Restriction Map of TDH2/YJR009C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TDH2/YJR009C on chromosome X from coordinates 454681 to 453683.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16024

EMBOSS_001 TfiI HinfI MseI Tsp4CI* | TsoI TspEI \ \ \ \ \ ATGGTTAGAGTTGCTATTAACGGTTTCGGTAGAATCGGTAGATTGGTTATGAGAATTGCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAATCTCAACGATAATTGCCAAAGCCATCTTAGCCATCTAACCAATACTCTTAACGA / / / / / | Tsp4CI* | HinfI TspEI MseI | TfiI TsoI M V R V A I N G F G R I G R L V M R I A W L E L L L T V S V E S V D W L * E L L G * S C Y * R F R * N R * I G Y E N C F ----:----|----:----|----:----|----:----|----:----|----:----| X T L T A I L P K P L I P L N T I L I A X P * L Q * * R N R Y F R Y I P * S F Q H N S N S N V T E T S D T S Q N H S N S BinI* | TspDTI MaeII | | MboI | TaqI | | | DpnI | SetI | | | |BstKTI CviRI* | TaiI | | | || BcgI | BcgI | | Hpy99I | | | || | BsaXI \ \ \ \ \ \ \ \ \\ \ \ TTGCAAAGAAAGAACGTCGAAGTTGTTGCTTTGAACGATCCTTTCATCTCTAACGACTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTCTTTCTTGCAGCTTCAACAACGAAACTTGCTAGGAAAGTAGAGATTGCTGATG / / // / / // //// | BcgI || | TaqI || |||BsaXI CviRI* || MaeII || |||MboI |Hpy99I || ||BcgI TaiI || |DpnI SetI || BstKTI |BinI* TspDTI L Q R K N V E V V A L N D P F I S N D Y C K E R T S K L L L * T I L S S L T T T A K K E R R S C C F E R S F H L * R L L ----:----|----:----|----:----|----:----|----:----|----:----| K C L F F T S T T A K F S G K M E L S * K A F F S R R L Q Q K S R D K * R * R S Q L S L V D F N N S Q V I R E D R V V V FatI AflIII BspLU11I* |CviAII || NspI || NlaIII || |BsaXI || || MlyI || || PleI || || | Csp6I || || | |RsaI BaeI AciI || || | || HinfI | Tsp4CI* HphI \ \\ \\ \ \\ \ \ \ \ TCCGCTTACATGTTCAAGTACGACTCTACTCACGGTAGATACGCTGGTGAAGTTTCCCAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGAATGTACAAGTTCATGCTGAGATGAGTGCCATCTATGCGACCACTTCAAAGGGTG / / /// // // / / // | | ||| || || HinfI Tsp4CI* |BaeI | | ||| || || BaeI HphI | | ||| || |Csp6I | | ||| || RsaI | | ||| |PleI | | ||| MlyI | | ||BspLU11I* | | ||AflIII | | ||FatI | | |CviAII | | BsaXI | NlaIII | NspI AciI S A Y M F K Y D S T H G R Y A G E V S H P L T C S S T T L L T V D T L V K F P T R L H V Q V R L Y S R * I R W * S F P R ----:----|----:----|----:----|----:----|----:----|----:----| E A * M N L Y S E V * P L Y A P S T E W S R K C T * T R S * E R Y I R Q H L K G G S V H E L V V R S V T S V S T F N G V MboI MaeIII | DpnI BsmAI BaeI BccI Tsp45I | |BstKTI Eco31I BseYI \ \ \ \ \\ \ \ GATGACAAGCACATCATCGTTGATGGTCACAAGATCGCCACTTTCCAAGAAAGAGACCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGTTCGTGTAGTAGCAACTACCAGTGTTCTAGCGGTGAAAGGTTCTTTCTCTGGGT / / // / / / / BccI | || MboI | | SetI | |DpnI | GsaI | BstKTI Eco31I Tsp45I BsmAI MaeIII D D K H I I V D G H K I A T F Q E R D P M T S T S S L M V T R S P L S K K E T Q * Q A H H R * W S Q D R H F P R K R P S ----:----|----:----|----:----|----:----|----:----|----:----| S S L C M M T S P * L I A V K W S L S G R H C A C * R Q H D C S R W K G L F L G I V L V D D N I T V L D G S E L F S V W FatI NcoI StyI SecI* DsaI* AluI |CviAII GsaI || NlaIII CviJI || | CviJI MlyI BsrI | SetI || | | BtgZI PleI HinfI TspRI \ \ \\ \ \ \ \ \ \ GCTAACTTGCCATGGGCTTCTCTAAACATTGACATCGCCATTGACTCCACTGGTGTTTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGAACGGTACCCGAAGAGATTTGTAACTGTAGCGGTAACTGAGGTGACCACAAAAG / / // / / // // / BseYI | || CviJI BtgZI |PleI |HinfI BsrI CviJI | |DsaI* MlyI TspRI AluI | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII A N L P W A S L N I D I A I D S T G V F L T C H G L L * T L T S P L T P L V F S * L A M G F S K H * H R H * L H W C F Q ----:----|----:----|----:----|----:----|----:----|----:----| A L K G H A E R F M S M A M S E V P T K L * S A M P K E L C Q C R W Q S W Q H K S V Q W P S R * V N V D G N V G S T N E HgiCI* | NlaIV | Hin4II* BtsI TspEI BtsI TspRI | |HgaI SetI | MboII \ \ \ \ \\ \ \ \ AAGGAATTGGACACTGCTCAAAAGCACATTGACGCTGGTGCCAAGAAGGTTGTCATCACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTAACCTGTGACGAGTTTTCGTGTAACTGCGACCACGGTTCTTCCAACAGTAGTGA // // / // / / |TspRI || | |SetI | MboII |BtsI || | HgaI TspRI TspEI || HgiCI* BtsI |NlaIV Hin4II* K E L D T A Q K H I D A G A K K V V I T R N W T L L K S T L T L V P R R L S S L G I G H C S K A H * R W C Q E G C H H C ----:----|----:----|----:----|----:----|----:----|----:----| L S N S V A * F C M S A P A L F T T M V * P I P C Q E F A C Q R Q H W S P Q * * L F Q V S S L L V N V S T G L L N D D S FatI |CviAII || NlaIII || | MseI || | |HpaI BccI || | |HindII MboII TspRI | AciI TaqII || | |Hpy166II | Hpy188I \ \ \ \ \\ \ \\ \ \ GCTCCATCTTCCACCGCCCCAATGTTCGTCATGGGTGTTAACGAAGAAAAATACACTTCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTAGAAGGTGGCGGGGTTACAAGCAGTACCCACAATTGCTTCTTTTTATGTGAAGA / / / / // // / / | | TaqII | |FatI |MseI | Hpy188I | AciI | CviAII Hpy166II MboII BccI NlaIII HindII HpaI A P S S T A P M F V M G V N E E K Y T S L H L P P P Q C S S W V L T K K N T L L S I F H R P N V R H G C * R R K I H F * ----:----|----:----|----:----|----:----|----:----|----:----| A G D E V A G I N T M P T L S S F Y V E Q E M K W R G L T R * P H * R L F I C K S W R G G G W H E D H T N V F F F V S R XcmI |Tsp4CI* ||MmeI |||BstXI |||| CviJI |||| |NlaIV |||| || MwoI |||| || |CfrI |||| || || BalI |||| || || CviJI |||| || || HaeIII |||| || || |StyI Csp6I |||| || || |SecI* MboII |RsaI |||| || || || SfaNI \ \\ \\\\ \\ \\ \\ \ GACTTGAAGATTGTTTCCAACGCTTCTTGTACCACCAACTGTTTGGCTCCATTGGCCAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACTTCTAACAAAGGTTGCGAAGAACATGGTGGTTGACAAACCGAGGTAACCGGTTC / // // // / / // / MboII |Csp6I || || MwoI | || SecI* RsaI || |NlaIV | || StyI || CviJI | |SetI |Tsp4CI* | CfrI |MmeI HaeIII BstXI CviJI XcmI BalI D L K I V S N A S C T T N C L A P L A K T * R L F P T L L V P P T V W L H W P R L E D C F Q R F L Y H Q L F G S I G Q G ----:----|----:----|----:----|----:----|----:----|----:----| S K F I T E L A E Q V V L Q K A G N A L Q S S S Q K W R K K Y W W S N P E M P W V Q L N N G V S R T G G V T Q S W Q G L Tsp4CI* | TspRI | Hpy166II | | FatI | | |CviAII SetI | | || NlaIII SetI Hin4II* | MboII | | || | AciI \ \ \ \ \ \ \\ \ \ GTTATCAACGATGCTTTCGGTATTGAAGAAGGTTTGATGACCACTGTTCACTCCATGACC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGTTGCTACGAAAGCCATAACTTCTTCCAAACTACTGGTGACAAGTGAGGTACTGG / / / / / / / / // SfaNI Hin4II* SetI | | | | | |FatI | | | | | CviAII | | | | NlaIII | | | Hpy166II | | Tsp4CI* | TspRI MboII V I N D A F G I E E G L M T T V H S M T L S T M L S V L K K V * * P L F T P * P Y Q R C F R Y * R R F D D H C S L H D R ----:----|----:----|----:----|----:----|----:----|----:----| T I L S A K P I S S P K I V V T * E M V P * * R H K R Y Q L L N S S W Q E S W S N D V I S E T N F F T Q H G S N V G H G Hin4I Hin4I | FokI | | Tsp4CI* | | | HindII | | | Hpy166II | | | |TaqII | | | || AsuI* AciI | | | || AvaII BarI |XmnI | | | || Tsp4CI* BccI Hin4I ||FokI | | | || |BmgT120I BsaXI Hin4I ||| GsuI | | | || || BseGI | MnlI |BsrI SetI ||| Eco57MI \ \ \ \\ \\ \ \ \ \\ \ \\\ \ GCCACCCAAAAGACTGTTGACGGTCCATCCCACAAGGACTGGAGAGGTGGTAGAACCGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGGGTTTTCTGACAACTGCCAGGTAGGGTGTTCCTGACCTCTCCACCATCTTGGCGA / / / /// / /// / / // / / // / | Hin4I | ||| | ||| | | || | SetI || BsaXI | Hin4I | ||| | ||| | | || BsrI |Eco57MI AciI | ||| | ||| | | |Hin4I |GsuI | ||| | ||| | | |Hin4I |AciI | ||| | ||| | | |BarI XmnI | ||| | ||| | | MnlI | ||| | ||| | BccI | ||| | ||| BsaXI | ||| | ||AvaII | ||| | ||AsuI* | ||| | |BmgT120I | ||| | BseGI | ||| Tsp4CI* | ||Hpy166II | ||HindII | |TaqII | FokI Tsp4CI* A T Q K T V D G P S H K D W R G G R T A P P K R L L T V H P T R T G E V V E P L H P K D C * R S I P Q G L E R W * N R F ----:----|----:----|----:----|----:----|----:----|----:----| A V W F V T S P G D W L S Q L P P L V A R W G F S Q Q R D M G C P S S L H Y F R G G L L S N V T W G V L V P S T T S G S BccI |AgeI |BetI* |Cfr10I ||HpaII ||| MnlI ||| |TseI ||| ||BisI BetI* ||| |||BlsI |HpaII BseGI ||| |||| DdeI ||FokI | BarI ||| |||| Bpu10I ||BsaXI | | BseGI ||| |||| | MwoI |||MaeIII | | | BbvI ||| |||| | | CviJI SetI \\\\ \ \ \ \ \\\ \\\\ \ \ \ \ TCCGGTAACATCATCCCATCCTCTACCGGTGCTGCTAAGGCTGTCGGTAAGGTCTTGCCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCATTGTAGTAGGGTAGGAGATGGCCACGACGATTCCGACAGCCATTCCAGAACGGT / // / / / / / // /// / / / / | || | | BseGI | | || ||| | CviJI SetI MwoI | || | MaeIII | | || ||| Bpu10I | || | BseGI | | || ||| DdeI | || | BarI | | || ||MwoI | || FokI | | || ||TseI | |BetI* | | || |BisI | HpaII | | || BlsI FokI | | |Cfr10I | | |BetI* | | |MnlI | | |AgeI | | HpaII | BccI BbvI S G N I I P S S T G A A K A V G K V L P P V T S S H P L P V L L R L S V R S C Q R * H H P I L Y R C C * G C R * G L A R ----:----|----:----|----:----|----:----|----:----|----:----| E P L M M G D E V P A A L A T P L T K G K R Y C * G M R * R H Q * P Q R Y P R A G T V D D W G R G T S S L S D T L D Q W HindII Hpy166II PleI | AgeI |MlyI TspEI | BetI* ||TspGWI | MwoI | Cfr10I ||Tsp4CI* | | CviRI* | |HpaII Hpy188I ||| TaqI | | | SetI | || BslFI CviJI |HinfI ||| | Hpy99I \ \ \ \ \ \\ \ \ \\ \\\ \ \ GAATTGCAAGGTAAGTTGACCGGTATGGCTTTCAGAGTCCCAACCGTCGATGTTTCCGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACGTTCCATTCAACTGGCCATACCGAAAGTCTCAGGGTTGGCAGCTACAAAGGCAA // / / // / / / / // / || SetI | || | | | | || TaqI |CviRI* | || | | | | |Tsp4CI* TspEI | || | | | | |Hpy99I | || | | | | |PleI | || | | | | |MlyI | || | | | | TspGWI | || | | | HinfI | || | | Hpy188I | || | CviJI | || BslFI | |Cfr10I | |BetI* | |AgeI | HpaII Hpy166II HindII E L Q G K L T G M A F R V P T V D V S V N C K V S * P V W L S E S Q P S M F P L I A R * V D R Y G F Q S P N R R C F R C ----:----|----:----|----:----|----:----|----:----|----:----| S N C P L N V P I A K L T G V T S T E T L I A L Y T S R Y P K * L G L R R H K R F Q L T L Q G T H S E S D W G D I N G N HindII Hin4II* Hpy166II | Hpy178III* | DrdI | | SetI | | Tsp4CI* SetI | | BbvI TspDTI \ \ \ \ \ \ \ \ GTTGACTTGACTGTCAAGTTGAACAAGGAAACCACCTACGATGAAATCAAGAAGGTTGTC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTGAACTGACAGTTCAACTTGTTCCTTTGGTGGATGCTACTTTAGTTCTTCCAACAG / / / / / / / // | | Tsp4CI* SetI | | | |BbvI | DrdI | | | TspDTI Hpy166II | | SetI HindII | Hpy178III* Hin4II* V D L T V K L N K E T T Y D E I K K V V L T * L S S * T R K P P T M K S R R L S * L D C Q V E Q G N H L R * N Q E G C Q ----:----|----:----|----:----|----:----|----:----|----:----| T S K V T L N F L S V V * S S I L F T T Q Q S S Q * T S C P F W R R H F * S P Q N V Q S D L Q V L F G G V I F D L L N D TseI CviJI |BisI ||BlsI |||Hin4II* ||||AciI ||||BisI FalI |||||BlsI FalI ||||||TauI AjuI ||||||NspBII* TspRI ||||||| FalI | BseRI ||||||| FalI | | BbvII* ||||||| AjuI Eco57I | | | DrdI ||||||| | SetI Eco57MI | | | | HgaI ||||||| | Hin4II* | MaeIII | | | | MboII \\\\\\\ \ \ \ \ \ \ \ \ \ AAGGCTGCCGCTGAAGGTAAGTTGAAGGGTGTCTTGGGTTACACTGAAGACGCTGTTGTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGACGGCGACTTCCATTCAACTTCCCACAGAACCCAATGTGACTTCTGCGACAACAG //////// / / / / // / / / |||||||| | Hin4II* Eco57MI | |AjuI | | BbvII* |||||||| SetI Eco57I | |FalI | | MboII |||||||AjuI | |FalI | DrdI |||||||FalI | MaeIII BseRI |||||||FalI TspRI ||||||NspBII* ||||||AciI |||||BisI ||||BlsI |||TseI |||TauI ||Hin4II* ||BisI |BlsI CviJI K A A A E G K L K G V L G Y T E D A V V R L P L K V S * R V S W V T L K T L L S G C R * R * V E G C L G L H * R R C C L ----:----|----:----|----:----|----:----|----:----|----:----| L A A A S P L N F P T K P * V S S A T T * P Q R Q L Y T S P H R P N C Q L R Q Q L S G S F T L Q L T D Q T V S F V S N D MboII |HphI || BbvI BsmAI || SfaNI |TaqII || | Ksp632I* ||Eco57I || | | TaqI ||Eco57MI || | | | BccI |||Hpy188I || | | | | Hin4I |||| Hin4I || | | | | |TseI |||| | MnlI || | | | | ||BisI |||| | |MlyI || | | | | |||BlsI |||| | |PleI || | | | | |||| AciI |||| | || MaeIII || | | | | |||| BisI |||| | || Tsp45I || | | | | |||| |BlsI |||| | || | HinfI || | | | | |||| ||TauI MfeI |||| | || | |MboII || | | | | |||| ||NspBII* TspEI \\\\ \ \\ \ \\ \\ \ \ \ \ \\\\ \\\ \ TCCTCTGACTTCTTGGGTGACTCTAACTCTTCCATCTTCGATGCTGCCGCTGGTATCCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGACTGAAGAACCCACTGAGATTGAGAAGGTAGAAGCTACGACGGCGACCATAGGTT // / / / // / // // / // // ////// || | | | |PleI | || |HphI | || || |||||NspBII* || | | | MlyI | || MboII | || || |||||AciI || | | MnlI | |HinfI | || || ||||BisI || | BsmAI | Tsp45I | || || |||BlsI || Hpy188I | MaeIII | || || ||TseI || Hin4I MboII | || || ||TauI |Eco57MI | || || |BisI |Eco57I | || || BlsI |HgaI | || |BccI TaqII | || TaqI | |Hin4I | Ksp632I* SfaNI BbvI S S D F L G D S N S S I F D A A A G I Q P L T S W V T L T L P S S M L P L V S N L * L L G * L * L F H L R C C R W Y P I ----:----|----:----|----:----|----:----|----:----|----:----| E E S K K P S E L E E M K S A A A P I W R R Q S R P H S * S K W R R H Q R Q Y G G R V E Q T V R V R G D E I S G S T D L BssKI EcoRII | ScrFI | BseBI BciVI | | Csp6I MaeIII | BsmAI | | |RsaI Tsp4CI* \ \ \ \ \\ \ TTGTCTCCAAAGTTCGTCAAGTTGGTTTCCTGGTACGACAACGAATACGGTTACTCTACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGAGGTTTCAAGCAGTTCAACCAAAGGACCATGCTGTTGCTTATGCCAATGAGATGG // / / /// / / |BciVI BsmAI | ||Csp6I | MaeIII TspEI | |RsaI Tsp4CI* MfeI | EcoRII | BssKI BseBI ScrFI L S P K F V K L V S W Y D N E Y G Y S T C L Q S S S S W F P G T T T N T V T L P V S K V R Q V G F L V R Q R I R L L Y Q ----:----|----:----|----:----|----:----|----:----|----:----| N D G F N T L N T E Q Y S L S Y P * E V I T E L T R * T P K R T R C R I R N S * Q R W L E D L Q N G P V V V F V T V R G AflIII | MaeII | | SetI SalI | | TaiI |TaqI | | | StyI |AccI | | | SecI* ||HindII | | | | CviJI ||Hpy166II | | | | | MseI \\\ \ \ \ \ \ \ AGAGTTGTCGACTTGGTTGAACACGTTGCCAAGGCTTAA 970 980 990 ----:----|----:----|----:----|----:---- TCTCAACAGCTGAACCAACTTGTGCAACGGTTCCGAATT /// / / // / ||SalI | AflIII || MseI |AccI | MaeII |CviJI |TaqI TaiI SecI* Hpy166II SetI StyI HindII R V V D L V E H V A K A * E L S T W L N T L P R L X S C R L G * T R C Q G L X ----:----|----:----|----:----|----:---- L T T S K T S C T A L A * W L Q R S P Q V R Q W P K S N D V Q N F V N G L S L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AflIII 2 AgeI 2 AsiGI,BshTI,CspAI,PinAI AjuI 1 AluI 1 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 BcgI 1 BciVI 1 BfuI BetI* 3 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 1 Bpu10I 1 BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseRI 1 BseYI 1 BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspLU11I* 1 PscI,PciI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 BstXI 1 BtgZI 1 BtsI 2 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 8 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DrdI 2 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 4 FokI 3 GsaI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 3 Hin4II* 5 HpyAV HindII 5 HincII HinfI 5 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 3 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 2 HpyCH4IV MaeIII 5 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 1 MunI MlyI 4 SchI MmeI 1 MnlI 3 MseI 3 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PleI 4 PpsI RsaI 3 AfaI SalI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 12 SfaNI 2 LweI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 4 TaqII 3 TauI 2 TfiI 1 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 5 TscAI XcmI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AhaIII* AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BamHI BbvCI Bce83I* BceAI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI BsaAI BsaBI BseMII BsePI BseSI BsgI BsiI* BsiYI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cac8I CauII* Cfr9I ClaI CspCI DinI DraII DraIII Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GlaI HaeII HgiAI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MaeI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769