Restriction Map of CIS3/YJL158C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CIS3/YJL158C on chromosome X from coordinates 122948 to 122265.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.30624

EMBOSS_001 BbvI | MaeII | | SetI | | TaiI | | | Hpy99I | | | | TspGWI | | | | |MaeI | | | | || BbvI | | | | || |TseI | | | | || |AluI | | | | || |MwoI | | | | || |CviJI | | | | || ||BisI | | | | || |||BlsI | | | | || |||SetI | | | | || |||| EcoP15I | | | | || |||| | MwoI | | | | || |||| | | EciI | | | | || |||| | | |TseI TspRI | | | | || |||| | | ||BisI MwoI |Hin4II* CviRI* | | | | || |||| | | |||BlsI |AciI ||GsuI |TspEI | | | | || |||| | | |||MnlI || BtsI ||Eco57MI \\ \ \ \ \ \\ \\\\ \ \ \\\\ \\ \ \\\ ATGCAATTCAAAAACGTCGCCCTAGCTGCCTCCGTTGCTGCTCTATCCGCCACTGCTTCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTAAGTTTTTGCAGCGGGATCGACGGAGGCAACGACGAGATAGGCGGTGACGAAGA / / // / / /////// / // /// / // / | | || | | ||||||| | || ||| MwoI |AciI Hin4II* | | || | | ||||||| | || ||TseI TspRI Eco57MI | | || | | ||||||| | || |BisI BtsI GsuI | | || | | ||||||| | || MnlI | | || | | ||||||| | || BlsI | | || | | ||||||| | |EciI | | || | | ||||||| | EcoP15I | | || | | ||||||| MwoI | | || | | ||||||TseI | | || | | ||||||BbvI | | || | | |||||BisI | | || | | ||||BlsI | | || | | |||CviJI | | || | | |||AluI | | || | | ||MaeI | | || | | |SetI | | || | | MwoI | | || | TspGWI | | || MaeII | | || BbvI | | |Hpy99I | | TaiI | | SetI | TspEI CviRI* M Q F K N V A L A A S V A A L S A T A S C N S K T S P * L P P L L L Y P P L L L A I Q K R R P S C L R C C S I R H C F C ----:----|----:----|----:----|----:----|----:----|----:----| X C N L F T A R A A E T A A R D A V A E X A I * F R R G L Q R R Q Q E I R W Q K H L E F V D G * S G G N S S * G G S S R BssKI EcoRII | ScrFI | BseBI | | SetI | | |Hpy166II | | ||XcmI | | ||Eco57I | | ||Eco57MI | | ||| FatI | | ||| NcoI | | ||| StyI | | ||| SecI* | | ||| DsaI* | | ||| |CviAII | | ||| || AsuI* | | ||| || AvaII | | ||| || NlaIII | | ||| || |BmgT120I Cfr10I | | ||| || ||HphI |HpaII | | ||| || |||Hpy166II || CviJI MaeIII | | ||| || |||| MseI || |NlaIV | SetI | | ||| || |||| SetI || || BbvI \ \ \ \ \\\ \\ \\\\ \ \\ \\ \ GCTGAAGGTTACACTCCAGGTGAACCATGGTCCACCTTAACCCCAACCGGCTCCATCTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTCCAATGTGAGGTCCACTTGGTACCAGGTGGAATTGGGGTTGGCCGAGGTAGAGA / / // /// / ////// / /// / SetI | || ||| | |||||SetI MseI ||NlaIV BbvI | || ||| | ||||Hpy166II |Cfr10I | || ||| | ||||AvaII |CviJI | || ||| | ||||AsuI* HpaII | || ||| | |||BmgT120I | || ||| | ||HphI | || ||| | |DsaI* | || ||| | |SecI* | || ||| | |StyI | || ||| | |NcoI | || ||| | |FatI | || ||| | CviAII | || ||| NlaIII | || ||Hpy166II | || ||XcmI | || |Eco57MI | || |Eco57I | || EcoRII | || BssKI | |BseBI | |ScrFI | SetI MaeIII A E G Y T P G E P W S T L T P T G S I S L K V T L Q V N H G P P * P Q P A P S L * R L H S R * T M V H L N P N R L H L L ----:----|----:----|----:----|----:----|----:----|----:----| A S P * V G P S G H D V K V G V P E M E Q Q L N C E L H V M T W R L G L R S W R S F T V S W T F W P G G * G W G A G D R MwoI | AluI TseI | CviJI |BisI | |MboII BccI ||BlsI SetI | ||SetI SetI Ksp632I* \ \\\ \ \ \\\ \ \ TGTGGTGCTGCCGAATACACTACCACCTTTGGTATTGCTGTTCAAGCTATTACCTCTTCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCACGACGGCTTATGTGATGGTGGAAACCATAACGACAAGTTCGATAATGGAGAAGT / /// / / / / / / / BccI ||TseI SetI | | | SetI | Hin4I |BisI | | CviJI Hin4I BlsI | | MboII | | AluI | SetI MwoI C G A A E Y T T T F G I A V Q A I T S S V V L P N T L P P L V L L F K L L P L Q W C C R I H Y H L W Y C C S S Y Y L F K ----:----|----:----|----:----|----:----|----:----|----:----| Q P A A S Y V V V K P I A T * A I V E E K H H Q R I C * W R Q Y Q Q E L * * R K T T S G F V S G G K T N S N L S N G R * TspEI | EcoP15I | | MaeIII | | Tsp45I | | | Hin4I | | | | Hin4I | | | | |Tsp4CI* Hin4I | | | | || DrdI |MnlI | | | | || | HphI ||AluI | | | | || | | BbvI ||Hin4I | | | | || | | | CviJI ||CviJI | | | | || | | | | Bce83I* |||DdeI | | | | || | | | | | MwoI |||Esp3I MaeII | | | | || | | | | | | TseI |||BsmAI | SetI | | | | || | | | | | | |BisI ||||SetI | TaiI | | | | || | | | | | | ||BlsI \\\\\ \ \ \ \ \ \ \\ \ \ \ \ \ \ \\\ AAAGCTAAGAGAGACGTTATCTCTCAAATTGGTGACGGTCAAGTCCAAGCCACTTCTGCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGATTCTCTCTGCAATAGAGAGTTTAACCACTGCCAGTTCAGGTTCGGTGAAGACGA /// // / / /// / / / / // // ||| || | MaeII ||| | | HphI | |MwoI |BisI ||| || TaiI ||| | DrdI | Bce83I* BlsI ||| || SetI ||| Tsp4CI* CviJI ||| |BsmAI ||| Tsp45I BbvI ||| |Esp3I ||| MaeIII ||| DdeI ||Hin4I ||CviJI |EcoP15I ||AluI |TspEI |Ksp632I* Hin4I MnlI SetI K A K R D V I S Q I G D G Q V Q A T S A K L R E T L S L K L V T V K S K P L L L S * E R R Y L S N W * R S S P S H F C C ----:----|----:----|----:----|----:----|----:----|----:----| F A L L S T I E * I P S P * T W A V E A L L * S L R * R E F Q H R D L G L W K Q F S L S V N D R L N T V T L D L G S R S AluI MwoI CviJI AluI | SmlI CviJI CviJI | SetI AciI CviJI \ \ \ \ \ \ \ \ GCTACTGCTCAAGCCACCGATAGTCAAGCCCAAGCTACTACTACCGCTACCCCAACCAGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGACGAGTTCGGTGGCTATCAGTTCGGGTTCGATGATGATGGCGATGGGGTTGGTCG / // / / / / / / MwoI |CviJI | | CviJI AciI | CviJI TseI SmlI | | AluI | AluI | SetI SetI CviJI A T A Q A T D S Q A Q A T T T A T P T S L L L K P P I V K P K L L L P L P Q P A Y C S S H R * S S P S Y Y Y R Y P N Q L ----:----|----:----|----:----|----:----|----:----|----:----| A V A * A V S L * A W A V V V A V G V L Q * Q E L W R Y D L G L * * * R * G L W S S S L G G I T L G L S S S G S G W G A SetI | Hpy188I | | MboII | | | MboI | | | BglII Ksp632I* | | | XhoII | CviRI* | | | | DpnI | | MnlI | | | | |BstKTI | | | SfaNI MboII \ \ \ \ \\ \ \ \ \ \ TCCGAAAAGATCTCTTCCTCTGCATCTAAAACATCTACTAATGCCACATCATCTTCTTGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTTTTCTAGAGAAGGAGACGTAGATTTTGTAGATGATTACGGTGTAGTAGAAGAACA / / // / // / / / | | || XhoII || MnlI SfaNI MboII | | || BglII |CviRI* | | || MboI Ksp632I* | | |DpnI | | BstKTI | MboII Hpy188I S E K I S S S A S K T S T N A T S S S C P K R S L P L H L K H L L M P H H L L V R K D L F L C I * N I Y * C H I I F L C ----:----|----:----|----:----|----:----|----:----|----:----| E S F I E E E A D L V D V L A V D D E Q S R F S R K R Q M * F M * * H W M M K K G F L D R G R C R F C R S I G C * R R T Acc65I HgiCI* AluI |Csp6I CviJI ||RsaI | FatI ||NlaIV | SetI ||| KpnI | |CviAII ||| |DdeI | || NlaIII ||| ||SetI | || | ApoI ||| ||| TspEI | || | TspEI ||| ||| | Hin4II* BccI | || | EcoRI ||| ||| | | SetI \ \ \\ \ \ \\\ \\\ \ \ \ GCCACTCCATCTTTGAAAGATAGCTCATGTAAGAATTCTGGTACCTTAGAATTGACCTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGAGGTAGAAACTTTCTATCGAGTACATTCTTAAGACCATGGAATCTTAACTGGAAC / / / / // / / /// / // BccI | | | |FatI | | ||| DdeI |SetI | | | CviAII | | ||HgiCI* Hin4II* | | NlaIII | | ||Acc65I TspEI | CviJI | | |Csp6I | AluI | | NlaIV SetI | | RsaI | | SetI | KpnI EcoRI TspEI ApoI A T P S L K D S S C K N S G T L E L T L P L H L * K I A H V R I L V P * N * P * H S I F E R * L M * E F W Y L R I D L E ----:----|----:----|----:----|----:----|----:----|----:----| A V G D K F S L E H L F E P V K S N V K H W E M K S L Y S M Y S N Q Y R L I S R G S W R Q F I A * T L I R T G * F Q G Q PsrI Tsp4CI* | StyI TspEI | SfaNI | SecI* | XmnI PsrI TspEI \ \ \ \ \ \ \ \ AAGGACGGTGTTTTGACTGATGCCAAGGGTAGAATTGGTTCTATTGTTGCTAACAGACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGCCACAAAACTGACTACGGTTCCCATCTTAACCAAGATAACAACGATTGTCTGTT / / / / / / | | PsrI SecI* TspEI PsrI | SfaNI StyI XmnI Tsp4CI* K D G V L T D A K G R I G S I V A N R Q R T V F * L M P R V E L V L L L L T D N G R C F D * C Q G * N W F Y C C * Q T I ----:----|----:----|----:----|----:----|----:----|----:----| F S P T K V S A L P L I P E I T A L L C S P R H K S Q H W P Y F Q N * Q Q * C V L V T N Q S I G L T S N T R N N S V S L MroNI CviJI Cfr10I BsiYI* |HpaII ||BbvI ||NaeI ||Cac8I |||KasI |||HgiCI* ||||AcyI ||||NarI ||||Hin6I |||||GlaI |||||DinI |||||NlaIV ||||||HhaI |||||||HaeII |||||||| MwoI |||||||| | TseI AsuI* |||||||| | BccI AvaII |||||||| | |BisI AsuI* Tsp4CI* |||||||| | ||BlsI AvaII |BmgT120I |||||||| | |||Cfr10I |BmgT120I TspEI || Hpy166II |||||||| | ||||HpaII || TsoI \ \\ \ \\\\\\\\ \ \\\\\ \\ \ TTCCAATTTGACGGTCCACCACCACAAGCCGGCGCCATCTACGCTGCCGGTTGGTCCATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTAAACTGCCAGGTGGTGGTGTTCGGCCGCGGTAGATGCGACGGCCAACCAGGTAA / / / // / / ////// / /// // /// TspEI | | |Hpy166II | | |||||| MwoI ||| || ||TsoI | | |AvaII | | |||||HgiCI* ||| || |AvaII | | |AsuI* | | |||||KasI ||| || |AsuI* | | BmgT120I | | ||||Hin6I ||| || BmgT120I | Tsp4CI* | | ||||NarI ||| |Cfr10I TspEI | | ||||AcyI ||| HpaII | | ||||BbvI ||TseI | | |||NlaIV |BisI | | |||DinI BccI | | |||GlaI BlsI | | ||Cfr10I | | ||MroNI | | ||HhaI | | |HpaII | | |HaeII | | Cac8I | | NaeI | CviJI BsiYI* F Q F D G P P P Q A G A I Y A A G W S I S N L T V H H H K P A P S T L P V G P L P I * R S T T T S R R H L R C R L V H Y ----:----|----:----|----:----|----:----|----:----|----:----| N W N S P G G G C A P A M * A A P Q D M I G I Q R D V V V L R R W R R Q R N T W E L K V T W W W L G A G D V S G T P G N MaeIII | TaqII | | MboII | | | CviJI | | | | Eco57I | | | | Eco57MI | | | | | MaeIII | | | | | Tsp45I | | | | | | MaeIII | | | | | | Tsp45I | | | | | | Tsp4CI* | | | | | | | MaeII | | | | | | | |TspRI | | | | | | | ||HphI | | | | | | | |||SetI HpaII BccI | | | | | | | |||TaiI | TspEI \ \ \ \ \ \ \ \ \\\\ \ \ ACTGAAGATGGTTACTTGGCTTTGGGTGACAGTGACGTTTTCTACCAATGTCTATCCGGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTCTACCAATGAACCGAAACCCACTGTCACTGCAAAAGATGGTTACAGATAGGCCG / / / / / / / / // / BccI | | | | | | | |MaeII HpaII | | | | | | | Tsp45I | | | | | | | MaeIII | | | | | | | HphI | | | | | | TaiI | | | | | | SetI | | | | | Tsp4CI* | | | | | Tsp45I | | | | | MaeIII | | | | TspRI | | | Eco57MI | | | Eco57I | | CviJI | MaeIII | MboII TaqII T E D G Y L A L G D S D V F Y Q C L S G L K M V T W L W V T V T F S T N V Y P A * R W L L G F G * Q * R F L P M S I R Q ----:----|----:----|----:----|----:----|----:----|----:----| V S S P * K A K P S L S T K * W H R D P * Q L H N S P K P H C H R K R G I D I R S F I T V Q S Q T V T V N E V L T * G A MboI BclI | DpnI | |BstKTI | || MaeII | || | SetI | || | TaiI | || | | Hpy99I TspDTI BstXI \ \\ \ \ \ \ \ AATTTCTACAACTTGTATGATCAAAACGTCGCCGAACAATGTAGTGCCATTCATTTGGAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGATGTTGAACATACTAGTTTTGCAGCGGCTTGTTACATCACGGTAAGTAAACCTT / // / // / / / / TspEI || | || MaeII TspDTI BstXI SetI || | |Hpy99I || | TaiI || | SetI || BclI || MboI |DpnI BstKTI N F Y N L Y D Q N V A E Q C S A I H L E I S T T C M I K T S P N N V V P F I W K F L Q L V * S K R R R T M * C H S F G S ----:----|----:----|----:----|----:----|----:----|----:----| L K * L K Y S * F T A S C H L A M * K S C N R C S T H D F R R R V I Y H W E N P I E V V Q I I L V D G F L T T G N M Q F SalI |TaqI |AccI ||HindII AluI ||Hpy166II CviJI ||| Tsp4CI* | SetI ||| | MseI \ \ \\\ \ \ GCTGTTTCTTTGGTCGACTGTTAA 670 680 ----:----|----:----|---- CGACAAAGAAACCAGCTGACAATT / //// / CviJI |||| MseI AluI |||Tsp4CI* ||SalI |AccI |TaqI Hpy166II HindII A V S L V D C * L F L W S T V X C F F G R L L X ----:----|----:----|---- A T E K T S Q * L Q K K P R S N S N R Q D V T L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 7 AluBI ApoI 1 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BbvI 5 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BglII 1 BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BssKI 1 BstSCI,StyD4I BstKTI 2 BstXI 1 BtsI 1 Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 13 CviKI-1 CviRI* 2 HpyCH4V DdeI 2 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 2 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 Eco57I 2 AcuI Eco57MI 3 EcoP15I 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 2 GlaI 1 GsuI 1 BpmI HaeII 1 BstH2I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HpaII 4 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy188I 1 Hpy99I 2 KasI 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 5 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MnlI 3 MroNI 1 NgoMIV MseI 2 Tru1I,Tru9I MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NarI 1 Mly113I NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PsrI 1 RsaI 1 AfaI SalI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 18 SfaNI 2 LweI SmlI 1 SmoI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 1 TaqII 1 TseI 5 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BceAI BcgI BciVI BdaI BetI* BfiI BglI BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstF5I BstZ17I BtgZI BtrI BtsCI CauII* Cfr9I CfrI ClaI CspCI DraII DraIII Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EspI* FalI FaqI FauI FnuDII* FokI FseI FspAI GsaI HaeIII HgaI HgiAI* HgiJII* HindIII HinfI HpaI Hpy178III*MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MslI MstI* NdeI NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SchI SduI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TauI TfiI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769