Restriction Map of LSO1/YJR005C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

LSO1/YJR005C-A on chromosome X from coordinates 448758 to 448477.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.3854

EMBOSS_001 BspCNI |BseMII || BstXI || | TseI || | |BisI || | ||SapI || | ||BlsI DdeI || | ||Ksp632I* CviRI* | Hpy188I || | ||| MwoI | EcoT22I BsrI | | AlwNI || | ||| | BbvI \ \ \ \ \ \ \\ \ \\\ \ \ ATGCATAATACTGGCAAGAGATACTCAGAAACTGCCAAAAAAGTGGCAGCAGGAAGAGCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTATTATGACCGTTCTCTATGAGTCTTTGACGGTTTTTTCACCGTCGTCCTTCTCGT / / / /// // / /// // | CviRI* BsrI ||AlwNI || BstXI ||| |MwoI EcoT22I |DdeI |BseMII ||| Ksp632I* Hpy188I BspCNI ||| SapI ||TseI |BisI BlsI M H N T G K R Y S E T A K K V A A G R A C I I L A R D T Q K L P K K W Q Q E E Q A * Y W Q E I L R N C Q K S G S R K S K ----:----|----:----|----:----|----:----|----:----|----:----| X C L V P L L Y E S V A L F T A A P L A X A Y Y Q C S I S L F Q W F L P L L F L H M I S A L S V * F S G F F H C C S S C Cac8I HindIII AluI MboII | AluI AsuI* CviJI |MaeII | CviJI AvaII |SmlI || SetI | |EcoP15I |BmgT120I ||SetI || TaiI | ||SetI || MaeI Bce83I* MaeI |||Hpy178III* \\ \ \ \\\ \\ \ \ \ \\\\ AGAAAACGTAGGCAAGCTTACGAAAAGGACCAACTAGAGAAACAACAACTAGAAGCTCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTGCATCCGTTCGAATGCTTTTCCTGGTTGATCTCTTTGTTGTTGATCTTCGAGTT / // / / / // // / / / / / / / | || MaeII | | |EcoP15I |AvaII | Bce83I* | | | | Hpy178III* | |TaiI | | HindIII |AsuI* MaeI | | | | SmlI | |SetI | CviJI BmgT120I | | | MwoI | MboII | AluI | | CviJI BbvI Cac8I | | AluI SetI | SetI MaeI R K R R Q A Y E K D Q L E K Q Q L E A Q E N V G K L T K R T N * R N N N * K L K K T * A S L R K G P T R E T T T R S S R ----:----|----:----|----:----|----:----|----:----|----:----| L F R L C A * S F S W S S F C C S S A * L F V Y A L K R F P G V L S V V V L L E S F T P L S V F L V L * L F L L * F S L MwoI |MnlI || AluI || CviJI || |DdeI || ||SetI || ||| Hpy188I || ||| | SetI || ||| | Hin4II* AluI || ||| | | BspCNI CviJI || ||| | | |BseMII | SetI || ||| | | || SetI | | TsoI || ||| | | || | MboII | | | MboII \\ \\\ \ \ \\ \ \ \ \ \ \ GAAGCTCAGAGGTGGGAAGAAGGTGCGAGAACCCCTAACCAGAAGAAGCTGATTATGGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGAGTCTCCACCCTTCTTCCACGCTCTTGGGGATTGGTCTTCTTCGACTAATACCTT // / /// / // / / / / / / || | ||| | || SetI MboII | | | MboII || | ||| | |BseMII | | TsoI || | ||| | BspCNI | CviJI || | ||| Hin4II* | AluI || | ||SetI SetI || | |DdeI || | Hpy188I || CviJI || AluI |SetI MnlI E A Q R W E E G A R T P N Q K K L I M E K L R G G K K V R E P L T R R S * L W N S S E V G R R C E N P * P E E A D Y G T ----:----|----:----|----:----|----:----|----:----|----:----| S A * L H S S P A L V G L W F F S I I S L L E S T P L L H S F G * G S S A S * P F S L P P F F T R S G R V L L L Q N H F MaeI | CviJI | |AciI | |BisI AluI | |Ksp632I* CviJI | ||MnlI |DdeI BsmAI | ||BlsI ||SetI CviJI Eco31I TspEI | |||TauI \\\ \ \ \ \ \\\\ CAAAAAAAGACAGAGAAGCTAAGAGCCAAAAAGGAAAGAGACCAATTACTAGCCGCCGAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTTTTCTGTCTCTTCGATTCTCGGTTTTTCCTTTCTCTGGTTAATGATCGGCGGCTT / / / / / / ////// | | | CviJI Eco31I | |||||Ksp632I* | | DdeI BsmAI | ||||AciI | CviJI | |||BisI | AluI | ||BlsI SetI | ||MnlI | |CviJI | |TauI | MaeI TspEI Q K K T E K L R A K K E R D Q L L A A E K K R Q R S * E P K R K E T N Y * P P K K K D R E A K S Q K G K R P I T S R R R ----:----|----:----|----:----|----:----|----:----|----:----| C F F V S F S L A L F S L S W N S A A S V F F S L S A L L W F P F L G I V L R R L F L C L L * S G F L F S V L * * G G F HindIII | AluI | CviJI | | SetI | | |MboII | | || MnlI | | || | SetI \ \ \\ \ \ GAGGAAGCTTTAGGTAAGGGAGGCAGGGGAAAAAGATACTGA 250 260 270 280 ----:----|----:----|----:----|----:----|-- CTCCTTCGAAATCCATTCCCTCCGTCCCCTTTTTCTATGACT / / / // | | | |MnlI | | | SetI | | HindIII | | MboII | CviJI | AluI SetI E E A L G K G G R G K R Y * R K L * V R E A G E K D T X G S F R * G R Q G K K I L X ----:----|----:----|----:----|----:----|-- S S A K P L P P L P F L Y Q L P L K L Y P L C P F F I S L F S * T L S A P S F S V S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 6 AluBI AlwNI 1 CaiI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I Bce83I* 1 BpuEI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseMII 2 BsmAI 1 Alw26I,BstMAI BspCNI 2 BsrI 1 BseNI,Bse1I,BsrSI BstXI 1 Cac8I 1 BstC8I CviJI 8 CviKI-1 CviRI* 1 HpyCH4V DdeI 3 BstDEI,HpyF3I Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I Hin4II* 1 HpyAV HindIII 2 Hpy178III* 1 Hpy188III Hpy188I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboII 4 MnlI 3 MwoI 2 HpyF10VI,BstMWI SapI 1 LguI,PciSI,BspQI SetI 10 SmlI 1 SmoI TaiI 1 TauI 1 TseI 1 ApeKI TsoI 1 TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MroNI MseI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqI TaqII TatI TfiI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769