Restriction Map of CCT5/YJR064W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CCT5/YJR064W on chromosome X from coordinates 555914 to 557602.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28235

HpaII | MboI | XhoII TseI | | DpnI CviJI | | |BstKTI |BisI | | || TaqI BglI ||BlsI Hpy166II SetI MnlI | | || |BinI* MwoI \\\ \ \ \ \ \ \\ \\ \ ATGGCTGCTCGTCCACAACAACCTCCTATGGAAATGCCGGATCTGTCGAACGCCATTGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACGAGCAGGTGTTGTTGGAGGATACCTTTACGGCCTAGACAGCTTGCGGTAACAC //// / / / /// / / / |||TseI | SetI MnlI ||| | BinI* MwoI ||BisI Hpy166II ||| | TaqI BglI |BlsI ||| XhoII CviJI ||| MboI ||DpnI |BstKTI HpaII M A A R P Q Q P P M E M P D L S N A I V W L L V H N N L L W K C R I C R T P L W G C S S T T T S Y G N A G S V E R H C G ----:----|----:----|----:----|----:----|----:----|----:----| X A A R G C C G G I S I G S R D F A M T X P Q E D V V V E * P F A P D T S R W Q H S S T W L L R R H F H R I Q R V G N H Hin4II* | Hpy178III* | | MboI | | | DpnI | | | |BstKTI | | | || MaeIII | | | || |BinI* | | | || ||SetI AccI | | | || |||Ksp632I* BccI |Hpy166II | | | || |||| BsmAI \ \\ \ \ \ \\ \\\\ \ GCACAAGACGAGATGGGTAGACCCTTTATTATCGTGAAGGATCAAGGTAACAAGAAGAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTCTGCTCTACCCATCTGGGAAATAATAGCACTTCCTAGTTCCATTGTTCTTCTCT / // / / // // / // / BccI |AccI | | || || | || BsmAI Hpy166II | | || || | |Ksp632I* | | || || | MaeIII | | || || BinI* | | || |SetI | | || MboI | | |DpnI | | BstKTI | Hpy178III* Hin4II* A Q D E M G R P F I I V K D Q G N K K R H K T R W V D P L L S * R I K V T R R D T R R D G * T L Y Y R E G S R * Q E E T ----:----|----:----|----:----|----:----|----:----|----:----| A C S S I P L G K I I T F S * P L L F L P V L R S P Y V R * * R S P D L Y C S S C L V L H T S G K N D H L I L T V L L S TseI CviJI |BisI ||BlsI ||| MaeI ||| | MboI ||| | | DpnI CviJI ||| | | |BstKTI HaeIII ||| | | || AluI MnlI | TspGWI ||| | | || CviJI MboII | | BbvI ||| | | || | SetI \ \ \ \ \\\ \ \ \\ \ \ CAGCACGGATTAGAGGCCAAGAAATCACATATATTGGCTGCTAGATCAGTAGCTTCTATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTGCCTAATCTCCGGTTCTTTAGTGTATATAACCGACGATCTAGTCATCGAAGATAA / / / / //// /// / / / MboII | TspGWI BbvI |||| ||| | | CviJI MnlI HaeIII |||| ||| | | AluI CviJI |||| ||| | SetI |||| ||| MboI |||| ||DpnI |||| |BstKTI |||| MaeI |||TseI ||BisI |BlsI CviJI Q H G L E A K K S H I L A A R S V A S I S T D * R P R N H I Y W L L D Q * L L L A R I R G Q E I T Y I G C * I S S F Y Y ----:----|----:----|----:----|----:----|----:----|----:----| C C P N S A L F D C I N A A L D T A E I V A R I L P W S I V Y I P Q * I L L K * L V S * L G L F * M Y Q S S S * Y S R N AsuI* AvaII DraII PpuMI MboI SanDI BglII |NlaIV XhoII |BmgT120I | DpnI ||NlaIV | |HphI SetI ||| SecI* | |BstKTI | HphI BslFI ||| DsaI* | ||Hpy178III* | |Tsp4CI* \ \\\ \ \ \\\ \ \\ ATCAAAACTTCGTTGGGTCCCCGTGGGTTAGATAAGATCTTGATTTCACCTGACGGTGAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTTGAAGCAACCCAGGGGCACCCAATCTATTCTAGAACTAAAGTGGACTGCCACTT / /// / // / / / // BslFI ||SanDI DsaI* || | | SetI |Tsp4CI* ||PpuMI SecI* || | Hpy178III* HphI ||DraII || XhoII ||AvaII || BglII ||AsuI* || MboI |BmgT120I |DpnI |NlaIV |HphI NlaIV BstKTI I K T S L G P R G L D K I L I S P D G E S K L R W V P V G * I R S * F H L T V K Q N F V G S P W V R * D L D F T * R * N ----:----|----:----|----:----|----:----|----:----|----:----| I L V E N P G R P N S L I K I E G S P S * * F K T P D G H T L Y S R S K V Q R H D F S R Q T G T P * I L D Q N * R V T F AluI HphI CviJI | BccI |MaeI | | BccI BslFI TspEI ||SetI \ \ \ \ \ \\\ ATCACCATCACTAACGATGGTGCTACAATTTTGTCCCAAATGGAGCTAGATAATGAGATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGGTAGTGATTGCTACCACGATGTTAAAACAGGGTTTACCTCGATCTATTACTCTAA / / / / / / / / HphI | BccI BslFI TspEI | | MaeI BccI | CviJI | AluI SetI I T I T N D G A T I L S Q M E L D N E I S P S L T M V L Q F C P K W S * I M R L H H H * R W C Y N F V P N G A R * * D C ----:----|----:----|----:----|----:----|----:----|----:----| I V M V L S P A V I K D W I S S S L S I F * W * * R H H * L K T G F P A L Y H S D G D S V I T S C N Q G L H L * I I L N TatI SmlI Csp6I |Csp6I | Hpy178III* TspDTI ||RsaI | | TspEI |RsaI CviRI* ||Bce83I* | | | BccI || HphI \ \\\ \ \ \ \ \\ \ GCAAAGTTGTTAGTACAACTTTCCAAATCTCAAGATGATGAAATTGGTGATGGTACTACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTCAACAATCATGTTGAAAGGTTTAGAGTTCTACTACTTTAACCACTACCATGATGA / / /// / // / // / CviRI* | ||TatI Hpy178III* |TspEI | || HphI | |Csp6I SmlI BccI | |Csp6I | RsaI | RsaI Bce83I* TspDTI A K L L V Q L S K S Q D D E I G D G T T Q S C * Y N F P N L K M M K L V M V L L K V V S T T F Q I S R * * N W * W Y Y W ----:----|----:----|----:----|----:----|----:----|----:----| A F N N T C S E L D * S S S I P S P V V Q L T T L V V K W I E L H H F Q H H Y * C L Q * Y L K G F R L I I F N T I T S S Hin6I MseI |GlaI PflMI |TspEI BsrI ||HhaI BsiYI* || FokI AccI \ \\\ \ \\ \ \ GGTGTTGTTGTTCTGGCAAGTGCGCTACTTGACCAAGCATTGGAGTTAATTCAAAAGGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAACAACAAGACCGTTCACGCGATGAACTGGTTCGTAACCTCAATTAAGTTTTCCCA / /// / / / / BsrI ||Hin6I BsiYI* | | FokI |GlaI PflMI | TspEI HhaI MseI G V V V L A S A L L D Q A L E L I Q K G V L L F W Q V R Y L T K H W S * F K R V C C C S G K C A T * P S I G V N S K G Y ----:----|----:----|----:----|----:----|----:----|----:----| P T T T R A L A S S S W A N S N I * F P Q H Q Q E P L H A V Q G L M P T L E F P T N N N Q C T R * K V L C Q L * N L L T CviJI |AciI |BisI ||BlsI |||TauI |||| TspEI BssNAI |||| | MwoI Hpy166II |||| | |TspDTI | BseGI |||| | || CviJI \ \ \\\\ \ \\ \ ATACATCCAATCAAAATCGCTAATGGATTTGATGAAGCCGCCAAATTAGCCATTTCCAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTAGGTTAGTTTTAGCGATTACCTAAACTACTTCGGCGGTTTAATCGGTAAAGGTTC // //// / / / / |AccI |||| | | | CviJI Hpy166II |||| | | TspEI BssNAI |||| | TspDTI BseGI |||| MwoI |||AciI ||BisI |BlsI CviJI TauI I H P I K I A N G F D E A A K L A I S K Y I Q S K S L M D L M K P P N * P F P S T S N Q N R * W I * * S R Q I S H F Q V ----:----|----:----|----:----|----:----|----:----|----:----| I C G I L I A L P N S S A A L N A M E L Y V D L * F R * H I Q H L R W I L W K W Y M W D F D S I S K I F G G F * G N G L TsoI | BcgI | | FatI | | AflIII | | BspLU11I* | | |CviAII | | || MaeIII | | || Tsp45I | | || |NspI | | || |NlaIII | | || || MboII TspEI TspDTI | | || || |HgaI |BcgI | MnlI \ \ \\ \\ \\ \\ \ \ TTAGAAGAAACATGTGACGACATTTCTGCGTCAAACGATGAATTGTTCAGGGACTTTTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTCTTTGTACACTGCTGTAAAGACGCAGTTTGCTACTTAACAAGTCCCTGAAAAAT / / / /// / / / / / / | BcgI | ||| | HgaI BcgI TspEI | MnlI TsoI | ||| Tsp45I TspDTI | ||| MaeIII | ||MboII | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L E E T C D D I S A S N D E L F R D F L * K K H V T T F L R Q T M N C S G T F Y R R N M * R H F C V K R * I V Q G L F I ----:----|----:----|----:----|----:----|----:----|----:----| N S S V H S S M E A D F S S N N L S K K T L L F M H R C K Q T L R H I T * P S K * F F C T V V N R R * V I F Q E P V K * StyI SecI* BslFI | MboI |AsuI* | | DpnI ||BmgT120I | | |FatI |||CviJI | | |BspHI |||HaeIII CviJI | | |BstKTI ||||AciI |NlaIV | | ||CviAII ||||BisI ||SduI | | ||Hpy178III* |||||BlsI ||HgiJII* | | ||| NlaIII ||||||TauI XcmI ||| TspEI | | ||| |BinI* \\\\\\\ \ \\\ \ \ \ \\\ \\ TTGAGGGCCGCCAAAACTTCTTTGGGCTCCAAAATTGTTTCCAAGGATCATGATAGATTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCCCGGCGGTTTTGAAGAAACCCGAGGTTTTAACAAAGGTTCCTAGTACTATCTAAA //// / / // / ///// // / |||AciI XcmI | |NlaIV TspEI ||||| || BinI* ||BisI | CviJI ||||| |BspHI |BslFI HgiJII* ||||| |FatI |AsuI* SduI ||||| Hpy178III* |BlsI ||||| CviAII BmgT120I ||||MboI HaeIII |||NlaIII CviJI ||DpnI TauI |BstKTI SecI* StyI L R A A K T S L G S K I V S K D H D R F * G P P K L L W A P K L F P R I M I D L E G R Q N F F G L Q N C F Q G S * * I C ----:----|----:----|----:----|----:----|----:----|----:----| N L A A L V E K P E L I T E L S * S L N I S P R W F K K P S W F Q K W P D H Y I Q P G G F S R Q A G F N N G L I M I S K FatI |CviAII || NlaIII MaeII BceAI || | MboI |BtrI | MwoI MwoI || | | DpnI || SetI | | CviJI | CviJI || | | |BstKTI || TaiI \ \ \ \ \ \\ \ \ \\ \\ \ GCTGAAATGGCTGTGGAAGCCGTCATAAATGTCATGGACAAAGATCGTAAAGACGTGGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTTACCGACACCTTCGGCAGTATTTACAGTACCTGTTTCTAGCATTTCTGCACCTA / / / / / / // // / / // | | | MwoI CviJI | |FatI || MboI | |MaeII | | CviJI | CviAII |DpnI | BtrI | BceAI NlaIII BstKTI TaiI MwoI SetI A E M A V E A V I N V M D K D R K D V D L K W L W K P S * M S W T K I V K T W I * N G C G S R H K C H G Q R S * R R G F ----:----|----:----|----:----|----:----|----:----|----:----| A S I A T S A T M F T M S L S R L S T S Q Q F P Q P L R * L H * P C L D Y L R P S F H S H F G D Y I D H V F I T F V H I AciI | MboI | XhoII | | DpnI | | |BstKTI | | || BinI* | | || | TfiI | | || | HinfI MseI TaqI MseI CviRI* | | || | |EciI TspEI VspI \ \ \ \ \ \\ \ \\ \ \ TTCGATTTAATCAAAATGCAAGGACGGGTTGGCGGATCTATAAGCGATTCAAAATTGATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTAAATTAGTTTTACGTTCCTGCCCAACCGCCTAGATATTCGCTAAGTTTTAACTAA / / / /// / / / / / TaqI MseI CviRI* ||| | | | HinfI TspEI ||| | | | TfiI ||| | | EciI ||| | BinI* ||| XhoII ||| MboI ||DpnI |BstKTI AciI F D L I K M Q G R V G G S I S D S K L I S I * S K C K D G L A D L * A I Q N * L R F N Q N A R T G W R I Y K R F K I D * ----:----|----:----|----:----|----:----|----:----|----:----| K S K I L I C P R T P P D I L S E F N I N R N L * F A L V P Q R I * L R N L I S E I * D F H L S P N A S R Y A I * F Q N FokI BseGI MnlI \ \ \ AATGGTGTCATTTTGGATAAAGATTTTTCTCATCCACAAATGCCTAAATGTGTTTTACCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCACAGTAAAACCTATTTCTAAAAAGAGTAGGTGTTTACGGATTTACACAAAATGGT / / / / VspI FokI BseGI MnlI MseI N G V I L D K D F S H P Q M P K C V L P M V S F W I K I F L I H K C L N V F Y Q W C H F G * R F F S S T N A * M C F T K ----:----|----:----|----:----|----:----|----:----|----:----| L P T M K S L S K E * G C I G L H T K G * H H * K P Y L N K E D V F A * I H K V I T D N Q I F I K R M W L H R F T N * W AluI CviJI BsiYI* | SetI | BccI | | MseI | |CviJI | | | MaeII | || SduI | | | AflIII | || HgiJII* | | | | SetI | || | Hpy188I MseI | | | | TaiI SetI \ \\ \ \ \ \ \ \ \ \ \ AAAGAGGGCTCTGATGGTGTTAAGTTAGCTATATTAACGTGTCCATTTGAACCTCCTAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCCCGAGACTACCACAATTCAATCGATATAATTGCACAGGTAAACTTGGAGGATTT / / / / / / / / / / / | | | Hpy188I | | CviJI | | AflIII SetI | | CviJI | | AluI | MaeII | | BccI | SetI MseI | HgiJII* MseI TaiI | SduI SetI BsiYI* K E G S D G V K L A I L T C P F E P P K K R A L M V L S * L Y * R V H L N L L N R G L * W C * V S Y I N V S I * T S * T ----:----|----:----|----:----|----:----|----:----|----:----| F S P E S P T L N A I N V H G N S G G L L L P S Q H H * T L * I L T D M Q V E * F L A R I T N L * S Y * R T W K F R R F Eco57I Eco57MI | TspEI TspEI MnlI | | MboII MboII \ \ \ \ \ CCAAAGACCAAGCATAAATTAGACATTTCTTCAGTAGAAGAATACCAAAAATTACAGACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCTGGTTCGTATTTAATCTGTAAAGAAGTCATCTTCTTATGGTTTTTAATGTCTGA / / // / / MnlI | |TspEI | TspEI | MboII MboII Eco57MI Eco57I P K T K H K L D I S S V E E Y Q K L Q T Q R P S I N * T F L Q * K N T K N Y R L K D Q A * I R H F F S R R I P K I T D L ----:----|----:----|----:----|----:----|----:----|----:----| G F V L C L N S M E E T S S Y W F N C V V L S W A Y I L C K K L L L I G F I V S W L G L M F * V N R * Y F F V L F * L S AciI | Cac8I | | Hin6I | | |GlaI | | |MboII TspDTI FauI | | ||HhaI \ \ \ \ \\\ TATGAACAAGATAAGTTCAAAGAAATGATAGACGATGTGAAGAAAGCGGGCGCAGATGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTTGTTCTATTCAAGTTTCTTTACTATCTGCTACACTTCTTTCGCCCGCGTCTACAA / / / /// TspDTI FauI | ||Hin6I | |GlaI | MboII | HhaI Cac8I AciI Y E Q D K F K E M I D D V K K A G A D V M N K I S S K K * * T M * R K R A Q M L * T R * V Q R N D R R C E E S G R R C C ----:----|----:----|----:----|----:----|----:----|----:----| * S C S L N L S I I S S T F F A P A S T K H V L Y T * L F S L R H S S L P R L H I F L I L E F F H Y V I H L F R A C I N SfeI* | BceAI BdaI CviJI | |BdaI BdaI MnlI HaeIII | |BdaI \ \ \ \ \\ GTTATATGCCAATGGGGGTTTGACGATGAGGCCAATCATCTACTTCTACAGAATGATTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAATATACGGTTACCCCCAAACTGCTACTCCGGTTAGTAGATGAAGATGTCTTACTAAAT / / / / // / BdaI MnlI HaeIII | |BceAI SetI BdaI CviJI | SfeI* BdaI BdaI V I C Q W G F D D E A N H L L L Q N D L L Y A N G G L T M R P I I Y F Y R M I Y Y M P M G V * R * G Q S S T S T E * F T ----:----|----:----|----:----|----:----|----:----|----:----| T I H W H P N S S S A L * R S R C F S K Q * I G I P T Q R H P W D D V E V S H N N Y A L P P K V I L G I M * K * L I I * CfrI SetI SetI | BccI | BalI | | BspMI | CviJI Tsp4CI* | | | BsiYI* | HaeIII MaeI BsrDI | McrI* \ \ \ \ \ \ \ \ \ \ CCTGCCGTAAGATGGGTAGGTGGCCAAGAACTAGAACACATTGCCATTTCCACAAACGGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGGCATTCTACCCATCCACCGGTTCTTGATCTTGTGTAACGGTAAAGGTGTTTGCCA / / / / / / / / // | | | SetI | CfrI | BsrDI |McrI* | | BspMI HaeIII MaeI Tsp4CI* | BsiYI* CviJI BccI BalI P A V R W V G G Q E L E H I A I S T N G L P * D G * V A K N * N T L P F P Q T V C R K M G R W P R T R T H C H F H K R S ----:----|----:----|----:----|----:----|----:----|----:----| G A T L H T P P W S S S C M A M E V F P V Q R L I P L H G L V L V C Q W K W L R R G Y S P Y T A L F * F V N G N G C V T Csp6I |RsaI |SetI ||FatI ||AflIII ||BspLU11I* |||CviAII |||| NspI |||| NlaIII |||| | Hpy178III* Hpy178III* |||| | | ApoI | DdeI TspEI |||| | | TspEI \ \ \ \\\\ \ \ \ CGCATTGTTCCAAGATTTCAAGACTTGTCTAAGGATAAATTAGGTACATGTTCCAGAATT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTAACAAGGTTCTAAAGTTCTGAACAGATTCCTATTTAATCCATGTACAAGGTCTTAA / / / // // / / Hpy178III* DdeI | || || | TspEI | || || | ApoI | || || Hpy178III* | || |BspLU11I* | || |AflIII | || |FatI | || CviAII | |NlaIII | |Csp6I | |NspI | RsaI TspEI SetI R I V P R F Q D L S K D K L G T C S R I A L F Q D F K T C L R I N * V H V P E F H C S K I S R L V * G * I R Y M F Q N L ----:----|----:----|----:----|----:----|----:----|----:----| R M T G L N * S K D L S L N P V H E L I D C Q E L I E L S T * P Y I L Y M N W F A N N W S K L V Q R L I F * T C T G S N DdeI | MboI | | DpnI Csp6I | | |BstKTI |RsaI | | || BinI* TaqI \\ \ \ \\ \ \ TACGAGCAGGAGTTTGGTACTACTAAGGATCGTATGCTGATTATCGAGCAAAGTAAAGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTCGTCCTCAAACCATGATGATTCCTAGCATACGACTAATAGCTCGTTTCATTTCTT // / // / / / |Csp6I | || MboI BinI* TaqI RsaI | |DpnI | BstKTI DdeI Y E Q E F G T T K D R M L I I E Q S K E T S R S L V L L R I V C * L S S K V K K R A G V W Y Y * G S Y A D Y R A K * R N ----:----|----:----|----:----|----:----|----:----|----:----| * S C S N P V V L S R I S I I S C L L S K R A P T Q Y * * P D Y A S * R A F Y L V L L L K T S S L I T H Q N D L L T F F MaeIII Tsp4CI* | FatI | AflIII BseGI | BspLU11I* |AluI | |CviAII AciI MboI |CviJI | || NspI FnuDII* | DpnI || SetI | || NlaIII | NlaIV | |BstKTI || | MaeII \ \\ \ \ \ \ \\ \\ \ \ ACAAAAACTGTAACATGTTTTGTTCGCGGTTCCAATAAAATGATCGTGGATGAAGCTGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTTGACATTGTACAAAACAAGCGCCAAGGTTATTTTACTAGCACCTACTTCGACTT / // // / / / // / // / // | || || | | NlaIV || MboI || | |TaiI | || || | AciI |DpnI || | |SetI | || || FnuDII* BstKTI || | MwoI | || |BspLU11I* || CviJI | || |AflIII || AluI | || |FatI |SetI | || CviAII BseGI | |MaeIII | NlaIII | NspI Tsp4CI* T K T V T C F V R G S N K M I V D E A E Q K L * H V L F A V P I K * S W M K L N K N C N M F C S R F Q * N D R G * S * T ----:----|----:----|----:----|----:----|----:----|----:----| V F V T V H K T R P E L L I I T S S A S F L F Q L M N Q E R N W Y F S R P H L Q C F S Y C T K N A T G I F H D H I F S F MwoI FokI | SetI | TaiI | |BsrDI DraIII | |CviRI* | TsoI | ||TspDTI | Csp6I | ||| MlyI | |RsaI HinfI | ||| PleI | ||MaeII | MaeII | ||| | FatI | |||BsaAI | AflIII | ||| | CviRI* | |||SnaBI | |PmaCI | ||| | |CviAII | |||MaeIII MlyI | |BsaAI | ||| | || HinfI | |||| SetI PleI | || SetI | ||| | || NlaIII | |||| TaiI |MseI | || TaiI Hpy166II \ \\\ \ \\ \ \ \\\\ \ \\ \ \\ \ \ CGTGCATTGCATGACTCACTATGTGTGGTACGTAACTTGGTTAAAGACTCACGTGTAGTT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGTAACGTACTGAGTGATACACACCATGCATTGAACCAATTTCTGAGTGCACATCAA //// /// // / / / //// / // / // // / / |||| ||| || | DraIII | |||| | || MseI || || | Hpy166II |||| ||| || HinfI | |||| | |PleI || || AflIII |||| ||| |FatI | |||| | MlyI || |MaeII |||| ||| CviAII | |||| MaeIII || BsaAI |||| ||CviRI* | |||MaeII || PmaCI |||| ||NlaIII | ||SnaBI |TaiI |||| |PleI | ||BsaAI |SetI |||| MlyI | |Csp6I HinfI |||FokI | RsaI ||CviRI* | TaiI |TspDTI | SetI MaeII TsoI BsrDI R A L H D S L C V V R N L V K D S R V V V H C M T H Y V W Y V T W L K T H V * F C I A * L T M C G T * L G * R L T C S L ----:----|----:----|----:----|----:----|----:----|----:----| R A N C S E S H T T R L K T L S E R T T V H M A H S V I H P V Y S P * L S V H L T C Q M V * * T H Y T V Q N F V * T Y N TseI |BisI ||BlsI ||BslFI |||CviJI |||| MaeIII |||| Tsp45I |||| | BbvI |||| | | Tth111I |||| | | | BssKI |||| | | | SecI* |||| | | | EcoRII |||| | | | | ScrFI DdeI |||| | | | | BseBI |BsmAI |||| | | | | |BseMII |Hpy188I |||| | | | | ||BspCNI || AluI |||| | | | | |||CviJI || CviJI Tsp4CI* |||| | | | | |||| MnlI || | SetI \ \\\\ \ \ \ \ \\\\ \ \\ \ \ TACGGTGGGGGAGCAGCCGAAGTGACTATGTCCCTGGCTGTCTCTGAGGAAGCTGATAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCACCCCCTCGTCGGCTTCACTGATACAGGGACCGACAGAGACTCCTTCGACTATTC / /// / / // ////// / / // / Tsp4CI* ||| BslFI | || |||||MnlI | | || CviJI ||CviJI | || ||||EcoRII | | || AluI ||TseI | || ||||BssKI | | |SetI |BisI | || ||||CviJI | | BsmAI BlsI | || |||SecI* | DdeI | || ||BseBI Hpy188I | || ||ScrFI | || |BspCNI | || BseMII | |BbvI | Tth111I Tsp45I MaeIII Y G G G A A E V T M S L A V S E E A D K T V G E Q P K * L C P W L S L R K L I S R W G S S R S D Y V P G C L * G S * * A ----:----|----:----|----:----|----:----|----:----|----:----| * P P P A A S T V I D R A T E S S A S L K R H P L L R L S * T G P Q R Q P L Q Y V T P S C G F H S H G Q S D R L F S I L MboI BclI | DpnI | |BstKTI | ||TspGWI | ||| BsmI | ||| CviRI* | ||| | EcoT22I | ||| | | SecI* MaeII | ||| | | DsaI* | SetI | ||| | | | TfiI | TaiI | ||| | | | HinfI MslI \ \ \ \\\ \ \ \ \ \ CAACGTGGTATTGATCAGTATGCATTCCGTGGATTCGCCCAAGCGTTAGACACCATTCCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGCACCATAACTAGTCATACGTAAGGCACCTAAGCGGGTTCGCAATCTGTGGTAAGGT / / // / / / / / / | MaeII || | | CviRI* | HinfI MslI TaiI || | EcoT22I | TfiI SetI || | BsmI DsaI* || BclI SecI* || MboI |TspGWI |DpnI BstKTI Q R G I D Q Y A F R G F A Q A L D T I P N V V L I S M H S V D S P K R * T P F Q T W Y * S V C I P W I R P S V R H H S N ----:----|----:----|----:----|----:----|----:----|----:----| C R P I S * Y A N R P N A W A N S V M G A V H Y Q D T H M G H I R G L T L C W E L T T N I L I C E T S E G L R * V G N W BinI* | Hpy178III* | | MboI CviJI | | | DpnI | ApoI | | | |PsrI AccI | TspEI | | | |BstKTI Hpy188I |Hpy166II \ \ \ \ \ \\ \ \\ ATGACTTTGGCTGAAAATTCTGGTCTTGATCCAATCGGAACTTTGTCTACATTGAAAAGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGAAACCGACTTTTAAGACCAGAACTAGGTTAGCCTTGAAACAGATGTAACTTTTCA / / / / /// / / // / CviJI | | | ||| MboI Hpy188I |AccI PsrI | | | ||DpnI Hpy166II | | | |BstKTI | | | Hpy178III* | | PsrI | BinI* TspEI ApoI M T L A E N S G L D P I G T L S T L K S * L W L K I L V L I Q S E L C L H * K V D F G * K F W S * S N R N F V Y I E K * ----:----|----:----|----:----|----:----|----:----|----:----| I V K A S F E P R S G I P V K D V N F L L S K P Q F N Q D Q D L R F K T * M S F H S Q S F I R T K I W D S S Q R C Q F T DdeI Bpu10I | MaeIII Hpy166II | |MmeI |PsrI TaqI | ||SetI Hin4II* \\ \ \ \\\ \ AAACAACTGAAAGAAAAGATTTCCAACATTGGTGTCGATTGCTTAGGTTACGGGTCTAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTGACTTTCTTTTCTAAAGGTTGTAACCACAGCTAACGAATCCAATGCCCAGATTA / / // / / Hpy166II TaqI || MaeIII Hin4II* |Bpu10I |MmeI |DdeI SetI K Q L K E K I S N I G V D C L G Y G S N N N * K K R F P T L V S I A * V T G L M T T E R K D F Q H W C R L L R L R V * * ----:----|----:----|----:----|----:----|----:----|----:----| L C S F S F I E L M P T S Q K P * P D L Y V V S L F S K W C Q H R N S L N R T * F L Q F F L N G V N T D I A * T V P R I BinI* TseI TspDTI |BisI FatI | MboI ||BlsI |CviAII | | DpnI PflMI ||| ApoI || NlaIII | | |BstKTI BsiYI* ||| TspEI BbvI \\ \ \ \ \\ \ \\\ \ \ GACATGAAGGAACTATTTGTCGTTGATCCATTTATTGGCAAAAAGCAGCAAATTCTTTTA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTACTTCCTTGATAAACAGCAACTAGGTAAATAACCGTTTTTCGTCGTTTAAGAAAAT / // / / // / / /// / / | |FatI | | || | BsiYI* ||TseI | SetI | CviAII | | || | PflMI |BisI TspEI NlaIII | | || MboI BlsI ApoI | | |DpnI | | BstKTI | BinI* TspDTI D M K E L F V V D P F I G K K Q Q I L L T * R N Y L S L I H L L A K S S K F F * H E G T I C R * S I Y W Q K A A N S F S ----:----|----:----|----:----|----:----|----:----|----:----| S M F S S N T T S G N I P L F C C I R K H C S P V I Q R Q D M * Q C F A A F E K V H L F * K D N I W K N A F L L L N K * AluI CviJI MaeII | SetI MseI | SetI | | TspEI |AhaIII* | TaiI \ \ \ \\ \ \ GCTACTCAATTATGTAGAATGATTTTAAAGATTGATAACGTCATCATTAGTGGTAAAGAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGAGTTAATACATCTTACTAAAATTTCTAACTATTGCAGTAGTAATCACCATTTCTA / / // / / CviJI TspEI |MseI | MaeII BbvI AhaIII* TaiI AluI SetI A T Q L C R M I L K I D N V I I S G K D L L N Y V E * F * R L I T S S L V V K M Y S I M * N D F K D * * R H H * W * R * ----:----|----:----|----:----|----:----|----:----|----:----| A V * N H L I I K F I S L T M M L P L S L * E I I Y F S K L S Q Y R * * * H Y L S S L * T S H N * L N I V D D N T T F I GAGTATTGA ----:---- CTCATAACT E Y * S I X V L X ----:---- S Y Q H T N L I S # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 5 BspACI,SsiI AflIII 5 AhaIII* 1 DraI AluI 6 AluBI ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BccI 6 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 2 BglI 1 BglII 1 BinI* 7 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 2 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspLU11I* 3 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 12 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I CfrI 1 AcoI,EaeI Csp6I 5 CviQI,RsaNI CviAII 7 CviJI 21 CviKI-1 CviRI* 5 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 12 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 2 BtgI,BstDSI EciI 1 Eco57I 1 AcuI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 7 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 2 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 6 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MmeI 1 MnlI 7 MseI 7 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 3 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PsrI 1 RsaI 5 AfaI SanDI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 21 SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 4 TatI 1 TauI 2 TfiI 2 PfeI TseI 4 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 2 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BbvII* BciVI BetI* BfiI BmeT110I BmtI BplI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspMII* BspOI BsrBI BstAPI BstEII BstXI BtgZI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI GsuI HaeII HgiAI* HgiCI* Hin4I HindII HindIII HpaI Hpy99I KasI KpnI MauBI MfeI MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PfoI PmeI PpiI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SapI SauI* ScaI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TspMI TspRI TstI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769