Restriction Map of PRY3/YJL078C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PRY3/YJL078C on chromosome X from coordinates 293981 to 291336.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16070

EMBOSS_001 SfaNI | GsuI | Eco57MI | | MaeI MaeI CviJI BglI | | BceAI BseGI |FokI MwoI \ \ \ \ \\ \ ATGCTGGAGTTTCCAATATCAGTTCTGCTAGGATGCCTAGTAGCCGTCAAGGCACAAACC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGACCTCAAAGGTTATAGTCAAGACGATCCTACGGATCATCGGCAGTTCCGTGTTTGG / / / / / / / / / | | | | | | | FokI TaiI | | | | | | MwoI SetI | | | | | | BglI | | | | | CviJI | | | | MaeI | | | BseGI | | BceAI | | MaeI | SfaNI Eco57MI GsuI M L E F P I S V L L G C L V A V K A Q T C W S F Q Y Q F C * D A * * P S R H K P A G V S N I S S A R M P S S R Q G T N H ----:----|----:----|----:----|----:----|----:----|----:----| X S S N G I D T R S P H R T A T L A C V X A P T E L I L E A L I G L L R * P V F H Q L K W Y * N Q * S A * Y G D L C L G Hpy188I | Hin6I | |GlaI | |Eco47III | ||HhaI | |||HaeII | |||| FatI MaeII | |||| AflIII | SetI TaqI MwoI | |||| BspLU11I* | TaiI |Hpy178III* | BtgZI | |||| |CviAII \ \ \\ \ \ \ \\\\ \\ ACGTTTCCAAACTTCGAGAGCGATGTGCTGAACGAGCATAACAAGTTCAGAGCGCTACAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAAAGGTTTGAAGCTCTCGCTACACGACTTGCTCGTATTGTTCAAGTCTCGCGATGTA / // / / / //// / / MaeII |Hpy178III* MwoI BtgZI | |||| | CviAII TaqI | |||| NlaIII | |||| NspI | |||Hin6I | ||Eco47III | ||GlaI | |HhaI | HaeII Hpy188I T F P N F E S D V L N E H N K F R A L H R F Q T S R A M C * T S I T S S E R Y M V S K L R E R C A E R A * Q V Q S A T C ----:----|----:----|----:----|----:----|----:----|----:----| V N G F K S L S T S F S C L L N L A S C W T E L S R S R H A S R A Y C T * L A V R K W V E L A I H Q V L M V L E S R * M NspI NlaIII | HindII | Hpy166II | | HphI | | |Hin6I | | ||GlaI | | |||HhaI | | ||||AciI | | ||||BisI | | ||||HaeII | | |||||BlsI | | ||||||TauI | | ||||||BsrBI CfrI | | ||||||| BssKI | BalI | | ||||||| SexAI | CviJI | | ||||||| EcoRII | HaeIII | | ||||||| | ScrFI | | SetI | | ||||||| | BseBI | | MwoI | | ||||||| | |SetI | | | Hin6I | | ||||||| | ||AsuI* | | | |GlaI | | ||||||| | ||AvaII | | | |MstI* | | ||||||| | |||BmgT120I | | | ||HhaI | | ||||||| | |||| Hpy188I | | | ||| MmeI \ \ \\\\\\\ \ \\\\ \ \ \ \ \\\ \ GTTGACACAGCGCCGCTCACCTGGTCCGACACTCTGGCCACCTATGCGCAGAACTACGCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTGTGTCGCGGCGAGTGGACCAGGCTGTGAGACCGGTGGATACGCGTCTTGATGCGG / / //////// / / /// / // /// | | |||||||| | | ||Hpy188I | |MwoI ||Hin6I | | |||||||| | | ||AvaII | CfrI ||MmeI | | |||||||| | | ||AsuI* | SetI |MstI* | | |||||||| | | |BmgT120I HaeIII |GlaI | | |||||||| | | EcoRII CviJI HhaI | | |||||||| | | SexAI BalI | | |||||||| | | BssKI | | |||||||| | BseBI | | |||||||| | ScrFI | | |||||||| SetI | | |||||||BsrBI | | |||||||AciI | | ||||||BisI | | |||||BlsI | | ||||Hin6I | | ||||TauI | | |||GlaI | | ||HhaI | | |HaeII | | HphI | Hpy166II | HindII BspLU11I* AflIII FatI V D T A P L T W S D T L A T Y A Q N Y A L T Q R R S P G P T L W P P M R R T T P * H S A A H L V R H S G H L C A E L R R ----:----|----:----|----:----|----:----|----:----|----:----| T S V A G S V Q D S V R A V * A C F * A H Q C L A A * R T R C E P W R H A S S R N V C R R E G P G V S Q G G I R L V V G BsmI |BccI || MslI || |Hpy188I || || AsuI* || || |CviJI || || |HaeIII || || |BmgT120I TsoI MseI || || || NdeI | SetI \ \\ \\ \\ \ \ \ GACCAATATGATTGTTCGGGTGTCTTAACGCATTCCGATGGCCCATATGGTGAGAACCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTTATACTAACAAGCCCACAGAATTGCGTAAGGCTACCGGGTATACCACTCTTGGAA // / / /// / // / || | | ||| NdeI |SetI HphI || | | ||AsuI* TsoI || | | |BmgT120I || | | HaeIII || | | CviJI || | Hpy188I || | MslI || BccI |BsmI MseI D Q Y D C S G V L T H S D G P Y G E N L T N M I V R V S * R I P M A H M V R T L P I * L F G C L N A F R W P I W * E P C ----:----|----:----|----:----|----:----|----:----|----:----| S W Y S Q E P T K V C E S P G Y P S F R R G I H N N P H R L A N R H G M H H S G V L I I T R T D * R M G I A W I T L V K AciI BsrBI | Hpy166II | |MwoI | ||AcyI | ||| BssKI | ||| EcoRII | ||| | ScrFI | ||| | BseBI HphI | ||| | | Csp6I | StyI | ||| | | |RsaI | SecI* | ||| | | |HgaI | | MaeIII | ||| | | ||BsiYI* TspEI \ \ \ \ \\\ \ \ \\\ \ GCCCTTGGTTACACAGACACGGGAGCGGTGGACGCCTGGTACGGGGAGATAAGCAAGTAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGAACCAATGTGTCTGTGCCCTCGCCACCTGCGGACCATGCCCCTCTATTCGTTCATA / / / // / / ///// / | MaeIII | || | | ||||| HgaI SecI* | || | | ||||Csp6I StyI | || | | |||RsaI | || | | ||EcoRII | || | | ||BssKI | || | | |BsiYI* | || | | BseBI | || | | ScrFI | || | AcyI | || Hpy166II | |MwoI | AciI BsrBI A L G Y T D T G A V D A W Y G E I S K Y P L V T Q T R E R W T P G T G R * A S I P W L H R H G S G G R L V R G D K Q V * ----:----|----:----|----:----|----:----|----:----|----:----| A R P * V S V P A T S A Q Y P S I L L Y Q G Q N C L C P L P P R R T R P S L C T G K T V C V R S R H V G P V P L Y A L I Hpy188I |TfiI PfoI |HinfI BssKI || SecI* | HpaII || DsaI* OliI | ScrFI || | MaeIII MslI | CauII* || | Tsp45I | SetI \ \ \\ \ \ \ \ AATTATTCAAATCCCGGATTTTCTGAATCCACGGGTCACTTCACACAGGTGGTTTGGAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATAAGTTTAGGGCCTAAAAGACTTAGGTGCCCAGTGAAGTGTGTCCACCAAACCTTC / /// / / / / / TspEI ||BssKI | | DsaI* Tsp45I MslI ||PfoI | | SecI* MaeIII OliI |HpaII | HinfI SetI CauII* | TfiI ScrFI Hpy188I N Y S N P G F S E S T G H F T Q V V W K I I Q I P D F L N P R V T S H R W F G S L F K S R I F * I H G S L H T G G L E V ----:----|----:----|----:----|----:----|----:----|----:----| L * E F G P N E S D V P * K V C T T Q F Y N N L D R I K Q I W P D S * V P P K S I I * I G S K R F G R T V E C L H N P L BseGI | PsiI | | FokI | | | SspI | | | | NmeAIII | | | | | Csp6I | | | | | |RsaI | | | | | || FatI HindII | | | | | || |CviAII Hpy166II | | | | | || || NlaIII | AciI TsoI | | | | | || || | TspEI \ \ \ \ \ \ \ \ \\ \\ \ \ TCAACCGCCGAGATTGGATGTGGTTATAAATATTGTGGTACGACATGGAACAATTATATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGGCGGCTCTAACCTACACCAATATTTATAACACCATGCTGTACCTTGTTAATATAA / / / / / / / // / // / | | TsoI BseGI PsiI | FokI || | |FatI TspEI | AciI NmeAIII || | CviAII Hpy166II SspI || NlaIII HindII |Csp6I RsaI S T A E I G C G Y K Y C G T T W N N Y I Q P P R L D V V I N I V V R H G T I I L N R R D W M W L * I L W Y D M E Q L Y C ----:----|----:----|----:----|----:----|----:----|----:----| D V A S I P H P * L Y Q P V V H F L * I T L R R S Q I H N Y I N H Y S M S C N Y * G G L N S T T I F I T T R C P V I I N PfoI BssKI EcoRII | ScrFI | BseBI | | TaqII | | | MnlI | | | | BssKI | | | | EcoRII | | | | |SecI* | | | | ||ScrFI MnlI SduI | | | | ||BseBI | CviRI* HgiAI* | | | | |||SetI | | HphI NlaIV \ \ \ \ \ \\\\ \ \ \ \ GTGTGCTCCTACAACCCTCCTGGAAACTACCTGGGTGAGTTTGCAGAGGAAGTGGAACCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACACGAGGATGTTGGGAGGACCTTTGATGGACCCACTCAAACGTCTCCTTCACCTTGGT / // / / / / / / / / / HgiAI* || | | | | | MnlI | HphI NlaIV SduI || | | | | EcoRII CviRI* || | | | | BssKI || | | | | SecI* || | | | BseBI || | | | ScrFI || | | SetI || | MnlI || EcoRII || BssKI || PfoI |BseBI |ScrFI TaqII V C S Y N P P G N Y L G E F A E E V E P C A P T T L L E T T W V S L Q R K W N H V L L Q P S W K L P G * V C R G S G T T ----:----|----:----|----:----|----:----|----:----|----:----| T H E * L G G P F * R P S N A S S T S G Q T S R C G E Q F S G P H T Q L P L P V H A G V V R R S V V Q T L K C L F H F W MnlI | Ksp632I* | | MnlI | | |SetI BseGI | | || BsaXI FokI | MnlI | | || Hin4I Tsp4CI* | | MboII | | || | MnlI PsiI | TspRI | | | MnlI | | || | | Hpy188I \ \ \ \ \ \ \ \ \ \\ \ \ \ CTTATAAGCACTGTTTCCTCGTCCTCATCCTCGTCCTCTTCTACCTCAACTACATCAGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GAATATTCGTGACAAAGGAGCAGGAGTAGGAGCAGGAGAAGATGGAGTTGATGTAGTCTG / / / / / / / / / / /// / / | | | FokI | | | MnlI | | ||BsaXI | Hpy188I | | Tsp4CI* | | MboII | | || MnlI | TspRI | MnlI | | |Ksp632I* PsiI BseGI | | Hin4I | | MnlI | SetI MnlI L I S T V S S S S S S S S S T S T T S D L * A L F P R P H P R P L L P Q L H Q T Y K H C F L V L I L V L F Y L N Y I R H ----:----|----:----|----:----|----:----|----:----|----:----| S I L V T E E D E D E D E E V E V V D S V * L C Q K R T R M R T R K * R L * M L K Y A S N G R G * G R G R R G * S C * V AciI Cac8I | NspBII* | |SfeI* BseGI | || FauI Tth111I | BccI | || |Hin6I | FokI | BsaXI | || ||GlaI AccI | Tsp4CI* | |BsrI | || |||HhaI |BssNAI | | BsmAI | ||Hin4I | || |||| BaeI |Hpy166II Tsp4CI* \ \ \ \ \\\ \ \\ \\\\ \ \\ \ ACAGTCTCCACCATCTCATCCAGTATTATGCCCGCTGTAGCGCAAGGGTATACAACAACG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAGAGGTGGTAGAGTAGGTCATAATACGGGCGACATCGCGTTCCCATATGTTGTTGC / / // / / / / / //// // / | FokI || | | BccI | | |||Hin6I |AccI Tsp4CI* Tth111I || | BsrI | | ||FauI Hpy166II Tsp4CI* || Hin4I | | ||GlaI BssNAI || BsaXI | | |HhaI |BseGI | | SfeI* BsmAI | | BaeI | NspBII* | AciI Cac8I T V S T I S S S I M P A V A Q G Y T T T Q S P P S H P V L C P L * R K G I Q Q R S L H H L I Q Y Y A R C S A R V Y N N G ----:----|----:----|----:----|----:----|----:----|----:----| V T E V M E D L I I G A T A C P Y V V V C L R W W R M W Y * A R Q L A L T Y L L C D G G D * G T N H G S Y R L P I C C R AciI |BisI ||BlsI |||NheI |||TauI |||CviJI ||||MaeI |||||Cac8I |||||| TseI |||||| BmtI MseI |||||| BaeI |BbvI |||||| |BisI |AhaIII* MwoI |||||| ||BlsI || TaqI Hpy99I EcoP15I |AciI \\\\\\ \\\ \\ \ \ \ \\ GTATCGTCTGCGGCTAGCAGCAGTTCTTTAAAATCGACGACCATAAACCCTGCCAAGACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGCAGACGCCGATCGTCGTCAAGAAATTTTAGCTGCTGGTATTTGGGACGGTTCTGG //// ////// // // / / / |||| |||||TseI || || TaqI | MwoI |||| ||||BisI || |Hpy99I EcoP15I |||| |||BlsI || BbvI |||| ||NheI |MseI |||| |MaeI AhaIII* |||| Cac8I |||CviJI |||BmtI ||BaeI ||BisI ||AciI |BlsI TauI V S S A A S S S S L K S T T I N P A K T Y R L R L A A V L * N R R P * T L P R P I V C G * Q Q F F K I D D H K P C Q D R ----:----|----:----|----:----|----:----|----:----|----:----| T D D A A L L L E K F D V V M F G A L V P I T Q P * C C N K L I S S W L G Q W S Y R R R S A A T R * F R R G Y V R G L G TfiI HinfI Ksp632I* | BinI* | MnlI | | MboI | Tsp4CI* | | BamHI BtsI | | TspEI | | XhoII | MboII | | | MmeI | | | DpnI | | TspRI | | | |SpeI | | | NlaIV HgaI | | |MnlI | | | ||MaeI | | | |BstKTI \ \ \ \\ \ \ \ \\\ \ \ \ \\ GCTACCCTCACTGCGTCCTCTTCTACCGTAATTACTAGTAGCACAGAATCAGTTGGATCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGGGAGTGACGCAGGAGAAGATGGCATTAATGATCATCGTGTCTTAGTCAACCTAGG / // / / // / / // / / // // AciI || | MnlI || | | |SpeI | | || |TspRI || MboII || | | MaeI | | || XhoII |HgaI || | TspEI | | || BamHI TspRI || MmeI | | || MboI BtsI |Ksp632I* | | |NlaIV Tsp4CI* | | |DpnI MnlI | | BstKTI | BinI* HinfI TfiI A T L T A S S S T V I T S S T E S V G S L P S L R P L L P * L L V A Q N Q L D P Y P H C V L F Y R N Y * * H R I S W I L ----:----|----:----|----:----|----:----|----:----|----:----| A V R V A D E E V T I V L L V S D T P D R * G * Q T R K * R L * * Y C L I L Q I S G E S R G R R G Y N S T A C F * N S G SetI BinI* | AvaI Bce83I* AluI | XhoI | Tsp4CI* CviJI | SmlI | | MnlI | SetI | PspXI | | TspRI | | MnlI | |TaqI | | | BsmAI | | | SapI | |BmeT110I | | | | CviJI | | | MaeIII | || Csp6I | | | | |MboII | | | Tsp45I | || |RsaI | | | | ||SmlI | | | Ksp632I* BseRI | || |MnlI \ \ \ \ \\\ \ \ \ \ \ \ \\ \\ TCCACTGTCTCATCAGCCTCAAGCTCTTCTGTCACTACTTCCTATGCTACCTCCTCGAGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGACAGAGTAGTCGGAGTTCGAGAAGACAGTGATGAAGGATACGATGGAGGAGCTCA / // / / /// / / / / / //// | || MnlI | ||| MnlI | | BseRI SetI |||RsaI | |Tsp4CI* | ||CviJI | Tsp45I ||MnlI | BinI* | ||AluI | MaeIII |PspXI Bce83I* | |SmlI Ksp632I* |SmlI | SetI SapI |XhoI BsmAI |AvaI CviJI BmeT110I MboII TaqI S T V S S A S S S S V T T S Y A T S S S P L S H Q P Q A L L S L L P M L P P R V H C L I S L K L F C H Y F L C Y L L E Y ----:----|----:----|----:----|----:----|----:----|----:----| E V T E D A E L E E T V V E * A V E E L R W Q R M L R L S K Q * * K R H * R R S G S D * * G * A R R D S S G I S G G R T MnlI Tsp4CI* | SfaNI | |Hpy99I | || MaeI | || |FokI | || |BsmAI | || |Esp3I | || || TspDTI BseGI SetI MnlI BarI \ \\ \\ \ \ \ \ \ ACCGTCGTCTCTAGTGATGCTACTTCATCCACTACCACCACCTCATCGGTTGCTACATCG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAGCAGAGATCACTACGATGAAGTAGGTGATGGTGGTGGAGTAGCCAACGATGTAGC // / // / / / / / / |Tsp4CI* | || Esp3I BseGI SetI | BarI BsrI |Hpy99I | || BsmAI MnlI |MnlI | || FokI Csp6I | |MaeI | TspDTI SfaNI T V V S S D A T S S T T T T S S V A T S P S S L V M L L H P L P P P H R L L H R R R L * * C Y F I H Y H H L I G C Y I V ----:----|----:----|----:----|----:----|----:----|----:----| V T T E L S A V E D V V V V E D T A V D Y R R R * H H * K M W * W W R M P Q * M G D D R T I S S * G S G G G * R N S C R Hpy188I | BbvI | | BbvI | | AvaI | | XhoI | | SmlI | | PspXI | | |TaqI | | |SetI | | |BmeT110I | | ||BarI | | ||| BtsI | | ||| | SduI | | ||| | HgiAI* | | ||| | | MnlI | | ||| | | |TseI | | ||| | | ||BisI | | ||| | | ||MboII | | ||| | | |||BlsI | | ||| | | |||TspRI | | ||| | | ||||TseI | | ||| | | |||||BisI | | ||| | | |||||MmeI | | ||| | | |||||MboII | | ||| | | ||||||BlsI | | ||| | | ||||||Hin4I | | ||| | | ||||||| Hin4I BsrI | | ||| | | ||||||| | Bce83I* | MboII | | ||| | | ||||||| | |BinI* | Csp6I | | ||| | | ||||||| | || MboI | |RsaI | | ||| | | ||||||| | || Hpy188I | ||EcoP15I | | ||| | | ||||||| | || | DpnI | ||| Hin4I | | ||| | | ||||||| | || | |BstKTI | ||| EcoP15I | | ||| | | ||||||| | || | || BbvI \ \\\ \ \ \ \\\ \ \ \\\\\\\ \ \\ \ \\ \ TCCAGTACCACTTCTTCCGACCCTACCTCGAGCACTGCTGCTGCTTCTTCTTCTGATCCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCATGGTGAAGAAGGCTGGGATGGAGCTCGTGACGACGACGAAGAAGAAGACTAGGA //// / / / / / // / /////// / / / // / |||| | | | | | || | ||||||| | | | || MboI |||| | | | | | || | ||||||| | | | |DpnI |||| | | | | | || | ||||||| | | | BstKTI |||| | | | | | || | ||||||| | | Hpy188I |||| | | | | | || | ||||||| | BinI* |||| | | | | | || | ||||||| Bce83I* |||| | | | | | || | ||||||TseI |||| | | | | | || | |||||BisI |||| | | | | | || | ||||Hin4I |||| | | | | | || | ||||BlsI |||| | | | | | || | |||MboII |||| | | | | | || | |||TseI |||| | | | | | || | ||MmeI |||| | | | | | || | ||BisI |||| | | | | | || | |BlsI |||| | | | | | || | Hin4I |||| | | | | | || | MboII |||| | | | | | || MnlI |||| | | | | | |PspXI |||| | | | | | |SmlI |||| | | | | | |XhoI |||| | | | | | |AvaI |||| | | | | | |BbvI |||| | | | | | BmeT110I |||| | | | | | HgiAI* |||| | | | | | TspRI |||| | | | | | TaqI |||| | | | | | SduI |||| | | | | | BtsI |||| | | | | BbvI |||| | | | BarI |||| | | | SetI |||| | | Hpy188I |||| | EcoP15I |||| EcoP15I |||Csp6I ||RsaI |Hin4I MboII S S T T S S D P T S S T A A A S S S D P P V P L L P T L P R A L L L L L L L I L Q Y H F F R P Y L E H C C C F F F * S C ----:----|----:----|----:----|----:----|----:----|----:----| D L V V E E S G V E L V A A A E E E S G T W Y W K K R G * R S C Q Q Q K K K Q D G T G S R G V R G R A S S S S R R R I R GsuI Eco57MI | AciI | |MnlI | ||TseI | ||NspBII* | |||BisI Hin6I | ||||BlsI |GlaI | ||||| AciI ||HhaI MboII | ||||| BisI ||FnuDII* | AciI | ||||| |BlsI ||| MnlI | BisI MaeI | ||||| |Hin4I ||| | Csp6I | |BlsI | TseI SmlI | ||||| ||TauI ||| | |RsaI | ||TauI | |BisI \ \ \\\\\ \\\ \\\ \ \\ \ \\\ \ \\ GCCTCAAGTTCCGCTGCCGCTTCCTCCAGCGCGAGTACCGAGAACGCCGCTTCTTCTAGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGTTCAAGGCGACGGCGAAGGAGGTCGCGCTCATGGCTCTTGCGGCGAAGAAGATCG / / / /////// //// // / //// / / | | | ||||||AciI |||| |Csp6I | |||AciI | BlsI | | | |||||BisI |||| RsaI | ||BisI MaeI | | | ||||BlsI |||MnlI | |BlsI | | | |||TseI ||FnuDII* | TauI | | | |||TauI ||Hin6I MboII | | | ||BisI |GlaI | | | |BlsI HhaI | | | NspBII* | | | Hin4I | | | AciI | | MnlI | Eco57MI | SmlI | GsuI BbvI A S S S A A A S S S A S T E N A A S S S P Q V P L P L P P A R V P R T P L L L A L K F R C R F L Q R E Y R E R R F F * Q ----:----|----:----|----:----|----:----|----:----|----:----| A E L E A A A E E L A L V S F A A E E L Q R L N R Q R K R W R S Y R S R R K K * G * T G S G S G G A R T G L V G S R R A BlsI |Hin6I ||GlaI |||HhaI ||||HaeII ||||| MboII ||||| TspDTI ||||| |AvaI ||||| |XhoI ||||| |SmlI ||||| |Hpy178III* ||||| ||TaqI ||||| ||BmeT110I ||||| |||BbvI ||||| |||| BccI ||||| |||| |AluI ||||| |||| |CviJI ||||| |||| |Ecl136II ||||| |||| || SetI ||||| |||| || SduI ||||| |||| || SacI ||||| |||| || HgiAI* TatI ||||| |||| || HgiJII* |Csp6I ||||| |||| || | SapI BplI ||RsaI GsuI ||||| |||| || | Ksp632I* BplI ||ScaI Eco57MI \\\\\ \\\\ \\ \ \ \ \\\ \ AGCGCCATCTCGAGCTCTTCATCAATGGTTTCTGCTCCTTTGAGTAGTACTCTTACTACT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCGGTAGAGCTCGAGAAGTAGTTACCAAAGACGAGGAAACTCATCATGAGAATGATGA //// // ///// / / /// / / |||| || ||||BbvI | BplI ||TatI | BplI |||| || |||Ecl136II | BplI |Csp6I | BplI |||| || |||CviJI Ksp632I* ScaI Eco57MI |||| || |||BccI SapI RsaI GsuI |||| || |||AluI |||| || ||SmlI |||| || ||XhoI |||| || ||AvaI |||| || |BmeT110I |||| || |HgiJII* |||| || |HgiAI* |||| || |TaqI |||| || |SacI |||| || |SduI |||| || |SetI |||| || Hpy178III* |||| |MboII |||| TspDTI |||Hin6I ||GlaI |TseI |HhaI HaeII BisI S A I S S S S S M V S A P L S S T L T T A P S R A L H Q W F L L L * V V L L L L R H L E L F I N G F C S F E * Y S Y Y F ----:----|----:----|----:----|----:----|----:----|----:----| L A M E L E E D I T E A G K L L V R V V C R W R S S K M L P K Q E K S Y Y E * * A G D R A R * * H N R S R Q T T S K S S AciI BplI BplI | FalI | FalI | Cac8I | | AluI | | CviJI MseI | | | SetI |TspEI | | | |Hpy178III* || FalI | | | || MaeIII TspEI || FalI MseI CviRI* \ \ \ \\ \ \ \\ \ \ \ TCCACCGCAAGCTCCAGAAGTGTAACTTCCAATTCAGTTAATTCTGTTAAGTTTGCAAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGGCGTTCGAGGTCTTCACATTGAAGGTTAAGTCAATTAAGACAATTCAAACGTTTG / / / / / / / / / / / / | | | | | MaeIII | | | TspEI MseI CviRI* | | | | Hpy178III* | | MseI | | | CviJI | FalI | | | AluI | FalI | | Cac8I TspEI | | SetI | AciI FalI FalI S T A S S R S V T S N S V N S V K F A N P P Q A P E V * L P I Q L I L L S L Q T H R K L Q K C N F Q F S * F C * V C K H ----:----|----:----|----:----|----:----|----:----|----:----| E V A L E L L T V E L E T L E T L N A F K W R L S W F H L K W N L * N Q * T Q L G G C A G S T Y S G I * N I R N L K C V Ksp632I* |EcoP15I || MnlI BbvI || | Hin6I | MnlI OliI || | |GlaI | | BdaI MslI || | ||HhaI | | BdaI | Tsp4CI* MboII SetI || | |||HaeII | | |SfeI* \ \ \ \ \\ \ \\\\ \ \ \\ ACAACTGTGTTTTCTGCTCAAACAACCTCTTCTGTAAGCGCCTCATTATCATCATCTGTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGACACAAAAGACGAGTTTGTTGGAGAAGACATTCGCGGAGTAATAGTAGTAGACAT // / / ////// / // // |Tsp4CI* | SetI |||||Hin6I | |BdaI |SfeI* MslI MboII ||||GlaI | |BdaI SetI OliI |||HhaI | BbvI ||HaeII MnlI |Ksp632I* |EcoP15I MnlI T T V F S A Q T T S S V S A S L S S S V Q L C F L L K Q P L L * A P H Y H H L * N C V F C S N N L F C K R L I I I I C S ----:----|----:----|----:----|----:----|----:----|----:----| V V T N E A * V V E E T L A E N D D D T C L Q T K Q E F L R K Q L R R M I M M Q C S H K R S L C G R R Y A G * * * * R Y TseI AluI MnlI CviJI | StyI AluI |BisI | BdaI CviJI Hpy188I ||BlsI | BdaI CviJI |DdeI | BspCNI ||SetI | SecI* HaeIII ||SetI | |BseMII \\\ \ \ \ \\\ \ \\ GCTGCTGACGATATTCAGGGTAGCACTTCCAAGGAGGCCACAAGCTCAGTTTCCGAACAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGACTGCTATAAGTCCCATCGTGAAGGTTCCTCCGGTGTTCGAGTCAAAGGCTTGTA //// // / / / / / / // |||TseI |BdaI | | | | DdeI | |BseMII ||BisI |BdaI | | | CviJI | BspCNI |BlsI MnlI | | | AluI Hpy188I CviJI | | SetI AluI | HaeIII | CviJI SecI* StyI A A D D I Q G S T S K E A T S S V S E H L L T I F R V A L P R R P Q A Q F P N I C * R Y S G * H F Q G G H K L S F R T Y ----:----|----:----|----:----|----:----|----:----|----:----| A A S S I * P L V E L S A V L E T E S C L Q Q R Y E P Y C K W P P W L S L K R V S S V I N L T A S G L L G C A * N G F M MaeIII | SpeI | |MaeI | ||BbvI | ||| CviRI* | ||| | MwoI | ||| | BstAPI | ||| | | TseI MwoI SpeI | ||| | | |BisI | BsmAI MboII |MaeI | ||| | | ||BlsI | |CviRI* |PshAI \\ \ \\\ \ \ \\\ \ \\ \\ ACTAGTATAGTAACTAGTGCAACTAATGCTGCCCAATATGCAACGAGACTTGGGTCATCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCATATCATTGATCACGTTGATTACGACGGGTTATACGTTGCTCTGAACCCAGTAGA // / // / / /// / / / / / |SpeI | || | BstAPI ||| MwoI | BsmAI | PshAI MaeI | || | MwoI ||TseI CviRI* MboII | || CviRI* |BisI | || BbvI BlsI | |SpeI | MaeI MaeIII T S I V T S A T N A A Q Y A T R L G S S L V * * L V Q L M L P N M Q R D L G H L * Y S N * C N * C C P I C N E T W V I F ----:----|----:----|----:----|----:----|----:----|----:----| V L I T V L A V L A A W Y A V L S P D D Y * Y L L * H L * H Q G I H L S V Q T M S T Y Y S T C S I S G L I C R S K P * R BsmAI Esp3I | DdeI | BbvCI | Bpu10I MboII | Ksp632I* Hpy178III* | | AluI | BceAI | | CviJI | | XmnI | | PvuII | | | BssKI | | NspBII* | | | |SecI* | | | SetI | | | |HpaII | | | | MnlI | | | ||ScrFI | | | | | BspCNI | | | ||CauII* | | | | | |BseMII | | | ||| MboII | | | | | || TspGWI | | | ||| AsuI* | | | | | || | BceAI | | | ||| |NlaIV | | | | | || | |Hpy188I | | | ||| |BmgT120I | | | | | || | ||ApoI | | | ||| ||CviJI | | | | | || | ||TspEI | | | ||| ||HaeIII | | | | | || | ||EcoRI \ \ \ \\\ \\\ \ \ \ \ \ \\ \ \\\ TCCAGAAGTTCTTCCGGGGCCGTCTCTTCCTCAGCTGTGTCGCAATCTGTTCTGAATTCC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCTTCAAGAAGGCCCCGGCAGAGAAGGAGTCGACACAGCGTTAGACAAGACTTAAGG / / / / / /// //// / // / / / / / | | | XmnI | ||AsuI* |||| | || | | | | BaeI | | BceAI | |BmgT120I |||| | || | | | EcoRI | Hpy178III* | |HaeIII |||| | || | | | TspEI MboII | |CviJI |||| | || | | | ApoI | BssKI |||| | || | | BceAI | SecI* |||| | || | Hpy188I | NlaIV |||| | || TspGWI CauII* |||| | |BseMII HpaII |||| | BspCNI ScrFI |||| MnlI MboII |||NspBII* |||PvuII |||CviJI |||AluI ||Ksp632I* ||Bpu10I ||BbvCI ||DdeI |SetI Esp3I BsmAI S R S S S G A V S S S A V S Q S V L N S P E V L P G P S L P Q L C R N L F * I P Q K F F R G R L F L S C V A I C S E F R ----:----|----:----|----:----|----:----|----:----|----:----| E L L E E P A T E E E A T D C D T R F E K W F N K R P R R K R L Q T A I Q E S N G S T R G P G D R G * S H R L R N Q I G BaeI | CviJI | | HindII | | Hpy166II | | | MaeII | | | | Hpy99I | | | | |SetI | | | | |TaiI | | | | || MaeIII | | | | || | DdeI | | | | || | |SetI | | | | || | || BaeI | | | | || | || | MnlI | | | | || | || | | BspCNI | | | | || | || | | |BseMII | | | | || | || | | || CviJI \ \ \ \ \\ \ \\ \ \ \\ \ GTTATAGCCGTCAACACCGACGTATCTGTAACCTCAGTTAGTAGCACAGCCCATACCACA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CAATATCGGCAGTTGTGGCTGCATAGACATTGGAGTCAATCATCGTGTCGGGTATGGTGT / / / / / / // / / // / / | | | | MaeII | || DdeI | || CviJI Eco57MI | | | TaiI | |BaeI | |BseMII Eco57I | | | SetI | MaeIII | BspCNI | | Hpy99I SetI MnlI | Hpy166II | HindII CviJI V I A V N T D V S V T S V S S T A H T T L * P S T P T Y L * P Q L V A Q P I P Q Y S R Q H R R I C N L S * * H S P Y H K ----:----|----:----|----:----|----:----|----:----|----:----| T I A T L V S T D T V E T L L V A W V V R * L R * C R R I Q L R L * Y C L G Y W N Y G D V G V Y R Y G * N T A C G M G C MaeIII | AciI | |FalI | |FalI | || DdeI | || | Hpy188I | || | | MnlI DdeI Eco57I | || | | | BspCNI Bpu10I Eco57MI | || | | | |BseMII | FalI | AciI | || | | | || Hpy188I | FalI \ \ \ \\ \ \ \ \\ \ \ \ AAGGACACCGCCACCACTTCAGTAACCGCCTCAGAAAGTATCACTTCGGAAACTGCTCAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGTGGCGGTGGTGAAGTCATTGGCGGAGTCTTTCATAGTGAAGCCTTTGACGAGTC / / / / // / // / / / AciI | | | |DdeI | || | FalI Bpu10I | | | | | || | FalI DdeI | | | | | || Hpy188I | | | | | |BseMII | | | | | BspCNI | | | | MnlI | | | Hpy188I | | AciI | MaeIII FalI FalI K D T A T T S V T A S E S I T S E T A Q R T P P P L Q * P P Q K V S L R K L L R G H R H H F S N R L R K Y H F G N C S G ----:----|----:----|----:----|----:----|----:----|----:----| F S V A V V E T V A E S L I V E S V A * L P C R W W K L L R R L F Y * K P F Q E L V G G G S * Y G G * F T D S R F S S L SspI | MaeIII | | MboII | | | Tsp4CI* | | | | AciI | | | | BisI | | | | |BlsI BspCNI | | | | |TspRI CviJI |BseMII | | | | ||TauI TaqI \ \\ \ \ \ \ \\\ \ GCTTCAAGTTCAACAGAGAAGAATATTAGTAACAGTGCCGCCACATCGAGTAGCATTTAC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTCAAGTTGTCTCTTCTTATAATCATTGTCACGGCGGTGTAGCTCATCGTAAATG / // / // / //// / CviJI |BseMII SspI || | |||AciI TaqI BspCNI || | ||BisI || | |BlsI || | TauI || Tsp4CI* || MaeIII |TspRI MboII A S S S T E K N I S N S A A T S S S I Y L Q V Q Q R R I L V T V P P H R V A F T F K F N R E E Y * * Q C R H I E * H L L ----:----|----:----|----:----|----:----|----:----|----:----| A E L E V S F F I L L L A A V D L L M * P K L N L L S S Y * Y C H R W M S Y C K S * T * C L L I N T V T G G C R T A N V Hpy178III* TseI AlfI | MmeI |BisI BplI | |BbvI ||BlsI AlfI Tsp4CI* | ||Tsp4CI* ||| FokI BplI | TspRI | ||| MaeIII ||| | MwoI | BseGI \ \ \ \\\ \ \\\ \ \ \ \ TCCAACAGTGCTTCTGTGTCAGGACACGGTGTAACATACGCTGCCGAATACGCCATTACA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGTCACGAAGACACAGTCCTGTGCCACATTGTATGCGACGGCTTATGCGGTAATGT / / / / / / / /// / // / / | Tsp4CI* | | | | | ||| | || | BseGI TspRI | | | | | ||| | || AlfI | | | | | ||| | || AlfI | | | | | ||| | |BplI | | | | | ||| | |BplI | | | | | ||| | FokI | | | | | ||| MwoI | | | | | ||TseI | | | | | |BisI | | | | | BlsI | | | | MaeIII | | | BbvI | | Tsp4CI* | MmeI Hpy178III* S N S A S V S G H G V T Y A A E Y A I T P T V L L C Q D T V * H T L P N T P L H Q Q C F C V R T R C N I R C R I R H Y I ----:----|----:----|----:----|----:----|----:----|----:----| E L L A E T D P C P T V Y A A S Y A M V S W C H K Q T L V R H L M R Q R I R W * G V T S R H * S V T Y C V S G F V G N C BplI Hin6I BplI |GlaI |OliI ||HhaI |MslI ||| Cac8I ||AlfI Hpy188I ||| |MnlI ||AlfI Cac8I TspEI MaeI Hpy178III* \ \\\ \\ \\\ \ \ \ \ TCCGAGCAATCCTCTGCGCTTGCCACATCTGTGCCTGCTACAAATTGCTCTAGTATCGTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTCGTTAGGAGACGCGAACGGTGTAGACACGGACGATGTTTAACGAGATCATAGCAC / /// / / // / / / / Hpy188I ||| | BplI |MslI Cac8I TspEI MaeI Hpy178III* ||| | BplI |OliI ||| Cac8I AlfI ||| MnlI AlfI ||Hin6I |GlaI HhaI S E Q S S A L A T S V P A T N C S S I V P S N P L R L P H L C L L Q I A L V S * R A I L C A C H I C A C Y K L L * Y R E ----:----|----:----|----:----|----:----|----:----|----:----| D S C D E A S A V D T G A V F Q E L I T M R A I R Q A Q W M Q A Q * L N S * Y R G L L G R R K G C R H R S C I A R T D H ApoI TspEI TatI | TaqI |Csp6I BbvII* | | Csp6I BccI ||RsaI | MboII | | |RsaI CviJI DdeI ||ScaI \ \ \ \ \\ \ \ \\\ AAGACCACAACTTTAGAAAATTCGAGTACCACAACCATCACAGCCATTACTAAGAGTACT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGTGTTGAAATCTTTTAAGCTCATGGTGTTGGTAGTGTCGGTAATGATTCTCATGA / / / // // / /// BbvII* | | |Csp6I |BccI | ||TatI MboII | | RsaI CviJI | |Csp6I | TaqI | ScaI TspEI | RsaI ApoI DdeI K T T T L E N S S T T T I T A I T K S T R P Q L * K I R V P Q P S Q P L L R V L D H N F R K F E Y H N H H S H Y * E Y Y ----:----|----:----|----:----|----:----|----:----|----:----| F V V V K S F E L V V V M V A M V L L V S S W L K L F N S Y W L W * L W * * S Y L G C S * F I R T G C G D C G N S L T S TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI |||| |MwoI StyI |||| ||AciI SecI* |||| ||| MaeIII | SetI |||| ||| |BbvI | |CfrI |||| ||| || BinI* | || BalI |||| ||| || | MboI | || CviJI |||| ||| || | XhoII | || HaeIII |||| ||| || | | DpnI | || | MwoI |||| ||| || | | |BstKTI \ \\ \ \ \\\\ \\\ \\ \ \ \\ ACAACCTTGGCCACTACTGCTAACAACTCCACAAGGGCAGCTACCGCAGTAACCATAGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGGAACCGGTGATGACGATTGTTGAGGTGTTCCCGTCGATGGCGTCATTGGTATCTA / // // /// / / // SetI || |MwoI ||CviJI AciI | |DpnI || CfrI ||MwoI | BstKTI |HaeIII ||TseI MaeIII |CviJI ||AluI BinI* |BalI |BisI BbvI SecI* BlsI StyI SetI T T L A T T A N N S T R A A T A V T I D Q P W P L L L T T P Q G Q L P Q * P * I N L G H Y C * Q L H K G S Y R S N H R S ----:----|----:----|----:----|----:----|----:----|----:----| V V K A V V A L L E V L A A V A T V M S * L R P W * Q * C S W L P L * R L L W L C G Q G S S S V V G C P C S G C Y G Y I TsoI DdeI | AsuI* | AluI | AvaII | CviJI | |BmgT120I | |MaeI BspCNI SetI | ||NlaIV | ||SetI |BseMII MmeI \ \\\ \ \\\ \\ \ CCCACATTGGACCCTACCGACAACTCAGCTAGTCCAACCGACAATGCTAAACACACCTCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGTAACCTGGGATGGCTGTTGAGTCGATCAGGTTGGCTGTTACGATTTGTGTGGAGA / / // /// / // / / | TsoI |AvaII ||| | |BseMII | MmeI XhoII |AsuI* ||| | BspCNI SetI MboI BmgT120I ||| MaeI NlaIV ||CviJI ||AluI |DdeI SetI P T L D P T D N S A S P T D N A K H T S P H W T L P T T Q L V Q P T M L N T P L H I G P Y R Q L S * S N R Q C * T H L Y ----:----|----:----|----:----|----:----|----:----|----:----| G V N S G V S L E A L G V S L A L C V E D W M P G * R C S L * D L R C H * V C R G C Q V R G V V * S T W G V I S F V G R MboII |NdeI || MboII || |MnlI || ||MboI || ||XhoII SfaNI || ||| DpnI Hin6I | AluI || ||| |BstKTI |GlaI | CviJI Bce83I* || ||| || BinI* ||HhaI | | SetI | BsrI \\ \\\ \\ \ \\\ \ \ \ \ \ ACATATGGATCTTCTTCCACAGGCGCATCTTTAGATAGCTTACGCACAACCACCAGTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATACCTAGAAGAAGGTGTCCGCGTAGAAATCTATCGAATGCGTGTTGGTGGTCATAA / // // / / /// / / / / | || || | BinI* ||Hin6I | SfaNI | BsrI | || || XhoII |GlaI | CviJI Bce83I* | || || MboI HhaI | AluI | || |DpnI SetI | || BstKTI | |MnlI | |NdeI | MboII MboII T Y G S S S T G A S L D S L R T T T S I H M D L L P Q A H L * I A Y A Q P P V L I W I F F H R R I F R * L T H N H Q Y * ----:----|----:----|----:----|----:----|----:----|----:----| V Y P D E E V P A D K S L K R V V V L I * M H I K K W L R M K L Y S V C L W W Y C I S R R G C A C R * I A * A C G G T N BsmAI | SetI | |CviRI* SmlI BsgI | || BspMI | BsmAI | Tsp4CI* | || | Hpy188I Hpy188I \ \ \ \ \ \\ \ \ \ AGTGTCTCAAGCAACACCACACAGTTAGTCTCTACCTGCACTTCCGAGAGCGATTATTCC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAGAGTTCGTTGTGGTGTGTCAATCAGAGATGGACGTGAAGGCTCTCGCTAATAAGG / / / / / // / / / | BsmAI | Tsp4CI* | || | BspMI Hpy188I SmlI BsgI | || Hpy188I | |CviRI* | BsmAI SetI S V S S N T T Q L V S T C T S E S D Y S V S Q A T P H S * S L P A L P R A I I P C L K Q H H T V S L Y L H F R E R L F R ----:----|----:----|----:----|----:----|----:----|----:----| L T E L L V V C N T E V Q V E S L S * E * H R L C C W V T L R * R C K R S R N N T D * A V G C L * D R G A S G L A I I G MboI MaeI BclI | AluI Hpy188I | CviJI BtsI | DpnI | | SetI | BccI TspRI TspRI | |BstKTI \ \ \ \ \ \ \ \ \\ GATAGTCCTAGCTTCGCCATCTCCACTGCCACCACCACTGAAAGCAATCTGATCACAAAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCAGGATCGAAGCGGTAGAGGTGACGGTGGTGGTGACTTTCGTTAGACTAGTGTTTG /// / / / / // / ||CviJI | BccI TspRI | || BclI ||AluI TspRI | || MboI |MaeI BtsI | |DpnI SetI | BstKTI Hpy188I D S P S F A I S T A T T T E S N L I T N I V L A S P S P L P P P L K A I * S Q T * S * L R H L H C H H H * K Q S D H K H ----:----|----:----|----:----|----:----|----:----|----:----| S L G L K A M E V A V V V S L L R I V F R Y D * S R W R W Q W W W Q F C D S * L I T R A E G D G S G G G S F A I Q D C V TspEI | BbvI | | TspGWI | | | SetI | | | |AciI | | | |MboII | | | || TseI AluI | | | || NspBII* BccI | | | || |BisI SfeI* CviJI Csp6I | | | || ||BlsI | Esp3I | SetI |RsaI | | | || ||| MnlI | BsmAI \ \ \\ \ \ \ \\ \\\ \ \ \ ACCATCACAGCTTCTTGTAGTACGGATAGTAATTTCCCTACCTCCGCTGCTTCTTCTACA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAGTGTCGAAGAACATCATGCCTATCATTAAAGGGATGGAGGCGACGAAGAAGATGT / // // // / / / ///// / | |BccI |Csp6I || | | | ||||MnlI SfeI* | CviJI RsaI || | | | |||TseI | AluI || | | | ||BisI SetI || | | | |BlsI || | | | NspBII* || | | | AciI || | | MboII || | SetI || BbvI |TspGWI TspEI T I T A S C S T D S N F P T S A A S S T P S Q L L V V R I V I S L P P L L L L Q H H S F L * Y G * * F P Y L R C F F Y R ----:----|----:----|----:----|----:----|----:----|----:----| V M V A E Q L V S L L K G V E A A E E V C W * L K K Y Y P Y Y N G * R R Q K K * G D C S R T T R I T I E R G G S S R R C KasI HgiCI* |AcyI |NarI |Hin6I MaeI ||GlaI | Hin4II* ||DinI | | BceAI ||NlaIV CviJI | | | Hpy178III* |||HhaI HaeIII | | | |TaqI PpiI ||||HaeII \ \ \ \ \\ \ \\\\\ GATGAGACGGCCTTCACTAGAACAATCTCGACATCTTGTAGCACTTTGAACGGCGCCTCA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCTGCCGGAAGTGATCTTGTTAGAGCTGTAGAACATCGTGAAACTTGCCGCGGAGT / / // / // / ///// BsmAI HaeIII || | |TaqI PpiI ||||HgiCI* Esp3I CviJI || | Hpy178III* ||||KasI || BceAI |||Hin6I |Hin4II* |||NarI MaeI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII D E T A F T R T I S T S C S T L N G A S M R R P S L E Q S R H L V A L * T A P Q * D G L H * N N L D I L * H F E R R L N ----:----|----:----|----:----|----:----|----:----|----:----| S S V A K V L V I E V D Q L V K F P A E L H S P R * * F L R S M K Y C K S R R R I L R G E S S C D R C R T A S Q V A G * MnlI BceAI BstXI | BsrI Tsp4CI* | BtgZI |TspDTI | | PpiI || MboII | | | AluI || NlaIV | | | CviJI || | AluI | | | TspRI TstI || | CviJI | | | | SetI TsoI || | | SetI \ \ \ \ \ \ \\ \ \ \ ACCCAAACCAGTGAGCTAACCACATCGCCTATGAAAACCAACACGGTGGTTCCAGCTTCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTTTGGTCACTCGATTGGTGTAGCGGATACTTTTGGTTGTGCCACCAAGGTCGAAGA //// // / / / / / // / / / |||| || CviJI | TsoI | | || | | TstI |||| || AluI TstI | | || | CviJI |||| |SetI | | || | AluI |||| BtgZI | | || SetI |||BceAI | | |NlaIV ||PpiI | | MboII |TspRI | Tsp4CI* |BsrI | TspDTI MnlI BstXI T Q T S E L T T S P M K T N T V V P A S P K P V S * P H R L * K P T R W F Q L L P N Q * A N H I A Y E N Q H G G S S F F ----:----|----:----|----:----|----:----|----:----|----:----| V W V L S S V V D G I F V L V T T G A E L G F W H A L W M A * S F W C P P E L K G L G T L * G C R R H F G V R H N W S R XbaI |MaeI TspRI TstI Hin4II* |Hpy178III* BtsI | MaeI \ \ \\ \ \ \ TCTTTCCCTTCAACTACAACCACTTGTCTAGAAAATGATGACACTGCCTTTTCTAGTATC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAGGGAAGTTGATGTTGGTGAACAGATCTTTTACTACTGTGACGGAAAAGATCATAG / // / / / Hin4II* |XbaI TspRI MaeI TspRI | BtsI Hpy178III* MaeI S F P S T T T T C L E N D D T A F S S I L S L Q L Q P L V * K M M T L P F L V S F P F N Y N H L S R K * * H C L F * Y L ----:----|----:----|----:----|----:----|----:----|----:----| E K G E V V V V Q R S F S S V A K E L I K K G K L * L W K D L F H H C Q R K * Y R E R * S C G S T * F I I V S G K R T D Eco57I Eco57MI TspRI | MseI | HindII | | BssKI | Hpy166II | | SecI* | | AciI | | | HpaII NheI | | BisI | | | ScrFI |MaeI | | |BlsI | | | CauII* ||Cac8I | | ||TauI | | | | MboII ||| BmtI \ \ \\\ \ \ \ \ \ \\\ \ TACACTGAAGTCAACGCCGCAACTATCATTAACCCCGGAGAAACATCTTCTCTCGCTAGC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTGACTTCAGTTGCGGCGTTGATAGTAATTGGGGCCTCTTTGTAGAAGAGAGCGATCG / //// / / /// / /// | |||AciI | MseI ||BssKI | ||NheI | ||BisI Eco57MI |SecI* | |MaeI | |BlsI Eco57I |HpaII | Cac8I | TauI |MboII BmtI Hpy166II CauII* HindII ScrFI Y T E V N A A T I I N P G E T S S L A S T L K S T P Q L S L T P E K H L L S L A H * S Q R R N Y H * P R R N I F S R * R ----:----|----:----|----:----|----:----|----:----|----:----| * V S T L A A V I M L G P S V D E R A L R C Q L * R R L * * * G R L F M K E R * V S F D V G C S D N V G S F C R R E S A MwoI SetI | CviJI Hin4II* Hpy188I | | SduI | MboII | CviJI | | HgiJII* | |MnlI \ \ \ \ \ \ \\ GATTTCGCCACATCTGAAAAGCCAAACGAGCCCACTTCTGTCAAATCCACCTCAAACGAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGCGGTGTAGACTTTTCGGTTTGCTCGGGTGAAGACAGTTTAGGTGGAGTTTGCTT / / / / / / / // | | | | CviJI | | |MnlI | | | HgiJII* | | MboII | | | SduI | Hin4II* | | MwoI SetI | CviJI Hpy188I D F A T S E K P N E P T S V K S T S N E I S P H L K S Q T S P L L S N P P Q T K F R H I * K A K R A H F C Q I H L K R R ----:----|----:----|----:----|----:----|----:----|----:----| S K A V D S F G F S G V E T L D V E F S R N R W M Q F A L R A W K Q * I W R L R I E G C R F L W V L G S R D F G G * V F GsuI HgiCI* Eco57MI | NlaIV Ksp632I* | Tsp4CI* | | SetI | MnlI SetI Tsp4CI* | | TspRI CviJI \ \ \ \ \ \ \ \ \ \ \ GGCACCTCTTCCACAACAACAACCTACCAACAGACTGTTGCTACACTGTATGCCAAGCCC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTGGAGAAGGTGTTGTTGTTGGATGGTTGTCTGACAACGATGTGACATACGGTTCGGG / / // / / / / / / | HgiCI* || SetI | | | Tsp4CI* CviJI NlaIV |Ksp632I* | | Eco57MI SetI MnlI | | GsuI | TspRI Tsp4CI* G T S S T T T T Y Q Q T V A T L Y A K P A P L P Q Q Q P T N R L L L H C M P S P H L F H N N N L P T D C C Y T V C Q A L ----:----|----:----|----:----|----:----|----:----|----:----| P V E E V V V V * W C V T A V S Y A L G L C R K W L L L R G V S Q Q * V T H W A A G R G C C C G V L L S N S C Q I G L G MnlI | CviJI | |StyI | |AvrII | |SecI* SetI Tsp4CI* | ||MaeI |CviRI* BsrI | McrI* CviJI \ \\\ \\ \ \ \ \ TCCAGCACAAGCCTAGGTGCAAGAACAACTACTGGTAGCAACGGTCGTTCAACTACCAGC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCGTGTTCGGATCCACGTTCTTGTTGATGACCATCGTTGCCAGCAAGTTGATGGTCG / / /// / / // / | | ||| CviRI* BsrI |McrI* CviJI | | ||SecI* Tsp4CI* | | ||AvrII | | ||StyI | | |MaeI | | SetI | CviJI MnlI S S T S L G A R T T T G S N G R S T T S P A Q A * V Q E Q L L V A T V V Q L P A Q H K P R C K N N Y W * Q R S F N Y Q P ----:----|----:----|----:----|----:----|----:----|----:----| E L V L R P A L V V V P L L P R E V V L R W C L G L H L F L * Q Y C R D N L * W G A C A * T C S C S S T A V T T * S G A FatI |CviAII || CviRI* || NlaIII TaqI || | EcoT22I |MboI || | | CviJI || DpnI || | | | Hin4I || |BstKTI || | | | SfaNI || || MnlI Hin4II* \\ \ \ \ \ \\ \\ \ \ CAACAAGACGGGTCTGCCATGCATCAGCCAACTTCCTCGATCTACACTCAACTAAAAGAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTCTGCCCAGACGGTACGTAGTCGGTTGAAGGAGCTAGATGTGAGTTGATTTTCTT / /// / / / // / / / / | ||| | CviJI | || | MnlI | Hin4I | ||| Hin4I | || MboI Hin4II* | ||CviRI* | |DpnI | ||FatI | BstKTI | |CviAII | TaqI | EcoT22I SfaNI NlaIII Q Q D G S A M H Q P T S S I Y T Q L K E N K T G L P C I S Q L P R S T L N * K K T R R V C H A S A N F L D L H S T K R R ----:----|----:----|----:----|----:----|----:----|----:----| W C S P D A M C * G V E E I * V * S F S G V L R T Q W A D A L K R S R C E V L L L L V P R G H M L W S G R D V S L * F F SetI |TseI BbvI ||BisI |CviRI* |||BlsI BcgI Hin4I AciI BcgI |Hin4II* ||||CviRI* SetI | MnlI \ \ \ \\ \\\\\ \ \ \ GGCACATCAACCACCGCAAAACTTTCTGCATACGAAGGTGCTGCAACACCTCTTTCCATT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTGTAGTTGGTGGCGTTTTGAAAGACGTATGCTTCCACGACGTTGTGGAGAAAGGTAA / / // / / /// / / / | BcgI || | SetI ||| SetI | MnlI AciI || BbvI ||CviRI* BcgI |CviRI* ||TseI Hin4II* |BisI BlsI G T S T T A K L S A Y E G A A T P L S I A H Q P P Q N F L H T K V L Q H L F P F H I N H R K T F C I R R C C N T S F H F ----:----|----:----|----:----|----:----|----:----|----:----| P V D V V A F S E A Y S P A A V G R E M L C M L W R L V K Q M R L H Q L V E K W A C * G G C F K R C V F T S C C R K G N MaeI AciI | AluI BisI AluI CviRI* | CviJI |BlsI CviJI BsrI | TspRI | | SetI ||TauI | SetI \ \ \ \ \ \ \\\ \ \ TTCCAGTGCAATAGTCTAGCTGGAACGATTGCCGCTTTTGTCGTAGCTGTTCTGTTCGCC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTCACGTTATCAGATCGACCTTGCTAACGGCGAAAACAGCATCGACAAGACAAGCGG / / /// //// / / TspRI CviRI* ||CviJI |||AciI | CviJI BsrI ||AluI ||BisI | AluI |MaeI |BlsI SetI SetI TauI F Q C N S L A G T I A A F V V A V L F A S S A I V * L E R L P L L S * L F C S P P V Q * S S W N D C R F C R S C S V R L ----:----|----:----|----:----|----:----|----:----|----:----| K W H L L R A P V I A A K T T A T R N A K G T C Y D L Q F S Q R K Q R L Q E T R E L A I T * S S R N G S K D Y S N Q E G MaeI \ TTCTAG ----:- AAGATC / MaeI F * S X L X ----:- K * R R E L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 18 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AlfI 2 AluI 15 AluBI ApoI 2 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 2 BalI 2 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvCI 1 BbvI 11 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 3 BpuEI BceAI 5 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 2 BglI 1 BinI* 5 AlwI,BspPI,AclWI BisI 18 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 18 BmeT110I 3 BmgT120I 4 BmtI 2 BspOI BplI 4 Bpu10I 2 BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 6 BseRI 1 BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 8 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 6 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrBI 2 AccBSI,MbiI BsrI 6 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 6 BstXI 1 BtgZI 2 BtsI 4 Cac8I 6 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 9 CviQI,RsaNI CviAII 3 CviJI 34 CviKI-1 CviRI* 10 HpyCH4V DdeI 7 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 6 MalI DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 6 EcoP15I 4 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 3 BsmBI FalI 4 FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 10 GsuI 4 BpmI HaeII 5 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 10 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 5 HpyAV Hin6I 10 HinP1I,HspAI HindII 4 HincII HinfI 2 HpaII 3 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 16 Hpy99I 3 KasI 1 Ksp632I* 7 Eam1104I,EarI,Bst6I MaeI 18 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 10 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 20 McrI* 1 BsiEI,BstMCI,Bsh1285I MmeI 5 MnlI 32 MseI 5 Tru1I,Tru9I MslI 4 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 11 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 2 FauNDI NheI 2 AsuNHI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 4 MspA1I NspI 1 BstNSI,XceI OliI 3 AleI PfoI 2 PpiI 1 PshAI 1 BstPAI,BoxI PsiI 2 AanI PspXI 2 PvuII 1 RsaI 9 AfaI SacI 1 Psp124BI,SstI SapI 2 LguI,PciSI,BspQI ScaI 2 BmcAI,AssI,ZrmI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 38 SexAI 1 MabI SfaNI 4 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 6 SmoI SpeI 3 BcuI,AhlI SspI 2 StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 9 TaqII 1 TatI 2 TauI 7 TfiI 2 PfeI TseI 11 ApeKI TsoI 4 Tsp45I 2 NmuCI Tsp4CI* 15 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 13 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XbaI 1 XhoI 3 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AgeI AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII BciVI BetI* BfiI BglII BsaAI BsaBI BsePI BseSI BseYI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspMII* BsrDI BstEII BtrI Cfr10I Cfr9I ClaI CspCI DraII DraIII DrdI Eam1105I EciI Eco31I EcoNI EcoRV EspI* FaqI FseI FspAI GsaI HindIII HpaI KpnI MauBI MfeI MluI MlyI MroNI NaeI NcoI NgoMIV NotI NruI PacI PasI PflMI PleI PmaCI PmeI PpuMI PspOMI PsrI PstI PvuI RsrII SacII SalI SanDI SauI* SchI SfiI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI VspI XcmI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769