Restriction Map of ABM1/YJR108W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ABM1/YJR108W on chromosome X from coordinates 628712 to 629083.


HindIII |FokI ||AluI ||CviJI |||TspDTI ||||SetI |||||MseI Csp6I Hpy178III* ||||||AhaIII* BseGI |RsaI | BccI ||||||| ApoI | StyI MnlI |SetI | | Tsp4CI* ||||||| TspEI | SecI* \ \\ \ \ \ \\\\\\\ \ \ \ ATGTCTTGGAGGTACTCTATCTTGACCGTAGATGGAAGCTTTAAAATTTTCATCCCTTGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAACCTCCATGAGATAGAACTGGCATCTACCTTCGAAATTTTAAAAGTAGGGAACC / / // / / /// //// / / MnlI | |Csp6I | Tsp4CI* ||| |||MseI TspEI SecI* | RsaI | BccI ||| ||| BseGI StyI SetI Hpy178III* ||| ||| ApoI ||| ||AhaIII* ||| |FokI ||| HindIII ||CviJI ||AluI |TspDTI SetI M S W R Y S I L T V D G S F K I F I P W C L G G T L S * P * M E A L K F S S L G V L E V L Y L D R R W K L * N F H P L G ----:----|----:----|----:----|----:----|----:----|----:----| X D Q L Y E I K V T S P L K L I K M G Q X T K S T S * R S R L H F S * F K * G K H R P P V R D Q G Y I S A K F N E D R P TsoI | Hin6I | |GlaI | |Eco47III | ||TseI | ||HhaI | |||BisI MaeII | |||HaeII |PmaCI | ||||BlsI |BsaAI | |||||FatI || SetI | |||||CviRI* || TaiI | ||||||CviAII || | BbvI | ||||||| NlaIII || | ApoI | ||||||| |CviJI || | TspEI | ||||||| || ApoI TfiI SspI || | |MnlI | ||||||| || TspEI HinfI \ \\ \ \\ \ \\\\\\\ \\ \ \ GAAATATTCCTCACGTGGAATTTTTTGAGCGCTGCATGGCTAAATTCTACCGAATCCAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTATAAGGAGTGCACCTTAAAAAACTCGCGACGTACCGATTTAAGATGGCTTAGGTTA / / // / / / /////// /// / / / SspI | || | | | ||||||| ||CviJI TspEI | TaiI | || | | | ||||||| |FatI ApoI | SetI | || | | | ||||||| CviAII HinfI | || | | | ||||||CviRI* TfiI | || | | | ||||||NlaIII | || | | | ||||||TseI | || | | | |||||BisI | || | | | ||||BlsI | || | | | |||Hin6I | || | | | ||Eco47III | || | | | ||GlaI | || | | | |HhaI | || | | | HaeII | || | | TsoI | || | TspEI | || | ApoI | || | BbvI | || MnlI | |MaeII | BsaAI | PmaCI TaiI SetI E I F L T W N F L S A A W L N S T E S N K Y S S R G I F * A L H G * I L P N P I N I P H V E F F E R C M A K F Y R I Q Y ----:----|----:----|----:----|----:----|----:----|----:----| S I N R V H F K K L A A H S F E V S D L P F I G * T S N K S R Q M A L N * R I W F Y E E R P I K Q A S C P * I R G F G I FatI MaeII AflIII |BsaAI BspLU11I* |SnaBI |CviAII || SetI || NspI SduI || TaiI || NlaIII BseSI MseI \\ \ \\ \ \ \ ACGTATATCCACTACTCAACATGTTGGGGCACAAGTGATTACACACTTAATATCTCTGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGCATATAGGTGATGAGTTGTACAACCCCGTGTTCACTAATGTGTGAATTATAGAGACAG // / // / / |MaeII | || BseSI MseI SnaBI | || SduI BsaAI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI T Y I H Y S T C W G T S D Y T L N I S V R I S T T Q H V G A Q V I T H L I S L S V Y P L L N M L G H K * L H T * Y L C H ----:----|----:----|----:----|----:----|----:----|----:----| V Y I W * E V H Q P V L S * V S L I E T Y T Y G S S L M N P C L H N C V * Y R Q R I D V V * C T P A C T I V C K I D R D AvaI XhoI SmlI |TaqI AluI |BmeT110I CviJI HindII ||Hpy178III* | SetI Hpy166II ||| CviRI* | | SfeI* TspEI | MaeI MseI ||| | BsmI \ \ \ \ \ \ \ \\\ \ \ ATAGAAGCTACTACAGAGAAATTGGTTGACACTAGATTATTAACAACACTCGAGAATGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTTCGATGATGTCTCTTTAACCAACTGTGATCTAATAATTGTTGTGAGCTCTTACGT / / / / / / / // / | CviJI SfeI* | | MaeI MseI || CviRI* | AluI | Hpy166II || BsmI SetI | HindII |Hpy178III* TspEI |SmlI |XhoI |AvaI BmeT110I TaqI I E A T T E K L V D T R L L T T L E N A * K L L Q R N W L T L D Y * Q H S R M Q R S Y Y R E I G * H * I I N N T R E C N ----:----|----:----|----:----|----:----|----:----|----:----| M S A V V S F N T S V L N N V V S S F A * L L * * L S I P Q C * I I L L V R S H Y F S S C L F Q N V S S * * C C E L I C BbvII* | MboII | |TspDTI | || MboII | || | FatI | || | |CviAII BdaI | || | || NlaIII AciI MseI BdaI | || | || | MnlI \ \ \ \ \\ \ \\ \ \ ACCGCTTGGATTAACTCAAACTCTATTGATGAAGACGAAGATGATATGCCTCATGCCACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCGAACCTAATTGAGTTTGAGATAACTACTTCTGCTTCTACTATACGGAGTACGGTGA / / / / / / // / AciI MseI BdaI | | | || MnlI BdaI | | | |FatI | | | CviAII | | NlaIII | MboII TspDTI BbvII* MboII T A W I N S N S I D E D E D D M P H A T P L G L T Q T L L M K T K M I C L M P L R L D * L K L Y * * R R R * Y A S C H * ----:----|----:----|----:----|----:----|----:----|----:----| V A Q I L E F E I S S S S S S I G * A V L R K S * S L S * Q H L R L H Y A E H W G S P N V * V R N I F V F I I H R M G S DdeI Bpu10I | Cac8I | | Hin6I Hin4I | | |GlaI MaeII Hin4I | | ||HhaI | SetI |Cfr10I | | ||FnuDII* | TaiI ||HpaII | | |||Hin4I MaeIII | BdaI |||BccI | | |||Hin4I Tsp45I | BdaI |||| CviJI | | |||| MwoI | SfaNI \ \ \\\\ \ \ \ \\\\ \ \ \ AACGTAGCAGACCGGCTTGATGGGTTATCCCTTAGCAAGCGCGTATATAGCATCTGTCAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCATCGTCTGGCCGAACTACCCAATAGGGAATCGTTCGCGCATATATCGTAGACAGTG / /// // / / /// / / | ||Hin4I |Cfr10I | | ||| MwoI Tsp45I | ||Hin4I |CviJI | | ||FnuDII* MaeIII | |MaeII HpaII | | ||Hin6I | BdaI BccI | | |GlaI | BdaI | | HhaI TaiI | Hin4I SetI | Hin4I | Cac8I Bpu10I DdeI N V A D R L D G L S L S K R V Y S I C H T * Q T G L M G Y P L A S A Y I A S V T R S R P A * W V I P * Q A R I * H L S L ----:----|----:----|----:----|----:----|----:----|----:----| L T A S R S S P N D R L L R T Y L M Q * * R L L G A Q H T I G * C A R I Y C R D V Y C V P K I P * G K A L A Y I A D T V ApoI TspEI \ TACGAATTTTAG 370 ----:----|-- ATGCTTAAAATC / / | TspEI | ApoI SfaNI Y E F * T N F X R I L X ----:----|-- * S N * S R I K V F K L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AluI 2 AluBI ApoI 4 AcsI,XapI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BdaI 2 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BseGI 1 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BsmI 1 BsaMI,Mva1269I,PctI BspLU11I* 1 PscI,PciI Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI CviAII 3 CviJI 4 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I Eco47III 1 Aor51HI,AfeI FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 2 HaeII 1 BstH2I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 1 HpaII 1 HapII,BsiSI,MspI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 1 MboII 2 MnlI 3 MseI 4 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI RsaI 1 AfaI SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 6 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 1 TfiI 1 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 5 TasI,Tsp509I,Sse9I XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BinI* BmgT120I BmtI BplI BsaBI BsaXI BseBI BseMII BsePI BseRI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4II* HpaI HphI Hpy188I Hpy99I KasI KpnI Ksp632I* MauBI MboI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TatI TauI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769