAGAGAATCATTCGAAGGCAGTTTTGGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTAATCCATTCGTTAATCTTTTTCTTTTTCTCTTAGTAAGCTTCCGTCAAAACCTT / / / // / SetI TspEI AjuI |HinfI AsuII |TfiI TaqI Hin4II* E T L G K Q L E K E K E N H S K A V L E K H * V S N * K K K K R I I R R Q F W K N I R * A I R K R K R E S F E G S F G S ----:----|----:----|----:----|----:----|----:----|----:----| S V N P L C N S F S F S F * E F A T K S Q F M L Y A I L F L F L S D N S P L K P F C * T L L * F F F F L I M R L C N Q F DrdI AjuI | EciI Esp3I BsmAI | | BsrDI BsmAI | AciI | | | CviRI* \ \ \ \ \ \ \ GTGAAAGACTTGGAGAGACGGGCGGAGACATTGAAGTCATCATTGCAAAGTATAAGTGAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTTCTGAACCTCTCTGCCCGCCTCTGTAACTTCAGTAGTAACGTTTCATATTCACTA / / // / / / / AjuI BsmAI |AciI | | BsrDI CviRI* Esp3I BsmAI | EciI DrdI V K D L E R R A E T L K S S L Q S I S D * K T W R D G R R H * S H H C K V * V M E R L G E T G G D I E V I I A K Y K * * ----:----|----:----|----:----|----:----|----:----|----:----| T F S K S L R A S V N F D D N C L I L S L S L S P S V P P S M S T M M A F Y L H H F V Q L S P R L C Q L * * Q L T Y T I Csp6I |RsaI ||MmeI |||MboII |||| ApoI |||| TspEI |||| |MboII |||| || Eco57I |||| || Eco57MI |||| || | BarI |||| || | |SetI PsiI |||| || | ||DdeI BsaBI |||| || | ||| BsmAI BspCNI | BarI |||| || | ||| Eco31I |BseMII \ \ \\\\ \\ \ \\\ \ \\ GATTATAATCTACTGAAGAAGAAGTACGAAATTCAAAGGTCTCAGTTGGAACAAAAAGAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATATTAGATGACTTCTTCTTCATGCTTTAAGTTTCCAGAGTCAACCTTGTTTTTCTC / / /// / /// / / / // | BsaBI ||| | ||| SetI | | |BseMII | PsiI ||| | ||BarI | | BspCNI BarI ||| | |TspEI | Eco31I ||| | |ApoI | BsmAI ||| | Eco57MI DdeI ||| | Eco57I ||| MboII ||MboII ||Csp6I |RsaI MmeI D Y N L L K K K Y E I Q R S Q L E Q K E I I I Y * R R S T K F K G L S W N K K R L * S T E E E V R N S K V S V G T K R E ----:----|----:----|----:----|----:----|----:----|----:----| S * L R S F F F Y S I * L D * N S C F S H N Y D V S S S T R F E F T E T P V F L I I I * Q L L L V F N L P R L Q F L F L BsrDI SfeI* Hpy178III* | TspEI |SetI \ \ \ \\ AACGAACTAAAACCACATCAAGAAAACAGCAATGAGAAAATTATAGATAAAATACCTGTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTGATTTTGGTGTAGTTCTTTTGTCGTTACTCTTTTAATATCTATTTTATGGACAT / / / / / Hpy178III* BsrDI TspEI SetI SfeI* N E L K P H Q E N S N E K I I D K I P V T N * N H I K K T A M R K L * I K Y L * R T K T T S R K Q Q * E N Y R * N T C R ----:----|----:----|----:----|----:----|----:----|----:----| F S S F G C * S F L L S F I I S L I G T S R V L V V D L F C C H S F * L Y F V Q V F * F W M L F V A I L F N Y I F Y R Y MseI |PmeI |AhaIII* || MnlI || | FatI || | NcoI || | StyI || | SecI* Hin4I || | DsaI* | Bce83I* TspEI || | |CviAII | | BbvII* SmlI | MseI || | || NlaIII | | | MboII |SetI \ \ \\ \ \\ \ \ \ \ \ \\ GAATTAACAGATAGTTTAAACTCCATGGAGGGAAATATAGAAGACGAATGGACTTTACCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATTGTCTATCAAATTTGAGGTACCTCCCTTTATATCTTCTGCTTACCTGAAATGGA // // / / // / / / / |MseI || | | |DsaI* | Bce83I* | SetI TspEI || | | |SecI* Hin4I BbvII* || | | |StyI MboII || | | |NcoI || | | |FatI || | | CviAII || | NlaIII || MnlI |MseI AhaIII* PmeI E L T D S L N S M E G N I E D E W T L P N * Q I V * T P W R E I * K T N G L Y L I N R * F K L H G G K Y R R R M D F T S ----:----|----:----|----:----|----:----|----:----|----:----| S N V S L K F E M S P F I S S S H V K G L I L L Y N L S W P P F Y L L R I S K V F * C I T * V G H L S I Y F V F P S * R TspEI | TspGWI Hpy178III* | | BinI* | ApoI | | | MboI | TspEI | | | | DpnI | | MnlI Hin4I | | | | |BstKTI \ \ \ \ \ \ \ \ \\ CAAGAAAATTCTATGCTGTCATTATCAATGTCAAAACTTGGCGAATTAGAAAGCGATCCG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTTAAGATACGACAGTAATAGTTACAGTTTTGAACCGCTTAATCTTTCGCTAGGC / / // / / / // / | | |TspEI | | | || MboI | | |ApoI | | | |DpnI | | Hin4I | | | BstKTI | MnlI | | BinI* Hpy178III* | TspEI SmlI TspGWI Q E N S M L S L S M S K L G E L E S D P K K I L C C H Y Q C Q N L A N * K A I R R K F Y A V I I N V K T W R I R K R S V ----:----|----:----|----:----|----:----|----:----|----:----| * S F E I S D N D I D F S P S N S L S G E L F N * A T M I L T L V Q R I L F R D L F I R H Q * * * H * F K A F * F A I R Hpy178III* MwoI BsmAI TfiI | TspDTI | CviJI Esp3I HinfI | | NdeI | | MboII \ \ \ \ \ \ \ \ TCTCTAAAACCCATTTACAATGAATCTCACGAAACCATATGTAGCGAAGAAAGCCAACAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGATTTTGGGTAAATGTTACTTAGAGTGCTTTGGTATACATCGCTTCTTTCGGTTGTA / / / / / / / / Esp3I | | | NdeI MwoI | MboII BsmAI | | TspDTI CviJI | Hpy178III* HinfI TfiI S L K P I Y N E S H E T I C S E E S Q H L * N P F T M N L T K P Y V A K K A N I S K T H L Q * I S R N H M * R R K P T F ----:----|----:----|----:----|----:----|----:----|----:----| D R F G M * L S D * S V M H L S S L W C T E L V W K C H I E R F W I Y R L F G V R * F G N V I F R V F G Y T A F F A L M Ksp632I* |BbvI |MnlI ||Hpy178III* ||| CviJI ||| HaeIII ||| |AciI ||| |BisI ||| ||BlsI ||| |||TseI ||| |||TauI ||| |||NspBII* ||| ||||BisI ||| |||||BlsI ||| ||||||MboII \\\ \\\\\\\ TTTGATAGAAAAAATGTGGATTTCAGCATTGACGATATTCCAGAAGAGGCCGCTGCTTTA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTATCTTTTTTACACCTAAAGTCGTAACTGCTATAAGGTCTTCTCCGGCGACGAAAT / /// /////// / | ||BbvI ||||||| MwoI | || ||||||TseI | || |||||MboII | || |||||BisI | || ||||BlsI | || |||NspBII* | || |||AciI | || ||BisI | || |BlsI | || HaeIII | || CviJI | || TauI | |Hpy178III* | Ksp632I* MnlI F D R K N V D F S I D D I P E E A A A L L I E K M W I S A L T I F Q K R P L L Y * * K K C G F Q H * R Y S R R G R C F T ----:----|----:----|----:----|----:----|----:----|----:----| K S L F F T S K L M S S I G S S A A A K N Q Y F F H P N * C Q R Y E L L P R Q K K I S F I H I E A N V I N W F L G S S * Hin4I |SapI TfiI |Ksp632I* MwoI Hin4II* HinfI MseI TspDTI || HgaI \ \ \ \ \ \\ \ CAAGCAATCAGGGAAGGGGAATCAATGAACTCGTTAAACAACACATCAATACCATACAGA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGTTAGTCCCTTCCCCTTAGTTACTTGAGCAATTTGTTGTGTAGTTATGGTATGTCT / / / / / / Hin4II* HinfI | TspDTI Hin4I Ksp632I* TfiI MseI SapI Q A I R E G E S M N S L N N T S I P Y R K Q S G K G N Q * T R * T T H Q Y H T E S N Q G R G I N E L V K Q H I N T I Q K ----:----|----:----|----:----|----:----|----:----|----:----| C A I L S P S D I F E N F L V D I G Y L V L L * P L P I L S S T L C C M L V M C L C D P F P F * H V R * V V C * Y W V S NheI AluI CviJI |MaeI ||SetI ||Cac8I ||| BmtI ||| | MboII ||| | | AluI ||| | | CviJI ||| | | | SetI ||| | | | | TaqI ||| | | | | | ApoI ||| | | | | | TspEI ||| | | | | | EcoRI ||| | | | | | | Hin4I ||| | | | | | | | CfrI ||| | | | | | | | | CviJI ||| | | | | | | | | HaeIII ||| | | | | | | | | | MwoI ||| | | | | | | | | | | Hin6I ||| | | | | | | | | | | |GlaI ||| | | | | | | | | | | |Eco47III ||| | | | | | | | | | | ||HhaI ||| | | | | | | | | | | |||HaeII ||| | | | | | | | | | | ||||BceAI Hpy166II \\\ \ \ \ \ \ \ \ \ \ \ \\\\\ \ AGAGCTAGCGTCCAGCTATCGAATTCTAACGGCCACATAAGCGCTCATCTGGTGAACAAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGATCGCAGGTCGATAGCTTAAGATTGCCGGTGTATTCGCGAGTAGACCACTTGTTC / / /// / / / // / / // //// / / | | ||| | | | || EcoRI | |MwoI |||| BceAI Hpy166II | | ||| | | | || TspEI | CfrI |||Hin6I | | ||| | | | || ApoI HaeIII ||Eco47III | | ||| | | | |TaqI CviJI ||GlaI | | ||| | | | Hin4I |HhaI | | ||| | | CviJI HaeII | | ||| | | AluI | | ||| | SetI | | ||| MboII | | ||NheI | | |MaeI | | Cac8I | CviJI | AluI | BmtI SetI HgaI R A S V Q L S N S N G H I S A H L V N K E L A S S Y R I L T A T * A L I W * T S S * R P A I E F * R P H K R S S G E Q V ----:----|----:----|----:----|----:----|----:----|----:----| L A L T W S D F E L P W M L A * R T F L F L * R G A I S N * R G C L R E D P S C S S A D L * R I R V A V Y A S M Q H V L MseI | HphI | | Csp6I Hin4II* SetI TspEI | | |RsaI MseI | TspGWI |TspEI HphI SfaNI TspEI \ \ \\ \ \ \ \\ \ \ \ TTAAGTACGGAGTTAAAAAGATTGGAAGGTGAATTATCAGCATCAAAGGAATTATACGAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCATGCCTCAATTTTTCTAACCTTCCACTTAATAGTCGTAGTTTCCTTAATATGCTA // // / / / / / / / || |Csp6I | | | SetI | HphI SfaNI || RsaI | | TspGWI TspEI TspEI |MseI | Hin4II* HphI MseI L S T E L K R L E G E L S A S K E L Y D * V R S * K D W K V N Y Q H Q R N Y T I K Y G V K K I G R * I I S I K G I I R * ----:----|----:----|----:----|----:----|----:----|----:----| N L V S N F L N S P S N D A D F S N Y S T L Y P T L F I P L H I I L M L P I I R * T R L * F S Q F T F * * C * L F * V I MseI Hpy178III* \ \ AATTTACTGAAAGAAAAGACAAAAGCAAATGATGAGATTTTAAGACTTCTGGAAGAAAAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATGACTTTCTTTTCTGTTTTCGTTTACTACTCTAAAATTCTGAAGACCTTCTTTTG / / / TspEI MseI Hpy178III* N L L K E K T K A N D E I L R L L E E N I Y * K K R Q K Q M M R F * D F W K K T F T E R K D K S K * * D F K T S G R K R ----:----|----:----|----:----|----:----|----:----|----:----| L K S F S F V F A F S S I K L S R S S F Y N V S L F S L L L H H S K L V E P L F I * Q F F L C F C I I L N * S K Q F F V ApoI MboI TspEI | DpnI MboII | |BstKTI | MnlI SetI | || MseI SfaNI CviRI* \ \ \ \ \\ \ \ \ GATAAATTCAATGAGGTAAATAAACAGAAAGATGATCTCTTAAAAAGAGTTGAGCAGATG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTAAGTTACTCCATTTATTTGTCTTTCTACTAGAGAATTTTTCTCAACTCGTCTAC / / / / // / / / / | | | SetI || MboI MseI SfaNI CviRI* | | TspEI |DpnI | | ApoI BstKTI | MnlI MboII D K F N E V N K Q K D D L L K R V E Q M I N S M R * I N R K M I S * K E L S R C * I Q * G K * T E R * S L K K S * A D A ----:----|----:----|----:----|----:----|----:----|----:----| S L N L S T F L C F S S R K F L T S C I R Y I * H P L Y V S L H D R L F L Q A S I F E I L Y I F L F I I E * F S N L L H HphI TspEI SetI MnlI SetI | MnlI TspEI \ \ \ \ \ \ \ CAAAGTAAATTGGAAACCTCCTTACAACTATTAGGTGAAAAGACTGAACAAGTGGAGGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCATTTAACCTTTGGAGGAATGTTGATAATCCACTTTTCTGACTTGTTCACCTCCTT / / / / / / | SetI MnlI SetI | MnlI TspEI HphI Q S K L E T S L Q L L G E K T E Q V E E K V N W K P P Y N Y * V K R L N K W R N K * I G N L L T T I R * K D * T S G G I ----:----|----:----|----:----|----:----|----:----|----:----| C L L N S V E K C S N P S F V S C T S S A F Y I P F R R V V I L H F S Q V L P P L T F Q F G G * L * * T F L S F L H L F Hpy188I | Hin4I | Hin4I | |MseI CviRI* | ||SfaNI | EcoT22I Hin4I | ||AhaIII* | | SfaNI Hin4I \ \\\ \ \ \ \ TTAGAAAATGATGTGTCCGATTTAAAAGAGATGATGCATCAACAAGTTCAACAAATGGTA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTACTACACAGGCTAAATTTTCTCTACTACGTAGTTGTTCAAGTTGTTTACCAT / // // / / / // TspEI || || SfaNI | CviRI* |SfaNI || |MseI EcoT22I Hin4I || AhaIII* Hin4I |Hpy188I Hin4I Hin4I L E N D V S D L K E M M H Q Q V Q Q M V * K M M C P I * K R * C I N K F N K W * R K * C V R F K R D D A S T S S T N G R ----:----|----:----|----:----|----:----|----:----|----:----| N S F S T D S K F S I I C * C T * C I T I L F H H T R N L L S S A D V L E V F P * F I I H G I * F L H H M L L N L L H Y CviRI* \ GAAATGCAAGGAAAAATGAGATAA 2110 2120 ----:----|----:----|---- CTTTACGTTCCTTTTTACTCTATT / CviRI* E M Q G K M R * K C K E K * D X N A R K N E I X ----:----|----:----|---- S I C P F I L Y L F A L F F S I F H L S F H S L # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AhaIII* 2 DraI AjuI 1 AluI 9 AluBI ApoI 8 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 1 BarI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 2 BpuEI BceAI 1 BcgI 1 BclI 1 FbaI,Ksp22I BfiI 1 BmrI,BmuI BglI 1 BinI* 2 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmtI 1 BspOI BplI 2 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseGI 3 BstF5I,BtsCI BseMII 4 BsmAI 7 Alw26I,BstMAI BspCNI 4 BsrDI 3 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 7 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 17 CviKI-1 CviRI* 7 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 7 MalI DrdI 1 AasI,DseDI DsaI* 2 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 2 EcoRI 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 3 BsmBI FalI 6 FatI 2 FokI 3 GlaI 1 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 9 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MfeI 1 MunI MlyI 3 SchI MmeI 1 MnlI 8 MseI 13 Tru1I,Tru9I MwoI 6 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PleI 3 PpsI PmeI 1 MssI PsiI 1 AanI RsaI 4 AfaI SapI 1 LguI,PciSI,BspQI SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 25 SfaNI 8 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 7 TauI 2 TfiI 6 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 28 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 3 TscAI XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BalI BamHI BciVI BdaI BetI* BglII BmeT110I BmgT120I BsaAI BsaXI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I CauII* Cfr9I ClaI CspCI DinI DraII DraIII Eam1105I Ecl136II EcoICRI EcoNI EcoP15I EcoRII EcoRV EgeI EheI EspI* FaqI FauI FnuDII* FseI FspAI GsaI GsuI HgiCI* HgiJII* HpaI KasI KpnI MauBI McrI* MluI MroNI MslI MstI* MvaI NaeI NarI NgoMIV NlaIV NmeAIII NotI NruI NspI OliI PacI PasI PflMI PfoI PmaCI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI ScrFI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TatI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769