Restriction Map of MET3/YJR010W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MET3/YJR010W on chromosome X from coordinates 456239 to 457774.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.27307

BsiYI* Tsp4CI* SfaNI Cac8I | MnlI | MaeI MwoI MseI \ \ \ \ \ \ \ ATGCCTGCTCCTCACGGTGGTATTCTACAAGACTTGATTGCTAGAGATGCGTTAAAGAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGACGAGGAGTGCCACCATAAGATGTTCTGAACTAACGATCTCTACGCAATTTCTTC / / / / / / / Cac8I | | MnlI | MwoI MseI | Tsp4CI* | MaeI BsiYI* SfaNI M P A P H G G I L Q D L I A R D A L K K C L L L T V V F Y K T * L L E M R * R R A C S S R W Y S T R L D C * R C V K E E ----:----|----:----|----:----|----:----|----:----|----:----| X G A G * P P I R C S K I A L S A N F F X A Q E E R H Y E V L S S Q * L H T L S H R S R V T T N * L V Q N S S I R * L L Hpy188I | MboII | TspDTI | | Hin6I Hpy188I TspEI | | |GlaI | Eco57I MlyI HinfI | MboII | | ||HhaI | Eco57MI PleI | MaeI \ \ \ \ \\\ \ \ \ \ \ AATGAATTGTTATCTGAAGCGCAATCTTCGGACATTTTAGTATGGAACTTGACTCCTAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTAACAATAGACTTCGCGTTAGAAGCCTGTAAAATCATACCTTGAACTGAGGATCT / /// /// / / // / / MboII ||| ||Hin6I | Eco57MI |PleI | MaeI TspEI ||| |GlaI | Eco57I MlyI HinfI ||| HhaI Hpy188I ||MboII |TspDTI Hpy188I N E L L S E A Q S S D I L V W N L T P R M N C Y L K R N L R T F * Y G T * L L D * I V I * S A I F G H F S M E L D S * T ----:----|----:----|----:----|----:----|----:----|----:----| F S N N D S A C D E S M K T H F K V G L S H I T I Q L A I K P C K L I S S S E * I F Q * R F R L R R V N * Y P V Q S R S Hpy188I | BsiYI* TspEI | | MnlI | XmnI | | |BsrI | |TfiI | | || BsaXI | |HinfI BseRI | | || |BfiI \ \\ \ \ \ \\ \\ CAACTATGTGATATTGAATTGATTCTAAATGGTGGGTTTTCTCCTCTGACTGGGTTTTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGATACACTATAACTTAACTAAGATTTACCACCCAAAAGAGGAGACTGACCCAAAAAC / / / / / // / | HinfI BseRI | | || BfiI | TfiI | | |Hin4I TspEI | | BsaXI XmnI | MnlI | BsrI Hpy188I BsiYI* Q L C D I E L I L N G G F S P L T G F L N Y V I L N * F * M V G F L L * L G F * T M * Y * I D S K W W V F S S D W V F E ----:----|----:----|----:----|----:----|----:----|----:----| C S H S I S N I R F P P N E G R V P N K V V I H Y Q I S E L H H T K E E S Q T K L * T I N F Q N * I T P K R R Q S P K Q MaeIII | MnlI | |BsaXI | || TfiI DraIII | || HinfI | AsuI* | || | Hin4I | AvaII Hin4I | || | |TaqI | Hpy166II | BseRI | || | ||Hpy178III* FokI | |BmgT120I \ \ \ \\ \ \\\ \ \ \\ AACGAAAACGATTACTCCTCTGTTGTTACAGATTCGAGATTAGCAGACGGCACATTGTGG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTTTGCTAATGAGGAGACAACAATGTCTAAGCTCTAATCGTCTGCCGTGTAACACC / // // / // / // BseRI || || | |Hpy178III* | |BseGI || || | TaqI | Hpy166II || || HinfI DraIII || || TfiI FokI || |MaeIII || Hin4I |MnlI BsaXI N E N D Y S S V V T D S R L A D G T L W T K T I T P L L L Q I R D * Q T A H C G R K R L L L C C Y R F E I S R R H I V D ----:----|----:----|----:----|----:----|----:----|----:----| F S F S * E E T T V S E L N A S P V N H S R F R N S R Q Q * L N S I L L R C M T V F V I V G R N N C I R S * C V A C Q P TspDTI BseGI | TspEI |BceAI BccI | | MseI TsoI \\ \ \ \ \ \ ACCATCCCTATTACATTAGATGTTGATGAAGCATTTGCTAACCAAATTAAACCAGACACA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAGGGATAATGTAATCTACAACTACTTCGTAAACGATTGGTTTAATTTGGTCTGTGT // / / / // / || BceAI BccI TspDTI || TsoI |AvaII |MseI |AsuI* TspEI BmgT120I T I P I T L D V D E A F A N Q I K P D T P S L L H * M L M K H L L T K L N Q T Q H P Y Y I R C * * S I C * P N * T R H K ----:----|----:----|----:----|----:----|----:----|----:----| V M G I V N S T S S A N A L W I L G S V S W G * * M L H Q H L M Q * G F * V L C G D R N C * I N I F C K S V L N F W V C Tsp4CI* | PfoI | BssKI | EcoRII ApoI | | ScrFI BseGI TspEI TspEI TspDTI | | BseBI Hpy166II \ \ \ \ \ \ \ AGAATTGCCCTTTTCCAAGATGATGAAATTCCTATTGCTATACTTACTGTCCAGGATGTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAACGGGAAAAGGTTCTACTACTTTAAGGATAACGATATGAATGACAGGTCCTACAA / / / / / / / / TspEI TspEI TspDTI | | | | Hpy166II ApoI | | | BseGI | | EcoRII | | BssKI | | PfoI | BseBI | ScrFI Tsp4CI* R I A L F Q D D E I P I A I L T V Q D V E L P F S K M M K F L L L Y L L S R M F N C P F P R * * N S Y C Y T Y C P G C L ----:----|----:----|----:----|----:----|----:----|----:----| L I A R K W S S S I G I A I S V T W S T L F Q G K G L H H F E * Q * V * Q G P H S N G K E L I I F N R N S Y K S D L I N TaqI Hpy188I |Eco57I |FokI |Eco57MI || MaeIII || CviJI || Tsp45I CviJI || | MboII || BstEII BseGI |FokI || | BbvII* MnlI || | SetI |HphI \\ \\ \ \ \ \\ \ \ \\ TACAAGCCAAACAAAACTATCGAAGCCGAAAAAGTCTTCAGAGGTGACCCAGAACATCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTCGGTTTGTTTTGATAGCTTCGGCTTTTTCAGAAGTCTCCACTGGGTCTTGTAGGT / / / / // / / / / / / / / | FokI | | || | MnlI | | | | | HphI CviJI | | || BbvII* | | | | BseGI | | |MboII | | | BstEII | | CviJI | | | Tsp45I | TaqI | | | MaeIII Eco57MI | | FokI Eco57I | SetI Hpy188I Y K P N K T I E A E K V F R G D P E H P T S Q T K L S K P K K S S E V T Q N I Q Q A K Q N Y R S R K S L Q R * P R T S S ----:----|----:----|----:----|----:----|----:----|----:----| * L G F L V I S A S F T K L P S G S C G K C A L C F * R L R F L R * L H G L V D V L W V F S D F G F F D E S T V W F M W MseI | AclI MaeII | MaeII | HphI | | SetI | |SetI AluI | | TaiI | |TaiI XmnI CviJI | | | Cfr10I | || Hpy99I |TfiI CviJI | SetI | | | |HpaII | || |AciI |HinfI \ \ \ \ \ \ \\ \ \\ \\ \\ GCCATTAGCTATTTATTTAACGTTGCCGGTGATTATTACGTCGGCGGTTCTTTAGAAGCG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAATCGATAAATAAATTGCAACGGCCACTAATAATGCAGCCGCCAAGAAATCTTCGC / / / / / // //// / / | | CviJI | MaeII |Cfr10I |||MaeII AciI XmnI | | AluI | AclI HpaII ||HphI | SetI MseI |Hpy99I CviJI TaiI TaiI SetI SetI A I S Y L F N V A G D Y Y V G G S L E A P L A I Y L T L P V I I T S A V L * K R H * L F I * R C R * L L R R R F F R S D ----:----|----:----|----:----|----:----|----:----|----:----| A M L * K N L T A P S * * T P P E K S A L W * S N I * R Q R H N N R R R N K L L G N A I * K V N G T I I V D A T R * F R BssKI EcoRII | ScrFI AarI | BseBI BspMI TspEI SetI MnlI | | SetI SetI |DdeI \ \ \ \ \ \ \ \\ ATTCAATTACCTCAACATTATGACTATCCAGGTTTGCGTAAGACACCTGCCCAACTAAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTAATGGAGTTGTAATACTGATAGGTCCAAACGCATTCTGTGGACGGGTTGATTCT / / / // / / / | TspEI MnlI || EcoRII SetI BspMI | SetI || BssKI AarI HinfI |BseBI DdeI TfiI |ScrFI SetI I Q L P Q H Y D Y P G L R K T P A Q L R F N Y L N I M T I Q V C V R H L P N * D S I T S T L * L S R F A * D T C P T K T ----:----|----:----|----:----|----:----|----:----|----:----| I * N G * C * S * G P K R L V G A W S L S E I V E V N H S D L N A Y S V Q G V L N L * R L M I V I W T Q T L C R G L * S Hpy178III* | AsuI* | AvaII | |NlaIV AluI ApoI | |BmgT120I CviJI TspEI | || Tsp4CI* BslFI EcoRI | || Tth111I | SetI CviRI* \ \ \\ \ \ \ \ CTTGAATTCCAATCAAGACAATGGGACCGTGTCGTAGCTTTCCAAACTCGTAATCCAATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTAAGGTTAGTTCTGTTACCCTGGCACAGCATCGAAAGGTTTGAGCATTAGGTTAC / / /// / / / / / / EcoRI | ||| | | | BslFI | CviRI* TspEI | ||| | | CviJI EcoT22I ApoI | ||| | | AluI | ||| | SetI | ||| Tth111I | ||Tsp4CI* | ||AvaII | ||AsuI* | |BmgT120I | NlaIV Hpy178III* L E F Q S R Q W D R V V A F Q T R N P M L N S N Q D N G T V S * L S K L V I Q C * I P I K T M G P C R S F P N S * S N A ----:----|----:----|----:----|----:----|----:----|----:----| S S N W D L C H S R T T A K W V R L G I V Q I G I L V I P G H R L K G F E Y D L K F E L * S L P V T D Y S E L S T I W H HindII Hpy166II FokI | Tsp4CI* DdeI | | CviJI Bpu10I EcoT22I | | |AciI MwoI | MmeI | CviJI | | |BisI | AluI | BinI* | | SduI | | ||BlsI | CviJI | | SetI | | HgiJII* | | |||TauI | | SetI | | | MboI \ \ \ \ \ \\\\ \ \ \ \ \ \ \ CATAGAGCCCACAGGGAGTTGACTGTGAGAGCCGCCAGAGAAGCTAATGCTAAGGTGCTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCTCGGGTGTCCCTCAACTGACACTCTCGGCGGTCTCTTCGATTACGATTCCACGAC / / / / //// / / / //// / | CviJI | Tsp4CI* |||| | | CviJI |||| BstKTI HgiJII* Hpy166II |||| | | AluI |||BinI* SduI HindII |||| | SetI ||FokI |||| MwoI |Bpu10I |||AciI |DdeI ||BisI SetI |BlsI MmeI CviJI TauI H R A H R E L T V R A A R E A N A K V L I E P T G S * L * E P P E K L M L R C * * S P Q G V D C E S R Q R S * C * G A D ----:----|----:----|----:----|----:----|----:----|----:----| C L A W L S N V T L A A L S A L A L T S A Y L G C P T S Q S L R W L L * H * P A M S G V P L Q S H S G G S F S I S L H Q DpnI |BstKTI BssKI ||BseGI SexAI ||| BsrI EcoRII ||| | XcmI | ScrFI OliI ||| | |BccI | BseBI MslI ||| | || PflMI | | SetI BccI ||| | || BsiYI* | | | TsoI HphI BsiI* \\\ \ \\ \ \ \ \ \ \ \ ATCCATCCAGTTGTTGGACTAACCAAACCAGGTGATATAGACCATCACACTCGTGTTCGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTAGGTCAACAACCTGATTGGTTTGGTCCACTATATCTGGTAGTGTGAGCACAAGCA / / / // / // / / / // / | | | || BccI || | TsoI HphI || BsiI* | | | |BsiYI* || EcoRII |BccI | | | |PflMI || SexAI MslI | | | XcmI || BssKI OliI | | BsrI |BseBI | MboI |ScrFI BseGI SetI DpnI I H P V V G L T K P G D I D H H T R V R S I Q L L D * P N Q V I * T I T L V F V P S S C W T N Q T R * Y R P S H S C S C ----:----|----:----|----:----|----:----|----:----|----:----| I W G T T P S V L G P S I S W * V R T R S G D L Q Q V L W V L H Y L G D C E H E D M W N N S * G F W T I Y V M V S T N T AccI |Hpy166II || BssKI || EcoRII || | ScrFI || | BseBI || | | TspEI MseI \\ \ \ \ \ GTCTACCAGGAAATTATTAAGCGTTATCCTAATGGTATTGCTTTCTTATCCCTGTTGCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGATGGTCCTTTAATAATTCGCAATAGGATTACCATAACGAAAGAATAGGGACAACGGT // / / / / || | | | MseI || | | TspEI || | EcoRII || | BssKI || BseBI || ScrFI |AccI Hpy166II V Y Q E I I K R Y P N G I A F L S L L P S T R K L L S V I L M V L L S Y P C C H L P G N Y * A L S * W Y C F L I P V A I ----:----|----:----|----:----|----:----|----:----|----:----| T * W S I I L R * G L P I A K K D R N G H R G P F * * A N D * H Y Q K R I G T A D V L F N N L T I R I T N S E * G Q Q W FatI |CviAII ||Cac8I ||| SphI BsrDI HphI ||| NspI | BceAI CviJI ||| NlaIII TspEI \ \ \ \\\ \ \ TTAGCAATGAGAATGAGTGGTGATAGAGAAGCCGTATGGCATGCTATTATTAGAAAGAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGTTACTCTTACTCACCACTATCTCTTCGGCATACCGTACGATAATAATCTTTCTTA / / // / /// BsrDI BceAI |CviJI | ||FatI HphI | |CviAII | Cac8I NlaIII NspI SphI L A M R M S G D R E A V W H A I I R K N * Q * E * V V I E K P Y G M L L L E R I S N E N E W * * R S R M A C Y Y * K E L ----:----|----:----|----:----|----:----|----:----|----:----| N A I L I L P S L S A T H C A I I L F F M L L S F S H H Y L L R I A H * * * F S * C H S H T T I S F G Y P M S N N S L I FauI | FatI | |CviAII | || AciI | || NlaIII | || | AsuI* | || | Cac8I | || | Bsp120I | || | |AsuI* | || | |BmgT120I | || | ||CviJI | || | ||NlaIV | || | ||HaeIII | || | ||BmgT120I | || | |||BssKI | || | |||SecI* | || | |||EcoRII | || | ||||ApaI | || | ||||SduI | || | ||||BseSI MnlI | || | ||||HgiJII* HgiCI* |XcmI | || | |||||ScrFI | NlaIV || BsmAI | || | |||||BseBI StyI | TspDTI || Eco31I | || | |||||| SetI SecI* \ \ \\ \ \ \\ \ \\\\\\ \ \ TATGGTGCCTCCCACTTCATTGTTGGTAGAGACCATGCGGGCCCAGGTAAGAACTCCAAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATACCACGGAGGGTGAAGTAACAACCATCTCTGGTACGCCCGGGTCCATTCTTGAGGTTC / / / / // / // // / /////// / | | | HgiCI* |XcmI | || || | ||||||EcoRII SecI* | | NlaIV MnlI | || || | ||||||BssKI StyI | TspDTI | || || | |||||SecI* TspEI | || || | ||||BseBI | || || | ||||ScrFI | || || | |||SetI | || || | ||Bsp120I | || || | ||AsuI* | || || | |BmgT120I | || || | |AsuI* | || || | BmgT120I | || || | HaeIII | || || | NlaIV | || || | CviJI | || || HgiJII* | || || Cac8I | || || BseSI | || || SduI | || || ApaI | || || AciI | || |FatI | || CviAII | |NlaIII | FauI Eco31I BsmAI Y G A S H F I V G R D H A G P G K N S K M V P P T S L L V E T M R A Q V R T P R W C L P L H C W * R P C G P R * E L Q G ----:----|----:----|----:----|----:----|----:----|----:----| * P A E W K M T P L S W A P G P L F E L N H H R G S * Q Q Y L G H P G L Y S S W I T G G V E N N T S V M R A W T L V G L Bce83I* |SfaNI SmlI ||AsuI* | Hpy178III* ||AvaII | | TaqI FatI ||Tsp4CI* | | | TfiI |CviAII |||BmgT120I | | TspEI | HinfI || NlaIII \\\\ \ \ \ \ \ \\ \ GGTGTTGATTTCTACGGTCCATACGATGCTCAAGAATTGGTCGAATCCTACAAGCATGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAACTAAAGATGCCAGGTATGCTACGAGTTCTTAACCAGCTTAGGATGTTCGTACTT / / // / / / / / // | | |AvaII | | | HinfI | |FatI | | |AsuI* | | | TfiI | CviAII | | |SfaNI | | TaqI NlaIII | | BmgT120I | TspEI | Tsp4CI* Hpy178III* Bce83I* SmlI G V D F Y G P Y D A Q E L V E S Y K H E V L I S T V H T M L K N W S N P T S M N C * F L R S I R C S R I G R I L Q A * T ----:----|----:----|----:----|----:----|----:----|----:----| P T S K * P G Y S A * S N T S D * L C S P H Q N R R D M R H E L I P R I R C A H T N I E V T W V I S L F Q D F G V L M F Hpy188I TspDTI | MaeIII Tsp4CI* BsrI | XmnI | Tsp45I |BbvII* \ \ \ \ \ \\ CTGGACATTGAAGTTGTTCCATTCAGAATGGTCACTTATTTGCCAGACGAAGACCGTTAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTGTAACTTCAACAAGGTAAGTCTTACCAGTGAATAAACGGTCTGCTTCTGGCAATA / / / / / / / BsrI | XmnI Hpy188I Tsp45I | BbvII* TspDTI MaeIII | MboII Tsp4CI* L D I E V V P F R M V T Y L P D E D R Y W T L K L F H S E W S L I C Q T K T V M G H * S C S I Q N G H L F A R R R P L C ----:----|----:----|----:----|----:----|----:----|----:----| S S M S T T G N L I T V * K G S S S R * V P C Q L Q E M * F P * K N A L R L G N Q V N F N N W E S H D S I Q W V F V T I MboII | MfeI | TspEI BceAI | | MboI Csp6I | | BclI |RsaI | | | DpnI |SetI | | | |BstKTI || Esp3I | | | || TspEI SetI || BsmAI \ \ \ \\ \ \ \\ \ GCTCCAATTGATCAAATTGACACCACAAAGACGAGAACCTTGAACATTTCAGGTACAGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTTAACTAGTTTAACTGTGGTGTTTCTGCTCTTGGAACTTGTAAAGTCCATGTCTC /// / / / / // ||| BclI TspEI SetI | |Csp6I ||| MboI | |BceAI ||DpnI | RsaI |BstKTI SetI TspEI MfeI A P I D Q I D T T K T R T L N I S G T E L Q L I K L T P Q R R E P * T F Q V Q S S N * S N * H H K D E N L E H F R Y R V ----:----|----:----|----:----|----:----|----:----|----:----| A G I S * I S V V F V L V K F M E P V S H E L Q D F Q C W L S S F R S C K L Y L S W N I L N V G C L R S G Q V N * T C L TfiI HinfI MseI | Hpy178III* TsoI AcyI |HgaI | | HphI | Hpy178III* \ \\ \ \ \ \ \ TTGAGACGCCGTTTAAGAGTTGGTGGTGAGATTCCTGAATGGTTCTCATATCCTGAAGTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTGCGGCAAATTCTCAACCACCACTCTAAGGACTTACCAAGAGTATAGGACTTCAC / / / / / / / / BsmAI AcyI | HgaI | Hpy178III* TsoI Hpy178III* Esp3I MseI | HphI HinfI TfiI L R R R L R V G G E I P E W F S Y P E V * D A V * E L V V R F L N G S H I L K W E T P F K S W W * D S * M V L I S * S G ----:----|----:----|----:----|----:----|----:----|----:----| N L R R K L T P P S I G S H N E Y G S T T S V G N L L Q H H S E Q I T R M D Q L Q S A T * S N T T L N R F P E * I R F H DdeI | Eco57I | Eco57MI BsiYI* | | TfiI | MmeI MfeI MseI | | HinfI | |SetI TspEI TspDTI \ \ \ \ \ \\ \ \ GTTAAAATCCTAAGAGAATCCAACCCACCAAGACCAAAACAAGGTTTTTCAATTGTTTTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTTTAGGATTCTCTTAGGTTGGGTGGTTCTGGTTTTGTTCCAAAAAGTTAACAAAAT / // / / // / / MseI |DdeI HinfI | |MmeI | SetI | TfiI | SetI TspDTI Eco57MI BsiYI* TspEI Eco57I MfeI V K I L R E S N P P R P K Q G F S I V L L K S * E N P T H Q D Q N K V F Q L F * * N P K R I Q P T K T K T R F F N C F R ----:----|----:----|----:----|----:----|----:----|----:----| T L I R L S D L G G L G F C P K E I T K P * F G L L I W G V L V L V L N K L Q K N F D * S F G V W W S W F L T K * N N * Tsp4CI* |Hin4I || BsiI* Hin4I SetI || | Hpy178III* | HindII TspEI MseI || | | TspEI BsrDI | Hpy166II CviRI* \ \ \\ \ \ \ \ \ \ \ GGTAATTCATTAACCGTTTCTCGTGAGCAATTATCCATTGCTTTGTTGTCAACATTCTTG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTAAGTAATTGGCAAAGAGCACTCGTTAATAGGTAACGAAACAACAGTTGTAAGAAC / // / / // / / / | || Tsp4CI* | |BsrDI Hin4I Hpy166II CviRI* | |MseI | TspEI HindII | Hin4I Hpy178III* TspEI BsiI* G N S L T V S R E Q L S I A L L S T F L V I H * P F L V S N Y P L L C C Q H S C * F I N R F S * A I I H C F V V N I L A ----:----|----:----|----:----|----:----|----:----|----:----| P L E N V T E R S C N D M A K N D V N K L Y N M L R K E H A I I W Q K T T L M R T I * * G N R T L L * G N S Q Q * C E Q MboI BglII XhoII TspEI | DpnI | BspMI SetI | |BstKTI Hin4I MaeIII \ \ \ \ \\ \ \ CAATTCGGTGGTGGCAGGTATTACAAGATCTTTGAACACAATAATAAGACAGAGTTACTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAGCCACCACCGTCCATAATGTTCTAGAAACTTGTGTTATTATTCTGTCTCAATGAT / / / // / / / | BspMI SetI || XhoII Hin4I MaeIII TspEI || BglII || MboI |DpnI BstKTI Q F G G G R Y Y K I F E H N N K T E L L N S V V A G I T R S L N T I I R Q S Y Y I R W W Q V L Q D L * T Q * * D R V T I ----:----|----:----|----:----|----:----|----:----|----:----| C N P P P L Y * L I K S C L L L V S N S A I R H H C T N C S R Q V C Y Y S L T V L E T T A P I V L D K F V I I L C L * * TfiI HinfI TspDTI | Hpy178III* Hpy166II BstXI | | Hin4I | TspEI | Hin4I \ \ \ \ \ \ \ TCTTTGATTCAAGATTTCATTGGTTCTGGTAGTGGACTAATTATTCCAAATCAATGGGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAACTAAGTTCTAAAGTAACCAAGACCATCACCTGATTAATAAGGTTTAGTTACCCTT / // / / / // | || Hpy178III* | TspEI |Hin4I | |Hin4I Hpy166II BstXI | HinfI | TfiI TspDTI S L I Q D F I G S G S G L I I P N Q W E L * F K I S L V L V V D * L F Q I N G K F D S R F H W F W * W T N Y S K S M G R ----:----|----:----|----:----|----:----|----:----|----:----| D K I * S K M P E P L P S I I G F * H S I K S E L N * Q N Q Y H V L * E L D I P R Q N L I E N T R T T S * N N W I L P F Cac8I SmlI | Hin4I |SetI | | AclI || AluI | | MaeII || CviJI | | | SetI || |DdeI | | | TaiI || |EspI* MlyI HinfI | | | |Bce83I* || ||SetI PleI MboII | | | |Hpy166II || ||| MnlI \ \ \ \ \ \\ \\ \\\ \ GATGACAAGGACTCTGTTGTTGGCAAGCAAAACGTTTACTTATTAGATACCTCAAGCTCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGTTCCTGAGACAACAACCGTTCGTTTTGCAAATGAATAATCTATGGAGTTCGAGT // / / / / / / / / /// // || | HinfI | Cac8I | | Hpy166II SetI ||| |EspI* || MboII Hin4I | Bce83I* ||| |DdeI |PleI | MaeII ||| MnlI MlyI | AclI ||CviJI TaiI ||AluI SetI |SmlI SetI D D K D S V V G K Q N V Y L L D T S S S M T R T L L L A S K T F T Y * I P Q A Q * Q G L C C W Q A K R L L I R Y L K L S ----:----|----:----|----:----|----:----|----:----|----:----| S S L S E T T P L C F T * K N S V E L E L H C P S Q Q Q C A F R K S I L Y R L S I V L V R N N A L L V N V * * I G * A * BseGI BspCNI | SetI |BseMII | | FokI ||AluI | | | TspDTI ||CviJI AciI | | | | TatI |||MaeI NspBII* | | | | Bsp1407I ||||SetI | PleI | | | | |Csp6I CviJI ||||| HinfI | |MlyI | | | | ||RsaI \ \\\\\ \ \ \\ \ \ \ \ \\\ GCCGATATTCAGCTAGAGTCAGCGGATGAACCTATTTCACATATTGTACAAAAAGTTGTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCTATAAGTCGATCTCAGTCGCCTACTTGGATAAAGTGTATAACATGTTTTTCAACAG / /// / / / / // // / / /// CviJI ||| | | | | || |SetI | FokI ||Bsp1407I ||| | | | | || BseGI TspDTI ||TatI ||| | | | | |PleI |Csp6I ||| | | | | |MlyI RsaI ||| | | | | AciI ||| | | | NspBII* ||| | | HinfI ||| | MaeI ||| CviJI ||| AluI ||SetI |BseMII BspCNI A D I Q L E S A D E P I S H I V Q K V V P I F S * S Q R M N L F H I L Y K K L S R Y S A R V S G * T Y F T Y C T K S C P ----:----|----:----|----:----|----:----|----:----|----:----| A S I * S S D A S S G I E C I T C F T T L R Y E A L T L P H V * K V Y Q V F L Q G I N L * L * R I F R N * M N Y L F N D BbvII* | CviJI BsiYI* | | MboII MseI \ \ \ \ \ CTATTCTTGGAAGACAATGGCTTTTTTGTATTTTAA 1510 1520 1530 ----:----|----:----|----:----|----:- GATAAGAACCTTCTGTTACCGAAAAAACATAAAATT / // / BsiYI* |BbvII* MseI |MboII CviJI L F L E D N G F F V F * Y S W K T M A F L Y F X I L G R Q W L F C I L X ----:----|----:----|----:----|----:- R N K S S L P K K T N * G I R P L C H S K Q I K * E Q F V I A K K Y K L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 5 AluBI ApaI 1 ApoI 2 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 3 BclI 1 FbaI,Ksp22I BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 5 Bpu10I 1 BsaXI 1 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 1 BseRI 2 BseSI 1 BaeGI,BstSLI BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspMI 2 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 3 BstXI 1 Cac8I 4 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 14 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI DraIII 1 AdeI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 3 AcuI Eco57MI 3 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 3 FauI 1 SmuI FokI 5 GlaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 10 HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 5 Hpy99I 1 MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 4 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MfeI 2 MunI MlyI 3 SchI MmeI 2 MnlI 7 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 3 PpsI RsaI 2 AfaI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 22 SexAI 1 MabI SfaNI 2 LweI SmlI 2 SmoI SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 3 TatI 1 TauI 1 TfiI 7 PfeI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 17 TasI,Tsp509I,Sse9I Tth111I 1 PflFI,PsyI,AspI XcmI 2 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BcgI BciVI BdaI BetI* BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseYI BsgI BsmI BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRV EgeI EheI FalI FnuDII* FseI FspAI GsaI GsuI HaeII HgiAI* Hin4II* HindIII HpaI KasI KpnI Ksp632I* MauBI McrI* MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TseI TspGWI TspMI TspRI TstI VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769