Restriction Map of RFA3/YJL173C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RFA3/YJL173C on chromosome X from coordinates 96529 to 96161.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12026

EMBOSS_001 CfrI | BalI | CviJI MaeII | HaeIII HindII | SetI | | Cac8I Hpy166II | TaiI \ \ \ \ \ \ ATGGCCAGCGAAACACCAAGAGTTGACCCCACAGAAATCTCCAACGTCAATGCTCCTGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGGTCGCTTTGTGGTTCTCAACTGGGGTGTCTTTAGAGGTTGCAGTTACGAGGACAC / / / / / | Cac8I Hpy166II | MaeII | CfrI HindII TaiI HaeIII SetI CviJI BalI M A S E T P R V D P T E I S N V N A P V W P A K H Q E L T P Q K S P T S M L L C G Q R N T K S * P H R N L Q R Q C S C V ----:----|----:----|----:----|----:----|----:----|----:----| X A L S V G L T S G V S I E L T L A G T X P W R F V L L Q G W L F R W R * H E Q H G A F C W S N V G C F D G V D I S R H TfiI Hin6I HinfI |GlaI | TspRI BspCNI MmeI ||HhaI | | DdeI |BseMII \ \\\ \ \ \ \\ TTTAGGATAATAGCGCAAATCAAATCACAACCCACTGAATCTCAGTTGATTTTACAATCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAATCCTATTATCGCGTTTAGTTTAGTGTTGGGTGACTTAGAGTCAACTAAAATGTTAGC / /// / / / // MmeI ||Hin6I TspRI | DdeI |BseMII |GlaI HinfI BspCNI HhaI TfiI F R I I A Q I K S Q P T E S Q L I L Q S L G * * R K S N H N P L N L S * F Y N R * D N S A N Q I T T H * I S V D F T I A ----:----|----:----|----:----|----:----|----:----|----:----| N L I I A C I L D C G V S D * N I K C D T * S L L A F * I V V W Q I E T S K V I K P Y Y R L D F * L G S F R L Q N * L R MnlI | TseI SetI MaeII | |BisI | BbvI | SetI TaqI | ||BlsI | |BceAI | TaiI SspI \ \ \\\ \ \\ \ \ \ CCAACCATATCATCGAAAAACGGCAGCGAGGTTGAAATGATTACGTTGAACAATATTCGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGGTATAGTAGCTTTTTGCCGTCGCTCCAACTTTACTAATGCAACTTGTTATAAGCA / / /// / // / / / TaqI | ||| SetI || | MaeII SspI | ||TseI || TaiI | |BisI || SetI | BlsI |BbvI MnlI BceAI P T I S S K N G S E V E M I T L N N I R Q P Y H R K T A A R L K * L R * T I F V N H I I E K R Q R G * N D Y V E Q Y S C ----:----|----:----|----:----|----:----|----:----|----:----| G V M D D F F P L S T S I I V N F L I R A L W I M S F R C R P Q F S * T S C Y E W G Y * R F V A A L N F H N R Q V I N T MlyI PleI TspDTI |MboI || DpnI || |TaqI || |BstKTI BplI || || HinfI BplI BplI || || | BsiI* BplI CviRI* \ \\ \\ \ \ \ \ GTATCTATGAATAAAACATTTGAGATCGACTCGTGGTATGAGTTTGTTTGCAGGAACAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGATACTTATTTTGTAAACTCTAGCTGAGCACCATACTCAAACAAACGTCCTTGTTA / / //// // / / / / BplI | |||| || | BsiI* BplI CviRI* BplI | |||| || HinfI BplI | |||| |TaqI | |||| MboI | |||DpnI | ||BstKTI | |PleI | MlyI TspDTI V S M N K T F E I D S W Y E F V C R N N Y L * I K H L R S T R G M S L F A G T M I Y E * N I * D R L V V * V C L Q E Q * ----:----|----:----|----:----|----:----|----:----|----:----| T D I F L V N S I S E H Y S N T Q L F L H I * S Y F M Q S R S T T H T Q K C S C Y R H I F C K L D V R P I L K N A P V I BceAI | TfiI | HinfI | | XbaI | | |MaeI | | |Hpy178III* | | || TatI | | || |Csp6I Cac8I | | || ||RsaI | AluI | | || ||| HgaI | CviJI | | || ||| | CviRI* | |MaeI | | || ||| | | ApoI | ||SetI | | || ||| | | TspEI \ \\\ \ \ \\ \\\ \ \ \ GATGACGGCGAGCTAGGATTTTTGATTCTAGACGCTGTACTATGCAAATTCAAGGAGAAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCCGCTCGATCCTAAAAACTAAGATCTGCGACATGATACGTTTAAGTTCCTCTTG / / / / / // /// // / | | MaeI | | |XbaI ||| |HgaI TspEI | CviJI | | | ||| | ApoI | AluI | | | ||| CviRI* Cac8I | | | ||TatI SetI | | | |Csp6I | | | RsaI | | Hpy178III* | | MaeI | HinfI | TfiI BceAI D D G E L G F L I L D A V L C K F K E N M T A S * D F * F * T L Y Y A N S R R T * R R A R I F D S R R C T M Q I Q G E R ----:----|----:----|----:----|----:----|----:----|----:----| S S P S S P N K I R S A T S H L N L S F H H R R A L I K S E L R Q V I C I * P S I V A L * S K Q N * V S Y * A F E L L V MseI | HindIII | | AluI | | CviJI | | | MseI | | | SetI | | | MboII Tsp4CI* BsmAI \ \ \ \ \ \ GAAGATTTAAGCTTAAACGGTGTGGTTGCTTTACAGAGACTATGTAAGAAATACCCAGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTAAATTCGAATTTGCCACACCAACGAAATGTCTCTGATACATTCTTTATGGGTCTT / /// / / / | ||| | Tsp4CI* BsmAI | ||| MseI | ||HindIII | |MboII | CviJI | AluI MseI SetI E D L S L N G V V A L Q R L C K K Y P E K I * A * T V W L L Y R D Y V R N T Q K R F K L K R C G C F T E T M * E I P R N ----:----|----:----|----:----|----:----|----:----|----:----| S S K L K F P T T A K C L S H L F Y G S R L N L S L R H P Q K V S V I Y S I G L F I * A * V T H N S * L S * T L F V W F MaeI \ ATATACTAG ----:---- TATATGATC / MaeI I Y * Y T X I L X ----:---- I Y * F I S Y V L # Enzymes that cut Frequency Isoschizomers AluI 2 AluBI ApoI 1 AcsI,XapI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BceAI 2 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BplI 2 BseMII 1 BsiI* 1 BssSI,Bst2BI,BauI BsmAI 1 Alw26I,BstMAI BspCNI 1 BstKTI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviJI 3 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 1 MalI GlaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 3 Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MlyI 1 SchI MmeI 1 MnlI 1 MseI 2 Tru1I,Tru9I PleI 1 PpsI RsaI 1 AfaI SetI 5 SspI 1 TaiI 2 TaqI 2 TatI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I TspRI 1 TscAI XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I ClaI CspCI CviAII DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FokI FseI FspAI GsaI GsuI HaeII HgiAI* HgiCI* HgiJII* Hin4I Hin4II* HpaI HpaII HphI Hpy188I Hpy99I KasI KpnI Ksp632I* MaeIII MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaqII TauI TsoI Tsp45I TspGWI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769