Restriction Map of NUP85/YJR042W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NUP85/YJR042W on chromosome X from coordinates 514055 to 516289.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.12835

AcyI MaeII |ZraI || TaqI || SetI || TaiI || AatII TfiI || |MboI HinfI || ||Hpy99I | BsaBI || |||DpnI TaqI | | TaqI || ||||BstKTI ClaI | | ClaI || |||||TspEI \ \ \ \ \\ \\\\\\ ATGACAATCGATGATTCAAATCGATTACTTATGGACGTCGATCAATTTGATTTTTTGGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTTAGCTACTAAGTTTAGCTAATGAATACCTGCAGCTAGTTAAACTAAAAAACCTG / // / //// // / / / ClaI |BsaBI ClaI |||| || | TspEI Hpy99I TaqI HinfI TaqI |||| || MboI TfiI |||| |DpnI |||| BstKTI |||| TaqI |||MaeII |||AcyI ||ZraI |Hpy99I AatII TaiI SetI M T I D D S N R L L M D V D Q F D F L D * Q S M I Q I D Y L W T S I N L I F W T D N R * F K S I T Y G R R S I * F F G R ----:----|----:----|----:----|----:----|----:----|----:----| X V I S S E F R N S I S T S * N S K K S X S L R H N L D I V * P R R D I Q N K P H C D I I * I S * K H V D I L K I K Q V Hpy99I | Hin6I BfiI | |GlaI | AsuI* | ||HhaI TaqII | AvaII | ||| DdeI | MboII | DraII | ||| |TspGWI | |TspDTI | PpuMI | ||| || BceAI | || MboII | SanDI \ \\\ \\ \ \ \\ \ \ \ GACGGAACGGCGCAACTTAGTAATAACAAGACCGATGAAGAAGAACAACTATATAAAAGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCTTGCCGCGTTGAATCATTATTGTTCTGGCTACTTCTTCTTGTTGATATATTTTCC /// / / / / / / / ||| | DdeI BceAI | | MboII BfiI ||| TspGWI | TspDTI ||Hin6I | MboII |GlaI TaqII HhaI D G T A Q L S N N K T D E E E Q L Y K R T E R R N L V I T R P M K K N N Y I K G R N G A T * * * Q D R * R R T T I * K G ----:----|----:----|----:----|----:----|----:----|----:----| S P V A C S L L L L V S S S S C S Y L L R R F P A V * Y Y C S R H L L V V I Y F V S R R L K T I V L G I F F F L * I F P NlaIV BmgT120I |NlaIV || FauI || BsrI || Tth111I || | BslFI || | BsiYI* || | |AciI || | |NspBII* || | || BslFI || | || | CviJI || | || | | BssKI || | || | | EcoRII || | || | | | ScrFI || | || | | | BseBI Tsp4CI* || | || | | | | AsuI* | MboI || | || | | | | AvaII | BclI || | || | | | | |BmgT120I | | DpnI || | || | | | | ||NlaIV | | |BstKTI \\ \ \\ \ \ \ \ \\\ \ \ \\ GACCCAGTCAGCGGGGCTATCCTGGTCCCTATGACTGTAAATGATCAACCGATTGAAAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGTCAGTCGCCCCGATAGGACCAGGGATACTGACATTTACTAGTTGGCTAACTTTTT /// /// / // // / /// / // / ||| ||| | || |BslFI | ||AvaII Tsp4CI* || BclI ||| ||| | || CviJI | ||AsuI* || MboI ||| ||| | |BslFI | |BmgT120I |DpnI ||| ||| | AciI | |NlaIV BstKTI ||| ||| NspBII* | EcoRII ||| ||BsiYI* | BssKI ||| |FauI BseBI ||| Tth111I ScrFI ||SanDI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I |NlaIV |BsrI NlaIV D P V S G A I L V P M T V N D Q P I E K T Q S A G L S W S L * L * M I N R L K K P S Q R G Y P G P Y D C K * S T D * K K ----:----|----:----|----:----|----:----|----:----|----:----| S G T L P A I R T G I V T F S * G I S F P G L * R P * G P G * S Q L H D V S Q F V W D A P S D Q D R H S Y I I L R N F F AluI BseYI CviJI | SetI | | GsaI | | AsuI* | | |NlaIV TspDTI | | |BmgT120I | PflMI MseI | | ||CviJI | BsiYI* SfaNI |AhaIII* | | ||HaeIII | | BsmI \ \\ \ \ \\\ \ \ \ AATGGCGACAAGATGCCTTTAAAGTTCAAGCTGGGGCCACTTTCTTACCAAAATATGGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCGCTGTTCTACGGAAATTTCAAGTTCGACCCCGGTGAAAGAATGGTTTTATACCGT / // / / //// / / / SfaNI |MseI | | |||AsuI* | | BsmI AhaIII* | | ||BmgT120I | BsiYI* | | ||HaeIII | PflMI | | ||CviJI TspDTI | | |NlaIV | | BseYI | CviJI | AluI | GsaI SetI N G D K M P L K F K L G P L S Y Q N M A M A T R C L * S S S W G H F L T K I W H W R Q D A F K V Q A G A T F L P K Y G I ----:----|----:----|----:----|----:----|----:----|----:----| F P S L I G K F N L S P G S E * W F I A F H R C S A K L T * A P A V K K G F Y P I A V L H R * L E L Q P W K R V L I H C HindIII | AluI ApoI | CviJI TspEI CviRI* | | SetI EcoRI MaeI \ \ \ \ \ \ TTCATAACTGCAAAAGATAAATATAAGCTTTATCCTGTTAGAATTCCTAGATTAGATACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTATTGACGTTTTCTATTTATATTCGAAATAGGACAATCTTAAGGATCTAATCTATGG / / / / / / CviRI* | | HindIII | MaeI | CviJI EcoRI | AluI TspEI SetI ApoI F I T A K D K Y K L Y P V R I P R L D T S * L Q K I N I S F I L L E F L D * I P H N C K R * I * A L S C * N S * I R Y Q ----:----|----:----|----:----|----:----|----:----|----:----| N M V A F S L Y L S * G T L I G L N S V M * L Q L L Y I Y A K D Q * F E * I L Y E Y S C F I F I L K I R N S N R S * I G CviRI* | MaeII | |BsaAI | |SnaBI | || SetI ApoI | || TaiI SetI TspEI Tsp4CI* SetI \ \\ \ \ \ \ \ AGCAAAGAGTTTTCTGCATACGTATCAGGTTTATTTGAAATTTACCGTGATTTAGGTGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTTCTCAAAAGACGTATGCATAGTCCAAATAAACTTTAAATGGCACTAAATCCACTA / / // / / / / | | || SetI | Tsp4CI* SetI | | |MaeII TspEI | | SnaBI ApoI | | BsaAI | TaiI | SetI CviRI* S K E F S A Y V S G L F E I Y R D L G D A K S F L H T Y Q V Y L K F T V I * V M Q R V F C I R I R F I * N L P * F R * * ----:----|----:----|----:----|----:----|----:----|----:----| L L S N E A Y T D P K N S I * R S K P S W C L T K Q M R I L N I Q F K G H N L H A F L K R C V Y * T * K F N V T I * T I TspEI | Hin4II* | | Hpy178III* HphI Csp6I PflMI MseI | | |NruI | MseI |RsaI BsiYI* |TspEI | | |FnuDII* \ \ \\ \ \\ \ \ \\ GACAGAGTGTTTAATGTACCAACGATTGGAGTTGTTAATTCTAATTTCGCGAAGGAGCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCTCACAAATTACATGGTTGCTAACCTCAACAATTAAGATTAAAGCGCTTCCTCGTA / / // / / / / / // HphI | || BsiYI* | | | | |Hpy178III* | || PflMI | | | | FnuDII* | |Csp6I | | | | NruI | RsaI | | | TspEI MseI | | Hin4II* | TspEI MseI D R V F N V P T I G V V N S N F A K E H T E C L M Y Q R L E L L I L I S R R S I Q S V * C T N D W S C * F * F R E G A * ----:----|----:----|----:----|----:----|----:----|----:----| S L T N L T G V I P T T L E L K A F S C H C L T * H V L S Q L Q * N * N R S P A V S H K I Y W R N S N N I R I E R L L M CfrI |MnlI ||BalI ||CviJI ||HaeIII |||FatI |||NcoI |||StyI |||SecI* |||DsaI* ||||CviAII ||||| NlaIII ||||| | TfiI ||||| | HinfI ||||| | | Hpy188I CviRI* ||||| |BglI | | AjuI | Tsp4CI* ||||| |MwoI | | | TspEI TspDTI \ \ \\\\\ \\ \ \ \ \ \ AATGCAACAGTAAATCTGGCCATGGAGGCGATTCTGAATGAATTGGAAGTGTTTATTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTTGTCATTTAGACCGGTACCTCCGCTAAGACTTACTTAACCTTCACAAATAACCA / / / ////// // / / | Tsp4CI* | |||||DsaI* |Hpy188I TspEI TspDTI CviRI* | |||||SecI* HinfI | |||||StyI TfiI | |||||NcoI AjuI | |||||FatI | ||||CviAII | |||MwoI | |||BglI | ||CfrI | |NlaIII | HaeIII | CviJI | BalI MnlI N A T V N L A M E A I L N E L E V F I G M Q Q * I W P W R R F * M N W K C L L V C N S K S G H G G D S E * I G S V Y W * ----:----|----:----|----:----|----:----|----:----|----:----| L A V T F R A M S A I R F S N S T N I P Y H L L L D P W P P S E S H I P L T * Q I C C Y I Q G H L R N Q I F Q F H K N T MboI |BccI |PleI |AjuI ||DpnI ||MlyI |||BstKTI ||||Hpy178III* ||||| Ksp632I* ||||| | BinI* ||||| | | BseGI ||||| | | | MmeI ||||| | | | | Hpy166II MseI ||||| | | | | |FokI TfiI | MboII HinfI ||||| | | | | || MboII HinfI | | Tsp4CI* \ \\\\\ \ \ \ \ \\ \ \ \ \ \ AGAGTCAAGGATCAGGATGGAAGAGTGAACCGATTTTATGAGTTGGAAGAATCTTTAACC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCAGTTCCTAGTCCTACCTTCTCACTTGGCTAAAATACTCAACCTTCTTAGAAATTGG / // / / // / / // / / / | || | | || MmeI | |FokI | | Tsp4CI* | || | | |BseGI | MboII | MboII | || | | Ksp632I* Hpy166II | MseI | || | | BinI* HinfI | || | Hpy178III* TfiI | || MboI | |PleI | |MlyI | |DpnI | |BccI | BstKTI HinfI AjuI R V K D Q D G R V N R F Y E L E E S L T E S R I R M E E * T D F M S W K N L * P S Q G S G W K S E P I L * V G R I F N R ----:----|----:----|----:----|----:----|----:----|----:----| L T L S * S P L T F R N * S N S S D K V Y L * P D P H F L S G I K H T P L I K L S D L I L I S S H V S K I L Q F F R * G MseI BseMII |BspCNI |AhaIII* || MnlI || | Tsp4CI* || | | DdeI || | | |Hpy188I || | | || TspDTI Hpy178III* || | | || | TatI | MnlI || | | || | |Csp6I | |Hin4I || | | || | ||RsaI BccI | || BseGI FokI \\ \ \ \\ \ \\\ \ \ \\ \ \ GTTTTAAACTGTCTGAGGACAATGTACTTCATATTAGATGGTCAGGATGTAGAGGAGAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATTTGACAGACTCCTGTTACATGAAGTATAATCTACCAGTCCTACATCTCCTCTTG // /// / / / /// / / // / || ||| | | TspDTI ||TatI BccI | || BseGI || ||| | | DdeI |Csp6I | |Hpy178III* || ||| | Hpy188I RsaI | MnlI || ||| Tsp4CI* Hin4I || ||MnlI || |MseI || AhaIII* |BspCNI BseMII V L N C L R T M Y F I L D G Q D V E E N F * T V * G Q C T S Y * M V R M * R R T F K L S E D N V L H I R W S G C R G E Q ----:----|----:----|----:----|----:----|----:----|----:----| T K F Q R L V I Y K M N S P * S T S S F R K L S D S S L T S * I L H D P H L P S N * V T Q P C H V E Y * I T L I Y L L V MboI MboI HinfI | DpnI | DpnI | Hin4I | |BstKTI | |BstKTI | |BsrDI BsrI | || Hpy188I | || Hpy188I | || PleI |MseI | || | Tsp4CI* | || |BseRI | || |MlyI |VspI | || | | Hpy166II \ \\ \\ \ \\ \\ \\ \ \\ \ \ \ AGATCAGAGTTTATTGAGTCATTGCTAAACTGGATTAATAGATCAGACGGTGAACCAGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGTCTCAAATAACTCAGTAACGATTTGACCTAATTATCTAGTCTGCCACTTGGTCTA // / / / / / / / // / / / / || Hpy188I | | HinfI PleI BsrI | || | | | HphI || BseRI | BsrDI MlyI | || | | Hpy166II || MboI Hin4I | || | Tsp4CI* |DpnI | || Hpy188I BstKTI | || MboI FokI | |DpnI | BstKTI VspI MseI R S E F I E S L L N W I N R S D G E P D D Q S L L S H C * T G L I D Q T V N Q M I R V Y * V I A K L D * * I R R * T R * ----:----|----:----|----:----|----:----|----:----|----:----| L D S N I S D N S F Q I L L D S P S G S C I L T * Q T M A L S S * Y I L R H V L S * L K N L * Q * V P N I S * V T F W I TspRI | TfiI | BspMI MboII | HinfI TaqI HphI |TspDTI Hin4II* | | SfeI* SetI AsuII \ \\ \ \ \ \ \ \ GAAGAATATATTGAACAAGTGTTTTCAGTGAAGGATTCTACAGCAGGTAAAAAAGTGTTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTATATAACTTGTTCACAAAAGTCACTTCCTAAGATGTCGTCCATTTTTTCACAAG / / // / / TspDTI Hin4II* || | SetI MboII TspRI || SfeI* |BspMI HinfI TfiI E E Y I E Q V F S V K D S T A G K K V F K N I L N K C F Q * R I L Q Q V K K C S R I Y * T S V F S E G F Y S R * K S V R ----:----|----:----|----:----|----:----|----:----|----:----| S S Y I S C T N E T F S E V A P L F T N H L I Y Q V L T K L S P N * L L Y F L T F F I N F L H K * H L I R C C T F F H E SspI |EcoP15I || Hpy178III* AluI || | HindIII CviJI || | | AluI | BplI || | | CviJI | BplI StuI || | | | SetI | SetI CviJI || | | | | TfiI | | MnlI HaeIII || | | | | HinfI | | | MseI | Cac8I \\ \ \ \ \ \ \ \ \ \ \ \ GAAACACAATATTTCTGGAAGCTTTTGAATCAGCTTGTTTTAAGAGGCCTGCTCTCCCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTGTTATAAAGACCTTCGAAAACTTAGTCGAACAAAATTCTCCGGACGAGAGGGTT / / / / / / / // / / / / / / AsuII | | | | | | || | MnlI MseI | Cac8I SetI TaqI | | | | | | || CviJI HaeIII | | | | | | || AluI CviJI | | | | | | |SetI StuI | | | | | | HinfI | | | | | | TfiI | | | | | | BplI | | | | | | BplI | | | | | HindIII | | | | CviJI | | | | AluI | | | SetI | | Hpy178III* | EcoP15I SspI E T Q Y F W K L L N Q L V L R G L L S Q K H N I S G S F * I S L F * E A C S P K N T I F L E A F E S A C F K R P A L P S ----:----|----:----|----:----|----:----|----:----|----:----| S V C Y K Q F S K F * S T K L P R S E W R F V I N R S A K S D A Q K L L G A R G F C L I E P L K Q I L K N * S A Q E G L MboI AluI | DpnI FatI CviJI | |BstKTI AflIII |SfeI* | || MboI BspLU11I* ||SetI | || BglII |TspDTI ||| BplI | || XhoII |CviAII ||| BplI | || Hpy188I || NspI ||| | SetI | || | DpnI || NlaIII ||| | | CviRI* | || | |BstKTI BceAI || | SfaNI \\\ \ \ \ \ \\ \ \\ \ \\ \ \ GCTATAGGTTGCATTGAAAGATCAGATCTTTTACCATATTTGAGTGATACATGTGCCGTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGATATCCAACGTAACTTTCTAGTCTAGAAAATGGTATAAACTCACTATGTACACGGCAA // // / // / // / / // // || || CviRI* || | || XhoII BceAI || |BspLU11I* || |SfeI* || | || BglII || |AflIII || SetI || | || MboI || |FatI |BplI || | |DpnI || CviAII |BplI || | BstKTI |NlaIII CviJI || Hpy188I |NspI AluI || MboI TspDTI |DpnI BstKTI A I G C I E R S D L L P Y L S D T C A V L * V A L K D Q I F Y H I * V I H V P F Y R L H * K I R S F T I F E * Y M C R F ----:----|----:----|----:----|----:----|----:----|----:----| A I P Q M S L D S R K G Y K L S V H A T L * L N C Q F I L D K V M N S H Y M H R S Y T A N F S * I K * W I Q T I C T G N CviRI* | MlyI | PleI | | MaeIII | | Tsp45I BccI TfiI | | | HinfI TaqI | Hpy178III* HinfI BsrI \ \ \ \ \ \ \ \ \ TCATTTGATGCAGTAAGTGACTCCATCGAACTCCTGAAACAATATCCAAAAGATTCGTCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAACTACGTCATTCACTGAGGTAGCTTGAGGACTTTGTTATAGGTTTTCTAAGCAGG / / // // / / / / / SfaNI | |PleI |HinfI | | Hpy178III* | BsrI | MlyI Tsp45I | BccI HinfI CviRI* MaeIII TaqI TfiI S F D A V S D S I E L L K Q Y P K D S S H L M Q * V T P S N S * N N I Q K I R P I * C S K * L H R T P E T I S K R F V Q ----:----|----:----|----:----|----:----|----:----|----:----| E N S A T L S E M S S R F C Y G F S E D K M Q H L L H S W R V G S V I D L L N T * K I C Y T V G D F E Q F L I W F I R G TatI |Csp6I ApoI TspEI ||RsaI TspEI | MseI CviJI \\\ \ \ \ \ AGTACATTTAGAGAATGGAAAAATTTGGTGCTAAAATTAAGTCAAGCCTTTGGTAGTTCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCATGTAAATCTCTTACCTTTTTAAACCACGATTTTAATTCAGTTCGGAAACCATCAAGA /// / // / ||TatI TspEI |MseI CviJI |Csp6I ApoI TspEI RsaI S T F R E W K N L V L K L S Q A F G S S V H L E N G K I W C * N * V K P L V V L Y I * R M E K F G A K I K S S L W * F C ----:----|----:----|----:----|----:----|----:----|----:----| L V N L S H F F K T S F N L * A K P L E W Y M * L I S F N P A L I L D L R Q Y N T C K S F P F I Q H * F * T L G K T T R BetI* |HpaII MboII || TspEI HphI | TspEI \\ \ \ \ \ GCTACTGATATTTCCGGTGAATTACGGGATTACATTGAAGATTTCTTGTTAGTAATTGGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGACTATAAAGGCCACTTAATGCCCTAATGTAACTTCTAAAGAACAATCATTAACCA // / / / / |BetI* | HphI MboII TspEI HpaII TspEI A T D I S G E L R D Y I E D F L L V I G L L I F P V N Y G I T L K I S C * * L V Y * Y F R * I T G L H * R F L V S N W W ----:----|----:----|----:----|----:----|----:----|----:----| A V S I E P S N R S * M S S K K N T I P Q * Q Y K R H I V P N C Q L N R T L L Q S S I N G T F * P I V N F I E Q * Y N T ApoI TspEI MaeII | SfeI* |BtrI PleI | | CviRI* || SetI |MlyI | | | PstI || TaiI HinfI ||BsiYI* \ \ \ \ \\ \ \ \\\ GGAAATCAACGAAAAATTCTGCAGTATTCAAGGACGTGGTATGAGTCCTTTTGTGGGTTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTAGTTGCTTTTTAAGACGTCATAAGTTCCTGCACCATACTCAGGAAAACACCCAAA // / / / // / / / || | SfeI* | |MaeII | | PleI || CviRI* | BtrI | | MlyI |PstI TaiI | BsiYI* TspEI SetI HinfI ApoI G N Q R K I L Q Y S R T W Y E S F C G F E I N E K F C S I Q G R G M S P F V G F K S T K N S A V F K D V V * V L L W V F ----:----|----:----|----:----|----:----|----:----|----:----| P F * R F I R C Y E L V H Y S D K Q P N H F D V F F E A T N L S T T H T R K H T S I L S F N Q L I * P R P I L G K T P K MaeIII BsrI MnlI SspI Tsp45I TspRI \ \ \ \ TTATTATACTATATCCCCTCATTAGAACTATCAGCAGAATATTTACAAATGTCACTGGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATATGATATAGGGGAGTAATCTTGATAGTCGTCTTATAAATGTTTACAGTGACCTT / / / / / / MnlI SspI | | | SetI | | BsrI | Tsp45I | MaeIII TspRI L L Y Y I P S L E L S A E Y L Q M S L E Y Y T I S P H * N Y Q Q N I Y K C H W K I I L Y P L I R T I S R I F T N V T G S ----:----|----:----|----:----|----:----|----:----|----:----| K N Y * I G E N S S D A S Y K C I D S S K I I S Y G R M L V I L L I N V F T V P * * V I D G * * F * * C F I * L H * Q F AluI CviJI FatI |EcoP15I |CviAII ||SetI || NlaIII ||| MaeII || | SalI ||| | SetI || | |TaqI ||| | TaiI || | |AccI ||| | | Hpy99I || | ||HindII ||| | | |AccI || | ||Hpy166II ||| | | ||Hpy166II HgaI || | |||Hpy99I \\\ \ \ \\\ \ \\ \ \\\\ GCTAACGTCGTAGACATAACAAATGATTGGGAACAACCATGCGTCGACATCATTAGTGGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGCAGCATCTGTATTGTTTACTAACCCTTGTTGGTACGCAGCTGTAGTAATCACCA / // / // / / // /// | || | |AccI | | || ||SalI | || | Hpy166II | | || |AccI | || MaeII | | || |TaqI | |Hpy99I | | || Hpy166II | EcoP15I | | || HindII | TaiI | | |Hpy99I | SetI | | |FatI CviJI | | CviAII AluI | NlaIII HgaI A N V V D I T N D W E Q P C V D I I S G L T S * T * Q M I G N N H A S T S L V V * R R R H N K * L G T T M R R H H * W * ----:----|----:----|----:----|----:----|----:----|----:----| A L T T S M V F S Q S C G H T S M M L P L * R R L C L L H N P V V M R R C * * H S V D Y V Y C I I P F L W A D V D N T T AgeI CviRI* BetI* | TseI Cfr10I TfiI | |BisI MwoI TspEI |HpaII HinfI | ||BlsI |AciI \ \\ \ \ \\\ \\ AAGATACACTCAATTTTACCGGTAATGGAATCTTTAGATAGTTGCACAGCAGCATTTACC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATGTGAGTTAAAATGGCCATTACCTTAGAAATCTATCAACGTGTCGTCGTAAATGG / // / / /// / TspEI |Cfr10I HinfI | ||| MwoI |BetI* TfiI | ||TseI |AgeI | |BisI HpaII | BlsI CviRI* K I H S I L P V M E S L D S C T A A F T R Y T Q F Y R * W N L * I V A Q Q H L P D T L N F T G N G I F R * L H S S I Y R ----:----|----:----|----:----|----:----|----:----|----:----| L I C E I K G T I S D K S L Q V A A N V Y S V S L K V P L P I K L Y N C L L M * L Y V * N * R Y H F R * I T A C C C K G EcoP15I MnlI BbvI | SetI SspI HphI \ \ \ \ \ GCTATGATTTGTGAAGCAAAAGGTTTGATAGAGAATATTTTTGAGGGTGAAAAAAATAGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGATACTAAACACTTCGTTTTCCAAACTATCTCTTATAAAAACTCCCACTTTTTTTATCG / / // // / | BbvI |SetI |SspI HphI AciI EcoP15I MnlI A M I C E A K G L I E N I F E G E K N S L * F V K Q K V * * R I F L R V K K I A Y D L * S K R F D R E Y F * G * K K * R ----:----|----:----|----:----|----:----|----:----|----:----| A I I Q S A F P K I S F I K S P S F F L R * S K H L L L N S L S Y K Q P H F F Y S H N T F C F T Q Y L I N K L T F F I A MboI BbvII* BglII | Hin4I XhoII | MboII | DpnI BtgZI | |TspDTI | |BstKTI MboII Hin4I \ \ \\ \ \\ \ \ GATGATTATAGTAATGAAGACAACGAAATGCTTGAAGATCTATTCTCTTATAGGAATGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAATATCATTACTTCTGTTGCTTTACGAACTTCTAGATAAGAGAATATCCTTACCA / / / // / / / | | TspDTI || | MboII Hin4I | | BbvII* || XhoII | | MboII || BglII | Hin4I || MboI BtgZI |DpnI BstKTI D D Y S N E D N E M L E D L F S Y R N G M I I V M K T T K C L K I Y S L I G M V * L * * * R Q R N A * R S I L L * E W Y ----:----|----:----|----:----|----:----|----:----|----:----| S S * L L S S L S I S S S R N E * L F P R H N Y Y H L C R F A Q L D I R K Y S H I I I T I F V V F H K F I * E R I P I T Hpy166II | DraIII AluI | |BsrI CviJI | |TspRI SfaNI | SetI TaqII | || BfiI \ \ \ \ \ \\ \ ATGGCATCTTATATGCTAAATAGCTTCGCTTTTGAGTTGTGTTCACTGGGTGATAAGGAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTAGAATATACGATTTATCGAAGCGAAAACTCAACACAAGTGACCCACTATTCCTT / / / / / / / / / / | | CviJI TaqII | | | BsrI BfiI HphI | | AluI | | DraIII | SetI | Hpy166II SfaNI TspRI M A S Y M L N S F A F E L C S L G D K E W H L I C * I A S L L S C V H W V I R N G I L Y A K * L R F * V V F T G * * G T ----:----|----:----|----:----|----:----|----:----|----:----| I A D * I S F L K A K S N H E S P S L S Y P M K Y A L Y S R K Q T T N V P H Y P H C R I H * I A E S K L Q T * Q T I L F HphI | AsuI* | |CviJI MwoI | |HaeIII | TstI CviRI* | |BmgT120I CviJI | |CviRI* | BslFI \ \\ \ \ \\ \ \ CTATGGCCCGTTGCCATTGGATTGATAGCCTTATCTGCAACAGGGACGAGAAGTGCAAAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GATACCGGGCAACGGTAACCTAACTATCGGAATAGACGTTGTCCCTGCTCTTCACGTTTC /// / / / / ||AsuI* | MwoI CviRI* CviRI* |BmgT120I | TstI HaeIII CviJI CviJI L W P V A I G L I A L S A T G T R S A K Y G P L P L D * * P Y L Q Q G R E V Q R M A R C H W I D S L I C N R D E K C K E ----:----|----:----|----:----|----:----|----:----|----:----| S H G T A M P N I A K D A V P V L L A F V I A R Q W Q I S L R I Q L L S S F H L * P G N G N S Q Y G * R C C P R S T C L CviRI* | TspEI | | HphI TstI | | | XmnI MaeIII SfaNI \ \ \ \ \ \ \ AAAATGGTGATTGCAGAATTACTTCCACACTACCCATTTGTTACGAATGATGACATTGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACCACTAACGTCTTAATGAAGGTGTGATGGGTAAACAATGCTTACTACTGTAACTT / / / / / / / | TstI | | TspEI MaeIII SfaNI BslFI | | XmnI | HphI CviRI* K M V I A E L L P H Y P F V T N D D I E K W * L Q N Y F H T T H L L R M M T L N N G D C R I T S T L P I C Y E * * H * M ----:----|----:----|----:----|----:----|----:----|----:----| F I T I A S N S G C * G N T V F S S M S S F P S Q L I V E V S G M Q * S H H C Q F H H N C F * K W V V W K N R I I V N F DdeI BarI |BseGI FokI BsmAI | Hin4II* \\ \ \ \ \ TGGATGCTAAGTATATGTGTAGAATGGAGACTACCAGAAATAGCGAAGGAAATATACACC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTACGATTCATATACACATCTTACCTCTGATGGTCTTTATCGCTTCCTTTATATGTGG / / / / / / / | DdeI FokI BsmAI BarI Hin4II* TaiI BseGI SetI W M L S I C V E W R L P E I A K E I Y T G C * V Y V * N G D Y Q K * R R K Y T P D A K Y M C R M E T T R N S E G N I H H ----:----|----:----|----:----|----:----|----:----|----:----| H I S L I H T S H L S G S I A F S I Y V I S A L Y I H L I S V V L F L S P F I C P H * T Y T Y F P S * W F Y R L F Y V G MaeII | SetI ApoI | TaiI BarI TspEI TspEI FauI \ \ \ \ \ \ ACGTTGGGTAATCAAATGTTATCGGCACACAACATAATTGAAAGTATCGCAAATTTTAGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAACCCATTAGTTTACAATAGCCGTGTGTTGTATTAACTTTCATAGCGTTTAAAATCA // / / / |BarI TspEI | FauI MaeII TspEI ApoI T L G N Q M L S A H N I I E S I A N F S R W V I K C Y R H T T * L K V S Q I L V V G * S N V I G T Q H N * K Y R K F * * ----:----|----:----|----:----|----:----|----:----|----:----| V N P L * I N D A C L M I S L I A F K L W T P Y D F T I P V C C L Q F Y R L N * R Q T I L H * R C V V Y N F T D C I K T HindIII | AluI | CviJI | | SetI | | | MmeI BsrI | | | |MnlI | TsoI | | | || FatI AciI | | TspDTI | | | || CviRI* | Cac8I | | | MslI CviJI | | | || |CviAII \ \ \ \ \ \ \ \ \ \ \\ \\ AGGGCGGGCAAATATGAACTGGTAAAGTCATATTCGTGGCTATTATTTGAAGCTTCGTGC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGCCCGTTTATACTTGACCATTTCAGTATAAGCACCGATAATAAACTTCGAAGCACG / / / / / / / / / / / Cac8I | | | MslI CviJI | | | | CviRI* AciI | | TspDTI | | | | NlaIII | TsoI | | | MnlI BsrI | | HindIII | | MmeI | CviJI | AluI SetI R A G K Y E L V K S Y S W L L F E A S C G R A N M N W * S H I R G Y Y L K L R A G G Q I * T G K V I F V A I I * S F V H ----:----|----:----|----:----|----:----|----:----|----:----| L A P L Y S S T F D Y E H S N N S A E H Y P P C I H V P L T M N T A I I Q L K T P R A F I F Q Y L * I R P * * K F S R A NlaIII | MwoI | |AsuI* | ||BmgT120I | |||CviJI PflMI MnlI | |||HaeIII BsiYI* BsmI | SfeI* \ \\\\ \ \ \ \ ATGGAGGGCCAGAAGTTGGACGACCCTGTGTTGAATGCCATTGTGAGCAAAAACTCTCCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCCCGGTCTTCAACCTGCTGGGACACAACTTACGGTAACACTCGTTTTTGAGAGGA // // / / / / |FatI || BsiYI* BsmI | PstI | || PflMI MnlI | |AsuI* | BmgT120I | HaeIII | CviJI CviAII MwoI M E G Q K L D D P V L N A I V S K N S P W R A R S W T T L C * M P L * A K T L L G G P E V G R P C V E C H C E Q K L S C ----:----|----:----|----:----|----:----|----:----|----:----| M S P W F N S S G T N F A M T L L F E G C P P G S T P R G Q T S H W Q S C F S E H L A L L Q V V R H Q I G N H A F V R R MaeII MaeIII |BseGI Tsp45I || SetI | HgaI || TaiI | | ApoI CviRI* || | PsiI | | TspEI | PstI || | | FokI BcgI | | EcoRI \ \ \\ \ \ \ \ \ \ \ GCAGAGGATGACGTTATAATACCACAAGACATTTTAGATTGTGTAGTGACGAATTCTATG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTCCTACTGCAATATTATGGTGTTCTGTAAAATCTAACACATCACTGCTTAAGATAC / / / / / / / / // | SfeI* | | PsiI FokI BcgI | |EcoRI CviRI* | MaeII | |TspEI BseGI | |ApoI TaiI | HgaI SetI Tsp45I MaeIII A E D D V I I P Q D I L D C V V T N S M Q R M T L * Y H K T F * I V * * R I L C R G * R Y N T T R H F R L C S D E F Y A ----:----|----:----|----:----|----:----|----:----|----:----| A S S S T I I G C S M K S Q T T V F E I Q L P H R * L V V L C K L N H L S S N * C L I V N Y Y W L V N * I T Y H R I R H MaeIII Tsp45I | TspEI | | BseMII | | |BspCNI BcgI | | || MnlI Hin6I | | || | AluI |GlaI | | || | CviJI ||HhaI | | || | |DdeI |||HaeII | | || | |BbvCI |||| NdeI | | || | |Bpu10I |||| |MwoI | | || | ||SetI \\\\ \\ \ \ \\ \ \\\ CGTCAAACTTTAGCGCCATATGCTGTTCTGTCACAATTCTATGAGCTGAGGGACAGAGAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTTGAAATCGCGGTATACGACAAGACAGTGTTAAGATACTCGACTCCCTGTCTCTT ////// / /// / / / / / |||||| NdeI ||| | | | | Bpu10I |||||MwoI ||| | | | | BbvCI ||||Hin6I ||| | | | | DdeI |||GlaI ||| | | | CviJI ||HhaI ||| | | | AluI |HaeII ||| | | SetI BcgI ||| | MnlI ||| TspEI ||BspCNI |BseMII Tsp45I MaeIII R Q T L A P Y A V L S Q F Y E L R D R E V K L * R H M L F C H N S M S * G T E K S N F S A I C C S V T I L * A E G Q R R ----:----|----:----|----:----|----:----|----:----|----:----| R * V K A G Y A T R D C N * S S L S L S A D F K L A M H Q E T V I R H A S P C L T L S * R W I S N Q * L E I L Q P V S F BbvI | BslFI | | AsuI* | | |NlaIV | | |BmgT120I | | ||CviJI | | ||HaeIII | | ||| MboII | | ||| | Hin6I | | ||| | |GlaI | | ||| | |Eco47III | | ||| | ||TseI | | ||| | ||HhaI | | ||| | |||BisI | | ||| | |||HaeII | | ||| | ||||BlsI | | ||| | |||||Hin6I | | ||| | ||||||GlaI ApoI | | ||| | |||||||HhaI TspEI | | ||| | |||||||| MwoI EcoRI \ \ \\\ \ \\\\\\\\ \ \ GATTGGGGCCAAGCGCTGCGCCTATTGCTTTTGCTGATTGAATTCCCTTATTTACCAAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACCCCGGTTCGCGACGCGGATAACGAAAACGACTAACTTAAGGGAATAAATGGTTTT //// ////////// / |||| |||||||||MwoI EcoRI |||| ||||||||Hin6I TspEI |||| |||||||GlaI ApoI |||| ||||||TseI |||| ||||||HhaI |||| |||||BisI |||| ||||BlsI |||| |||Hin6I |||| ||Eco47III |||| ||GlaI |||| |HhaI |||| HaeII |||MboII |||AsuI* ||BmgT120I ||HaeIII ||BslFI ||CviJI |NlaIV BbvI D W G Q A L R L L L L L I E F P Y L P K I G A K R C A Y C F C * L N S L I Y Q N L G P S A A P I A F A D * I P L F T K T ----:----|----:----|----:----|----:----|----:----|----:----| S Q P W A S R R N S K S I S N G * K G F L N P G L A A G I A K A S Q I G K N V L I P A L R Q A * Q K Q Q N F E R I * W F Csp6I ApoI |RsaI TspEI || TspEI \ \\ \ CATTACTTGGTTTTGCTTGTGGCGAAATTCCTGTACCCAATTTTCCTTTTAGATGATAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTAATGAACCAAAACGAACACCGCTTTAAGGACATGGGTTAAAAGGAAAATCTACTATTC / // / | |Csp6I TspEI | RsaI TspEI ApoI H Y L V L L V A K F L Y P I F L L D D K I T W F C L W R N S C T Q F S F * M I R L L G F A C G E I P V P N F P F R * * E ----:----|----:----|----:----|----:----|----:----|----:----| C * K T K S T A F N R Y G I K R K S S L V N S P K A Q P S I G T G L K G K L H Y M V Q N Q K H R F E Q V W N E K * I I L FokI | MboII AluI BseGI | |TspRI CviJI |TfiI | |TspDTI | SetI |HinfI | || Tsp4CI* \ \ \\ \ \\ \ AAGCTAATGGATGAAGATTCAGTGGCGACAGTCATTGAAGTTATAGAAACTAAATGGGAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGATTACCTACTTCTAAGTCACCGCTGTCAGTAACTTCAATATCTTTGATTTACCCTA / / / / / / / / | CviJI | | | | | Tsp4CI* | AluI | | | | FokI SetI | | | TspDTI | | | MboII | | HinfI | | TfiI | TspRI BseGI K L M D E D S V A T V I E V I E T K W D S * W M K I Q W R Q S L K L * K L N G M A N G * R F S G D S H * S Y R N * M G * ----:----|----:----|----:----|----:----|----:----|----:----| F S I S S S E T A V T M S T I S V L H S S A L P H L N L P S L * Q L * L F * I P L * H I F I * H R C D N F N Y F S F P I HindIII | AluI HgaI | CviJI BseGI FokI TspDTI TspDTI | | SetI \ \ \ \ \ \ \ GACGCTGATGAAAAAAGTTCAAACTTATATGAAACCATTATTGAAGCAGATAAAAGCTTA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGACTACTTTTTTCAAGTTTGAATATACTTTGGTAATAACTTCGTCTATTTTCGAAT / // / / / / // BseGI |HgaI TspDTI TspDTI | | |SetI FokI | | HindIII | CviJI | AluI SetI D A D E K S S N L Y E T I I E A D K S L T L M K K V Q T Y M K P L L K Q I K A Y R * * K K F K L I * N H Y * S R * K L T ----:----|----:----|----:----|----:----|----:----|----:----| S A S S F L E F K Y S V M I S A S L L K H R Q H F F N L S I H F W * Q L L Y F S V S I F F T * V * I F G N N F C I F A * FatI ApoI MaeI |CviAII TspEI ApoI TspEI |SetI || NlaIII | MseI TspEI | TspDTI \\ \\ \ \ \ \ \ \ CCTAGTAGCATGGCAACACTTTTGAAAAATTTAAGAAAGAAACTAAATTTCAAATTATGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GGATCATCGTACCGTTGTGAAAACTTTTTAAATTCTTTCTTTGATTTAAAGTTTAATACA / / // / / / // | | |FatI | MseI TspEI |TspEI | | CviAII TspEI ApoI TspDTI | NlaIII ApoI MaeI P S S M A T L L K N L R K K L N F K L C L V A W Q H F * K I * E R N * I S N Y V * * H G N T F E K F K K E T K F Q I M S ----:----|----:----|----:----|----:----|----:----|----:----| G L L M A V S K F F K L F F S F K L N H V * Y C P L V K S F N L F S V L N * I I R T A H C C K Q F I * S L F * I E F * T FatI |CviAII || NlaIII \\ \ CAAGCGTTCATGTAA 2230 ----:----|----: GTTCGCAAGTACATT / // | |FatI | CviAII NlaIII Q A F M * K R S C X S V H V X ----:----|----: * A N M Y D L T * T L R E H L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AluI 11 AluBI ApoI 10 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 2 BcgI 1 BclI 1 FbaI,Ksp22I BetI* 2 BsaWI BfiI 2 BmrI,BmuI BglI 1 BglII 2 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 6 BplI 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 2 BseRI 1 BseYI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 8 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 6 CviJI 21 CviKI-1 CviRI* 12 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI EcoP15I 3 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI FatI 6 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 4 GsaI 1 HaeII 2 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HhaI 4 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 3 HpyAV Hin6I 4 HinP1I,HspAI HindII 1 HincII HindIII 4 HinfI 12 HpaII 2 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 5 Hpy99I 4 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 5 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MlyI 4 SchI MmeI 2 MnlI 9 MseI 9 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 3 BasI,AccB7I,Van91I PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 2 RsaI 4 AfaI SalI 1 SanDI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 23 SfaNI 4 LweI SfeI* 4 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 6 TaqII 2 TatI 2 TfiI 8 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI Bce83I* BciVI BdaI BmeT110I BmtI BsaXI BsePI BseSI BsgI BsiI* Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtsI CauII* Cfr9I CspCI DinI DrdI Eam1105I EciI Ecl136II Eco31I Eco57I Eco57MI EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GsuI HgiAI* HgiCI* HgiJII* HpaI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TauI TspMI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769