Restriction Map of JEM1/YJL073W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

JEM1/YJL073W on chromosome X from coordinates 303181 to 305118.


BsaBI |MboI || DpnI || BciVI || |BstKTI BsrI || ||AvaI | TatI || |||BmeT110I | |Csp6I || ||||Hpy178III* | ||RsaI || ||||| Tsp4CI* | ||ScaI EcoRV \\ \\\\\ \ \ \\\ \ ATGATACTGATCTCGGGATACTGTCTTTTAGTGTATAGCGTTATTTTGCCAGTACTGATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTATGACTAGAGCCCTATGACAGAAAATCACATATCGCAATAAAACGGTCATGACTAT / // / // / / /// / | || | || Tsp4CI* BsrI ||| EcoRV | || | |Hpy178III* ||TatI | || | |AvaI |Csp6I | || | BmeT110I ScaI | || MboI RsaI | |DpnI | BstKTI | BciVI BsaBI M I L I S G Y C L L V Y S V I L P V L I * Y * S R D T V F * C I A L F C Q Y * Y D T D L G I L S F S V * R Y F A S T D I ----:----|----:----|----:----|----:----|----:----|----:----| X I S I E P Y Q R K T Y L T I K G T S I X S V S R P I S D K L T Y R * K A L V S H Y Q D R S V T K * H I A N N Q W Y Q Y ApoI TspEI | MseI | Hin4I | Hin4I CviJI | |AhaIII* CviJI BseMII |DdeI | || AccI | DdeI |BspCNI || MaeIII | || |Hpy166II \ \ \\ \\ \ \ \\ \\ TCGGCTTCTAAGTTATGTGATTTGGCTGAGTTACAACGATTGAACAAGAATTTAAAAGTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCGAAGATTCAATACACTAAACCGACTCAATGTTGCTAACTTGTTCTTAAATTTTCAT / / // / / / / /// / CviJI | |BspCNI | DdeI MaeIII | ||MseI Hpy166II | BseMII CviJI | || TspRI DdeI | |AhaIII* | TspEI | ApoI Hin4I Hin4I S A S K L C D L A E L Q R L N K N L K V R L L S Y V I W L S Y N D * T R I * K * G F * V M * F G * V T T I E Q E F K S R ----:----|----:----|----:----|----:----|----:----|----:----| D A E L N H S K A S N C R N F L F K F T I P K * T I H N P Q T V V I S C S N L L R S R L * T I Q S L * L S Q V L I * F Y MmeI XcmI |Hin4I |Hin4I || MboI || | DpnI Hin4I || | XcmI Hin4I || | |BstKTI | FatI TfiI || | || BseYI | CviRI* HinfI || | || | BinI* | |CviAII | TspRI || | || | |GsaI | || NlaIII \ \ \\ \ \\ \ \\ \ \\ \ GACACTGAATCCTTGCCAAAATACCAATGGATCGCTGGGCAGTTGGAACAAAACTGCATG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGACTTAGGAACGGTTTTATGGTTACCTAGCGACCCGTCAACCTTGTTTTGACGTAC / / / // // // / / / // AccI HinfI | |XcmI || || BinI* Hin4I | |FatI TfiI | MmeI || || BseYI Hin4I | CviAII Hin4I || |GsaI CviRI* Hin4I || MboI NlaIII |DpnI BstKTI XcmI D T E S L P K Y Q W I A G Q L E Q N C M T L N P C Q N T N G S L G S W N K T A * H * I L A K I P M D R W A V G T K L H D ----:----|----:----|----:----|----:----|----:----|----:----| S V S D K G F Y W H I A P C N S C F Q M L C Q I R A L I G I S R Q A T P V F S C V S F G Q W F V L P D S P L Q F L V A H BinI* | AciI | | MboI | | BamHI | | XhoII | | | DpnI Hpy188I | | | NlaIV | MaeII | | | |BstKTI | | SetI | | | ||MwoI Hin4I | | TaiI MaeI | | | ||| BinI* Hin4I | | TspEI | CviJI TsoI \ \ \ \\\ \ \ \ \ \ \ \ \ ACTGCGGATCCAGCAAGTGAAAATATGTCAGACGTAATTCAACTAGCCAATCAAATATAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGCCTAGGTCGTTCACTTTTATACAGTCTGCATTAAGTTGATCGGTTAGTTTATATG / /// / / / / / / / // / | ||| | | Hin4I | | | TspEI |CviJI TsoI | ||| | | Hin4I | | MaeII MaeI | ||| | BinI* | TaiI | ||| XhoII | SetI | ||| BamHI Hpy188I | ||| MboI | ||NlaIV | ||DpnI | |BstKTI | |MwoI | AciI BinI* T A D P A S E N M S D V I Q L A N Q I Y L R I Q Q V K I C Q T * F N * P I K Y T C G S S K * K Y V R R N S T S Q S N I L ----:----|----:----|----:----|----:----|----:----|----:----| V A S G A L S F I D S T I * S A L * I Y S Q P D L L H F Y T L R L E V L W D F I S R I W C T F I H * V Y N L * G I L Y V TspEI | BinI* | | CviJI MboI AluI | | | MboI | DpnI CviJI | | | | DpnI | |BstKTI | SetI | | | | |BstKTI | || BsaBI | | MseI | | | | || TspEI | || | DdeI | | MmeI \ \ \ \ \\ \ \ \\ \ \ \ \ \ TACAAAATTGGGCTGATCCAATTATCCAACGATCAACATCTAAGAGCTATTAACACATTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTTAACCCGACTAGGTTAATAGGTTGCTAGTTGTAGATTCTCGATAATTGTGTAAA // / // / / // // // / / / || | || MboI TspEI || |BsaBI || | | MseI || | |DpnI || MboI || | MmeI || | BstKTI |DpnI || CviJI || CviJI BstKTI || AluI |BinI* |SetI TspEI DdeI Y K I G L I Q L S N D Q H L R A I N T F T K L G * S N Y P T I N I * E L L T H L Q N W A D P I I Q R S T S K S Y * H I * ----:----|----:----|----:----|----:----|----:----|----:----| * L I P S I W N D L S * C R L A I L V N S C F Q A S G I I W R D V D L L * * C M V F N P Q D L * G V I L M * S S N V C K AluI CviJI | SetI | Cac8I TspDTI | | AciI MseI |SetI | | |MnlI CviJI \ \\ \ \ \\ \ GAAAAAATCGTTTTTAATGAAACTTACAAAGGTTCTTTTGGGAAGCTGGCGGAAAAGAGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTTAGCAAAAATTACTTTGAATGTTTCCAAGAAAACCCTTCGACCGCCTTTTCTCC / // / / / / / / MseI |TspDTI | | | | AciI CviJI SetI | | | MnlI | | Cac8I | CviJI | AluI SetI E K I V F N E T Y K G S F G K L A E K R K K S F L M K L T K V L L G S W R K R G K N R F * * N L Q R F F W E A G G K E A ----:----|----:----|----:----|----:----|----:----|----:----| S F I T K L S V * L P E K P F S A S F L Q F F R K * H F K C L N K Q S A P P F S F F D N K I F S V F T R K P L Q R F L P FokI | SetI | |CviRI* | |Hin4II* | || BslFI | || |Hpy188I | || || SfaNI EciI | || || | MboI | MwoI | || || | BclI | | AluI | || || | | DpnI | | CviJI | || || | | |BseGI | | | SetI TaqI BseGI | || || | | |BstKTI \ \ \ \ \ \ \ \\ \\ \ \ \\ CTACAAGAGCTGTATGTCGATTTTGGGATGTGGGACAAGGTGCATCAGAAGGATGATCAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTTCTCGACATACAGCTAAAACCCTACACCCTGTTCCACGTAGTCTTCCTACTAGTC // / / / / / /// / / // / || | CviJI TaqI BseGI | ||| | | || BclI || | AluI | ||| | | || MboI || SetI | ||| | | |DpnI |MwoI | ||| | | BstKTI EciI | ||| | | SfaNI | ||| | | BseGI | ||| | BslFI | ||| Hpy188I | ||FokI | |CviRI* | Hin4II* SetI L Q E L Y V D F G M W D K V H Q K D D Q Y K S C M S I L G C G T R C I R R M I S T R A V C R F W D V G Q G A S E G * S V ----:----|----:----|----:----|----:----|----:----|----:----| S C S S Y T S K P I H S L T C * F S S * A V L A T H R N Q S T P C P A D S P H D * L L Q I D I K P H P V L H M L L I I L FokI MaeII |Hpy188I | SetI || BccI | TaiI FokI || |TspDTI BseGI | |MnlI \ \\ \\ \ \ \\ TATGCGAAATATCTGTCCTTGAATGAAACCATCAGAAACAAAATATCATCCAAAGACGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGCTTTATAGACAGGAACTTACTTTGGTAGTCTTTGTTTTATAGTAGGTTTCTGCAA / / /// / / // FokI | ||BccI BseGI | |MnlI | |FokI | MaeII | TspDTI TaiI Hpy188I SetI Y A K Y L S L N E T I R N K I S S K D V M R N I C P * M K P S E T K Y H P K T F C E I S V L E * N H Q K Q N I I Q R R F ----:----|----:----|----:----|----:----|----:----|----:----| Y A F Y R D K F S V M L F L I D D L S T T H S I D T R S H F W * F C F I M W L R I R F I Q G Q I F G D S V F Y * G F V N DdeI |Hpy188I ||MboII ||| TseI MseI ||| AluI |HpaI ||| BceAI |HindII ||| CviJI SplI* |Hpy166II BbvI ||| |BisI |Csp6I || MaeII BseMII ||| ||BlsI ||RsaI || | SetI |BspCNI ||| ||SetI ||BsaXI || | TaiI \\ \\\ \\\ \\\ \\ \ \ TCTGTGGAGGAAGATATTTCTGAGCTGCTACGCATAACGCCGTACGATGTTAACGTCCTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGACACCTCCTTCTATAAAGACTCGACGATGCGTATTGCGGCATGCTACAATTGCAGGAG // / //////// / /// // / || BbvI |||||||TseI | ||SplI* || MaeII |BspCNI ||||||BceAI | |Csp6I |MseI BseMII ||||||BisI | RsaI |TaiI |||||BlsI BsaXI |SetI ||||CviJI Hpy166II ||||AluI HindII |||DdeI HpaI ||SetI |MboII Hpy188I S V E E D I S E L L R I T P Y D V N V L L W R K I F L S C Y A * R R T M L T S S C G G R Y F * A A T H N A V R C * R P L ----:----|----:----|----:----|----:----|----:----|----:----| E T S S S I E S S S R M V G Y S T L T R K Q P P L Y K Q A A V C L A T R H * R G R H L F I N R L Q * A Y R R V I N V D E Eco57I TspEI Eco57MI | BbvI | TseI MnlI MaeI | | MaeII | AluI | TaqI EcoP15I | | |BbvI | CviJI | ClaI | AluI | | ||MboII | |BisI | MslI | CviJI | | |||SetI | ||BlsI | | BsaXI | | SetI | | |||TaiI | ||SetI \ \ \ \ \ \ \ \ \\\\ \ \\\ TCCACGCACATCGATGTTCTTTTTCACAAACTAGCTGAAGAAATTGACGTTTCGTTAGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGCGTGTAGCTACAAGAAAAAGTGTTTGATCGACTTCTTTAACTGCAAAGCAATCGA / // / /// // // / / / /// | || ClaI ||CviJI || || | | | ||BisI | || TaqI ||AluI || || | | | |BlsI | |MslI |EcoP15I || || | | | CviJI | BsaXI |MaeI || || | | | AluI MnlI SetI || || | | SetI || || | Eco57MI || || | Eco57I || || BbvI || |MaeII || |BbvI || MboII |TaiI |SetI TspEI S T H I D V L F H K L A E E I D V S L A P R T S M F F F T N * L K K L T F R * L H A H R C S F S Q T S * R N * R F V S C ----:----|----:----|----:----|----:----|----:----|----:----| E V C M S T R K * L S A S S I S T E N A R W A C R H E K E C V L Q L F Q R K T L G R V D I N K K V F * S F F N V N R * S NheI CviJI |MaeI ||Cac8I ||| AluI ||| BmtI ||| CviJI ||| |SmlI TseI ||| |AflII |BisI TaqI ||| ||MseI ||BlsI | TsoI MnlI ||| ||SetI \\\ \ \ \ \\\ \\\ GCTGCTATCATTTTGGATTACGAAACAATCCTCGACAAGCATTTGGCTAGCTTAAGCATA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGATAGTAAAACCTAATGCTTTGTTAGGAGCTGTTCGTAAACCGATCGAATTCGTAT //// / / / / /// // |||TseI | TaqI MnlI | ||| |AflII ||BisI TsoI | ||| |SmlI |BlsI | ||| MseI TseI | ||CviJI | ||NheI | ||AluI | |MaeI | Cac8I | SetI CviJI BmtI A A I I L D Y E T I L D K H L A S L S I L L S F W I T K Q S S T S I W L A * A * C Y H F G L R N N P R Q A F G * L K H R ----:----|----:----|----:----|----:----|----:----|----:----| A A I M K S * S V I R S L C K A L K L M Q Q * * K P N R F L G R C A N P * S L C S S D N Q I V F C D E V L M Q S A * A Y SetI | TatI | |Csp6I | ||RsaI | |||SfaNI TspDTI | |||| HgaI | TaqI | |||| MseI | | TfiI | |||| | DdeI | | HinfI | |||| | | Hpy188I \ \ \ \ \\\\ \ \ \ GATACAAGACTTTCGATTCATTATGTCATATCTGTTTTACAGACCTTTGTACTTAACTCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGTTCTGAAAGCTAAGTAATACAGTATAGACAAAATGTCTGGAAACATGAATTGAGT / / / / /// / /// TspDTI | HinfI SetI ||| | ||DdeI | TfiI ||| | |Hpy188I TaqI ||| | HgaI ||| SfaNI ||| MseI ||TatI |Csp6I RsaI D T R L S I H Y V I S V L Q T F V L N S I Q D F R F I M S Y L F Y R P L Y L T Q Y K T F D S L C H I C F T D L C T * L R ----:----|----:----|----:----|----:----|----:----|----:----| S V L S E I * * T M D T K C V K T S L E L Y L V K S E N H * I Q K V S R Q V * S I C S K R N M I D Y R N * L G K Y K V * Hpy99I |BspCNI MslI ||BseMII | BstXI \\\ \ \ GATGCGTCGTTCAATATAAGAAAATGCCTTTCCATTGATATGGACTATGATAAATGTAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGCAGCAAGTTATATTCTTTTACGGAAAGGTAACTATACCTGATACTATTTACATTT / // / / | |BseMII | MslI | BspCNI BstXI Hpy99I D A S F N I R K C L S I D M D Y D K C K M R R S I * E N A F P L I W T M I N V K C V V Q Y K K M P F H * Y G L * * M * K ----:----|----:----|----:----|----:----|----:----|----:----| S A D N L I L F H R E M S I S * S L H L L H T T * Y L F I G K W Q Y P S H Y I Y I R R E I Y S F A K G N I H V I I F T F HphI Hin4I Hin4I | BccI | BinI* | | MboI | | XhoII | | | DpnI | | | BinI* | | | |PfoI | | | |BssKI | | | |EcoRII | | | |BstKTI | | | ||AlwNI | | | |||ScrFI | | | |||BseBI SetI | | | |||| MboI DdeI |TfiI | | | |||| BamHI | CviJI TspEI |HinfI | | | |||| XhoII \ \ \ \\ \ \ \ \\\\ \ AAACTAAGCCTGACTATTTCCAAATTGAACAAGGTGAATCCATCAAAAAGACAGATCCTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATTCGGACTGATAAAGGTTTAACTTGTTCCACTTAGGTAGTTTTTCTGTCTAGGAC // / / // / / //// / |CviJI | SetI || HphI | |||| BseBI DdeI TspEI |Hin4I | |||| ScrFI |Hin4I | |||XhoII HinfI | |||MboI TfiI | ||BinI* | |DpnI | BstKTI | AlwNI BinI* BccI K L S L T I S K L N K V N P S K R Q I L N * A * L F P N * T R * I H Q K D R S W T K P D Y F Q I E Q G E S I K K T D P G ----:----|----:----|----:----|----:----|----:----|----:----| F S L R V I E L N F L T F G D F L C I R F V L G S * K W I S C P S D M L F V S G F * A Q S N G F Q V L H I W * F S L D Q DpnI NlaIV |BstKTI || BinI* || | NdeI || | |MwoI || | |BstAPI || | || CviRI* || | || |Hin4I || | || |Hin4I ApoI || | || ||EcoT22I TspEI TspEI \\ \ \\ \\\ \ \ GATCCAGCAACATATGCATTTGAGAACAAAAAGTTTAGAAGTTGGGATAGAATTATTGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGTCGTTGTATACGTAAACTCTTGTTTTTCAAATCTTCAACCCTATCTTAATAACTT // / // / / / / || | || | | CviRI* TspEI || | || | EcoT22I || | || | NdeI || | || Hin4I || | || Hin4I || | |BstAPI || | |MwoI || | BinI* || XhoII || BamHI || MboI |NlaIV |DpnI EcoRII BstKTI BssKI PfoI D P A T Y A F E N K K F R S W D R I I E I Q Q H M H L R T K S L E V G I E L L N S S N I C I * E Q K V * K L G * N Y * I ----:----|----:----|----:----|----:----|----:----|----:----| S G A V Y A N S F L F N L L Q S L I I S P D L L M H M Q S C F T * F N P Y F * Q I W C C I C K L V F L K S T P I S N N F ApoI Hin4II* CviJI TspEI MseI TspDTI \ \ \ \ \ TTTTATTTGAAGGATAAGAAGCCATTTATTACACCAATGAAAATTCTTAACAAAGATACA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATAAACTTCCTATTCTTCGGTAAATAATGTGGTTACTTTTAAGAATTGTTTCTATGT / / / // Hin4II* CviJI | |TspDTI TspEI | MseI ApoI TspEI ApoI F Y L K D K K P F I T P M K I L N K D T F I * R I R S H L L H Q * K F L T K I Q L F E G * E A I Y Y T N E N S * Q R Y K ----:----|----:----|----:----|----:----|----:----|----:----| N * K F S L F G N I V G I F I R L L S V I K N S P Y S A M * * V L S F E * C L Y K I Q L I L L W K N C W H F N K V F I C XmnI MaeII | SetI MseI MfeI | TaiI |AhaIII* MnlI TspEI TspEI | BbvII* \\ \ \ \ \ \ AACTTTAAAAACAACTACTTCTTTTTAGAGGAAATTATCAAACAATTGATAGAAGACGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAATTTTTGTTGATGAAGAAAAATCTCCTTTAATAGTTTGTTAACTATCTTCTGCAA // / / / // / |MseI MnlI TspEI TspEI || MaeII AhaIII* MfeI |XmnI TaiI SetI N F K N N Y F F L E E I I K Q L I E D V T L K T T T S F * R K L S N N * * K T F L * K Q L L L F R G N Y Q T I D R R R S ----:----|----:----|----:----|----:----|----:----|----:----| F K L F L * K K K S S I I L C N I S S T L S * F C S S R K L P F * * V I S L L R V K F V V V E K * L F N D F L Q Y F V N BsmAI BinI* Eco31I |TaqI |MboII |AsuII ||Tsp4CI* || MboI ||| TaqI || XhoII ||| |Hpy178III* ApoI || | DpnI BccI ||| || SetI TspEI || | |BstKTI MboII \\\ \\ \ \ \\ \ \\ \ CAACTGTCGAGACCTTTGGCAAAAAATTTATTCGAAGATCCCCCAATAACCGATGGTTTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACAGCTCTGGAAACCGTTTTTTAAATAAGCTTCTAGGGGGTTATTGGCTACCAAAA // / /// / / / // / / / || | ||SetI | | | || | | BccI || | |Hpy178III* | | | || | MboII || | TaqI | | | || XhoII || Eco31I | | | || MboI || BsmAI | | | |DpnI |Tsp4CI* | | | BstKTI BbvII* | | AsuII MboII | | TaqI | BinI* TspEI ApoI Q L S R P L A K N L F E D P P I T D G F N C R D L W Q K I Y S K I P Q * P M V L T V E T F G K K F I R R S P N N R W F C ----:----|----:----|----:----|----:----|----:----|----:----| * S D L G K A F F K N S S G G I V S P K E V T S V K P L F N I R L D G L L R H N L Q R S R Q C F I * E F I G W Y G I T K MaeI | AccI | |BssNAI | |Hpy166II | || TfiI | || HinfI \ \\ \ GTCAAACCAAAATCATACTATCATACCGATTATCTAGTATACATTGATTCCATTCTTTGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTGGTTTTAGTATGATAGTATGGCTAATAGATCATATGTAACTAAGGTAAGAAACA / // / | |AccI HinfI | Hpy166II TfiI | BssNAI MaeI V K P K S Y Y H T D Y L V Y I D S I L C S N Q N H T I I P I I * Y T L I P F F V Q T K I I L S Y R L S S I H * F H S L S ----:----|----:----|----:----|----:----|----:----|----:----| T L G F D Y * * V S * R T Y M S E M R Q Q * V L I M S D Y R N D L I C Q N W E K D F W F * V I M G I I * Y V N I G N K T CviJI | MaeI | | FatI | | |CviAII | | || HinfI | | || NlaIII | | || | BetI* | | || | BspMII* | | || | |HpaII | | || | |Hpy178III* | | || | || AcyI | | || | || PleI | | || | || MaeII | | || | || |ZraI | | || | || |MlyI | | || | || || SetI | | || | || || TaiI | | || | || || AatII | | || | || || |Hpy178III* | | || | || || || BbvI | | || | || || || | BceAI | | || | || || || | |AluI | | || | || || || | |CviJI | | || | || || || | || SetI | | || | || || || | || | MwoI | | || | || || || | || | | TseI | | || | || || || | || | | CviJI | | || | || || || | || | | |BisI | | || | || || || | || | | |BsrI | | || | || || || | || | | ||BlsI | | || | || || || | || | | |||Hin6I | | || | || || || | || | | ||||GlaI | | || | || || || | || | | |||||HhaI \ \ \\ \ \\ \\ \\ \ \\ \ \ \\\\\\ CAGGCTTCTAGCATGAGTCCGGACGTCAAGAGAGCTAAACTGGCTGCGCCGTTCTGTAAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCGAAGATCGTACTCAGGCCTGCAGTTCTCTCGATTTGACCGACGCGGCAAGACATTT / // // / // // / / // / /////// CviJI || || | || || | | || MwoI ||||||Hin6I || || | || || | | |BceAI |||||GlaI || || | || || | | CviJI ||||TseI || || | || || | | AluI ||||HhaI || || | || || | | BbvI |||BisI || || | || || | SetI ||BlsI || || | || || Hpy178III* |CviJI || || | || |MaeII BsrI || || | || |AcyI || || | || PleI || || | || MlyI || || | || ZraI || || | |BspMII* || || | |BetI* || || | |AatII || || | |TaiI || || | |SetI || || | Hpy178III* || || | HpaII || || HinfI || |FatI || CviAII |NlaIII MaeI Q A S S M S P D V K R A K L A A P F C K R L L A * V R T S R E L N W L R R S V K G F * H E S G R Q E S * T G C A V L * K ----:----|----:----|----:----|----:----|----:----|----:----| * A E L M L G S T L L A L S A A G N Q L D P K * C S D P R * S L * V P Q A T R Y L S R A H T R V D L S S F Q S R R E T F FatI |CviAII || NlaIII || | SfaNI Hpy178III* || | |Hin4I | DdeI MnlI BsmI MaeI || | |Hin4I | |BseGI Hpy188I \ \ \ \\ \ \\ \ \\ \ AAGAGTTTGAGGCATTCACTAACACTAGAAACATGGAAACACTATCAGGATGCTAAGTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCAAACTCCGTAAGTGATTGTGATCTTTGTACCTTTGTGATAGTCCTACGATTCAGG / / / / // / / / / / MnlI BsmI | | |Hin4I | | | | Hpy188I | | |Hin4I | | | DdeI | | |FatI | | BseGI | | CviAII | Hpy178III* | NlaIII SfaNI MaeI K S L R H S L T L E T W K H Y Q D A K S R V * G I H * H * K H G N T I R M L S P E F E A F T N T R N M E T L S G C * V R ----:----|----:----|----:----|----:----|----:----|----:----| F L K L C E S V S S V H F C * * S A L D F S N S A N V L V L F M S V S D P H * T L T Q P M * * C * F C P F V I L I S L G BseMII |BspCNI || SetI || Hin4I || Hin4I || |Esp3I || |BsmAI ApoI || || DdeI TspEI FokI || || |SetI Tsp4CI* EcoRI \ \\ \\ \\ \ \ GAGCAAAAACCTTTACCTGAGACGGTATTGAGTGATGTATGGAATTCCAATCCTCATTTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTTTTGGAAATGGACTCTGCCATAACTCACTACATACCTTAAGGTTAGGAGTAAAC //// / / / / / |||SetI | | | Tsp4CI* EcoRI ||BspCNI | | DdeI TspEI ||Hin4I | BsmAI ApoI ||Hin4I | Esp3I |BseMII SetI FokI E Q K P L P E T V L S D V W N S N P H L S K N L Y L R R Y * V M Y G I P I L I C A K T F T * D G I E * C M E F Q S S F A ----:----|----:----|----:----|----:----|----:----|----:----| S C F G K G S V T N L S T H F E L G * K R A F V K V Q S P I S H H I S N W D E N L L F R * R L R Y Q T I Y P I G I R M Q MnlI MnlI Hpy166II MseI SetI SetI Tsp4CI* \ \ \ \ \ \ CTGATGTATATGGTAAACTCAATACTTAATAAAAGTAGGTCTAAACCTCATTCACAGTTC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GACTACATATACCATTTGAGTTATGAATTATTTTCATCCAGATTTGGAGTAAGTGTCAAG / / / / / / MnlI Hpy166II MseI SetI SetI Tsp4CI* MnlI L M Y M V N S I L N K S R S K P H S Q F * C I W * T Q Y L I K V G L N L I H S S D V Y G K L N T * * K * V * T S F T V Q ----:----|----:----|----:----|----:----|----:----|----:----| S I Y I T F E I S L L L L D L G * E C N A S T Y P L S L V * Y F Y T * V E N V T Q H I H Y V * Y K I F T P R F R M * L E CviJI HaeIII | DdeI | | Hpy188I | | |HinfI | | || SalI | | || |TaqI | | || |AccI | | || |MnlI | | || ||HindII ApoI | | || ||Hpy166II TspEI TspEI | | || |||BceAI \ \ \ \ \\ \\\\ AAAAAGCAATTATATGACCAGATAAACAAATTTTTCCAAGATAACGGCCTCTCAGAGTCG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCGTTAATATACTGGTCTATTTGTTTAAAAAGGTTCTATTGCCGGAGAGTCTCAGC / / / // //// TspEI TspEI | || |||AccI ApoI | || |||TaqI | || ||Hpy166II | || ||HindII | || |HinfI | || MnlI | |DdeI | Hpy188I HaeIII CviJI K K Q L Y D Q I N K F F Q D N G L S E S K S N Y M T R * T N F S K I T A S Q S R K A I I * P D K Q I F P R * R P L R V D ----:----|----:----|----:----|----:----|----:----|----:----| L F C N Y S W I F L N K W S L P R E S D * F A I I H G S L C I K G L Y R G R L T F L L * I V L Y V F K E L I V A E * L R PleI |MlyI |BspCNI ||BseMII ||| MaeII ||| |BsaAI Hpy188I ||| || SetI | MboII BcgI ||| || TaiI XmnI | |TspDTI TspEI | SetI \\\ \\ \ \ \ \\ \ \ \ ACCAATCCATACGTGATGAAGAACTTCCGATTATTACAGAAACAATTACAAACCTATAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTAGGTATGCACTACTTCTTGAAGGCTAATAATGTCTTTGTTAATGTTTGGATATTT //// / // / / / / // |||PleI | |MaeII XmnI | TspDTI | |SetI |||MlyI | BsaAI | MboII | BcgI ||BseMII TaiI Hpy188I TspEI |BspCNI SetI |BceAI SalI T N P Y V M K N F R L L Q K Q L Q T Y K P I H T * * R T S D Y Y R N N Y K P I K Q S I R D E E L P I I T E T I T N L * R ----:----|----:----|----:----|----:----|----:----|----:----| V L G Y T I F F K R N N C F C N C V * L S W D M R S S S S G I I V S V I V F R Y G I W V H H L V E S * * L F L * L G I F Hpy188I TseI |ApoI |BisI |TspEI BcgI SspI ||BlsI MmeI \\ \ \ \\\ \ GAGCATAAACATCGGAATTTCAACCAGCAATATTTCCAACAACAACAACAGCAGCAACAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTATTTGTAGCCTTAAAGTTGGTCGTTATAAAGGTTGTTGTTGTTGTCGTCGTTGTT / / / / /// / | | BcgI SspI ||| MmeI | TspEI ||TseI | ApoI |BisI Hpy188I BlsI E H K H R N F N Q Q Y F Q Q Q Q Q Q Q Q S I N I G I S T S N I S N N N N S S N N A * T S E F Q P A I F P T T T T A A T T ----:----|----:----|----:----|----:----|----:----|----:----| S C L C R F K L W C Y K W C C C C C C C L A Y V D S N * G A I N G V V V V A A V L M F M P I E V L L I E L L L L L L L L EcoP15I | BseYI | |MwoI | || TseI | || GsaI | || |BisI | || ||BlsI | || |||Hin6I | || ||||GlaI BsiYI* | || |||||HhaI | EcoP15I BbvI | || ||||||HaeII BbvI | | PsiI \ \ \\ \\\\\\\ \ \ \ \ CACCAACGACATCAAGCACCCCCAGCAGCGCCTAACTACGACCCAAAAAAGGACTATTAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTTGCTGTAGTTCGTGGGGGTCGTCGCGGATTGATGCTGGGTTTTTTCCTGATAATA / / / ////// / / / / BbvI | | |||||Hin6I | BsiYI* | PsiI | | ||||GlaI BbvI EcoP15I | | |||TseI | | |||HhaI | | ||HaeII | | ||BisI | | |BlsI | | BseYI | EcoP15I | GsaI MwoI H Q R H Q A P P A A P N Y D P K K D Y Y T N D I K H P Q Q R L T T T Q K R T I I P T T S S T P S S A * L R P K K G L L * ----:----|----:----|----:----|----:----|----:----|----:----| C W R C * A G G A A G L * S G F F S * * V G V V D L V G L L A * S R G L F P S N V L S M L C G W C R R V V V W F L V I I MseI |SwaI |AhaIII* ApoI TaqI ||ApoI TspEI MaeI MaeI AsuII ||TspEI \ \ \ \ \\\ AAAATTCTTGGAGTATCGCCTAGTGCTAGTTCGAAAGAAATAAGGAAAGCATATTTAAAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAGAACCTCATAGCGGATCACGATCAAGCTTTCTTTATTCCTTTCGTATAAATTTA / / / / // TspEI MaeI MaeI AsuII |MseI ApoI TaqI AhaIII* SwaI K I L G V S P S A S S K E I R K A Y L N K F L E Y R L V L V R K K * G K H I * I N S W S I A * C * F E R N K E S I F K F ----:----|----:----|----:----|----:----|----:----|----:----| L I R P T D G L A L E F S I L F A Y K F Y F E Q L I A * H * N S L F L S L M N L F N K S Y R R T S T R F F Y P F C I * I TfiI TaqII HinfI | CviJI | XmnI MseI TsoI | HaeIII | TspEI \ \ \ \ \ \ TTAACCAAAAAATACCACCCAGACAAAATAAAGGCCAACCATAACGACAAACAAGAATCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGGTTTTTTATGGTGGGTCTGTTTTATTTCCGGTTGGTATTGCTGTTTGTTCTTAGT / / / / / // | MseI TsoI | HaeIII |XmnI TspEI | CviJI HinfI ApoI TaqII TfiI L T K K Y H P D K I K A N H N D K Q E S * P K N T T Q T K * R P T I T T N K N Q N Q K I P P R Q N K G Q P * R Q T R I N ----:----|----:----|----:----|----:----|----:----|----:----| K V L F Y W G S L I F A L W L S L C S D N L W F I G G L C F L P W G Y R C V L I * G F F V V W V F Y L G V M V V F L F * Hpy178III* SplI* | MaeIII |Csp6I TspDTI | Tsp45I ||RsaI | MseI Hin4II* \ \ \\\ \ \ \ ATTCACGAAACTATGTCACAAATCAATGAAGCGTACGAAACATTAAGTGATGACGATAAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTGCTTTGATACAGTGTTTAGTTACTTCGCATGCTTTGTAATTCACTACTGCTATTT / / / /// / / / | Hpy178III* Tsp45I ||| | MseI Hin4II* TspEI MaeIII ||| TspDTI ||SplI* |Csp6I RsaI I H E T M S Q I N E A Y E T L S D D D K F T K L C H K S M K R T K H * V M T I K S R N Y V T N Q * S V R N I K * * R * K ----:----|----:----|----:----|----:----|----:----|----:----| I * S V I D C I L S A Y S V N L S S S L L E R F * T V F * H L T R F M L H H R Y N V F S H * L D I F R V F C * T I V I F DdeI SauI* | AsuI* | DraII | |NlaIV | |BmgT120I MboI | ||CviJI | DpnI AciI | ||HaeIII | |BstKTI | AciI | |||StyI | || Hpy178III* | BisI | |||AvrII | || | MboI | |BlsI | |||SecI* | || | | DpnI | ||TauI | ||||MaeI | || | | |BstKTI | ||| FauI | ||||MnlI \ \\ \ \ \\ \ \\\ \ \ \\\\\ AGGAAGGAATACGATCTTTCCAGATCAAACCCCCGCCGCAACACTTTTCCTCAGGGGCCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTCCTTATGCTAGAAAGGTCTAGTTTGGGGGCGGCGTTGTGAAAAGGAGTCCCCGGA // / /// / //// / / /// || MboI ||| MboI |||| FauI | ||DraII |DpnI ||DpnI |||AciI | ||AsuI* BstKTI |BstKTI ||BisI | ||MnlI Hpy178III* |BlsI | |BmgT120I AciI | |HaeIII TauI | |CviJI | NlaIV SauI* DdeI R K E Y D L S R S N P R R N T F P Q G P G R N T I F P D Q T P A A T L F L R G L E G I R S F Q I K P P P Q H F S S G A * ----:----|----:----|----:----|----:----|----:----|----:----| L F S Y S R E L D F G R R L V K G * P G F S P I R D K W I L G G G C C K E E P A P L F V I K G S * V G A A V S K R L P R PfoI BssKI FatI EcoRII AflIII | ScrFI BspLU11I* | BseBI Hpy188I |CviAII | | PflMI | CviJI BspCNI || NspI | | BsiYI* | | MseI |BseMII || NlaIII | | | CviJI | | |AhaIII* \\ \\ \ \ \ \ \ \ \ \\ AGGCAAAATAACATGTTCAAAAATCCAGGAAGTGGCTTCCCATTCGGAAATGGCTTTAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTTTTATTGTACAAGTTTTTAGGTCCTTCACCGAAGGGTAAGCCTTTACCGAAATTT // / // /// / / / // |BseMII | |BspLU11I* ||| CviJI Hpy188I | |MseI |SecI* | |AflIII ||EcoRII | AhaIII* |AvrII | |FatI ||BssKI CviJI |StyI | CviAII ||PfoI BspCNI NlaIII |BsiYI* MaeI NspI |PflMI BseBI ScrFI R Q N N M F K N P G S G F P F G N G F K G K I T C S K I Q E V A S H S E M A L K A K * H V Q K S R K W L P I R K W L * N ----:----|----:----|----:----|----:----|----:----|----:----| L C F L M N L F G P L P K G N P F P K L * A F Y C T * F D L F H S G M R F H S * P L I V H E F I W S T A E W E S I A K F ApoI CviJI TspEI | TspDTI \ \ \ ATGAATTTTGGGCTTTGA 1930 ----:----|----:--- TACTTAAAACCCGAAACT / / / | | TspDTI | CviJI TspEI ApoI M N F G L * * I L G F X E F W A L X ----:----|----:--- I F K P S Q F S N Q A K H I K P K S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 4 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 4 DraI AluI 8 AluBI AlwNI 1 CaiI ApoI 10 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvrII 1 AspA2I,BlnI,XmaJI BamHI 2 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 3 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BinI* 8 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmeT110I 1 BmgT120I 1 BmtI 1 BspOI BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 6 BseYI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 6 BspLU11I* 1 PscI,PciI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 11 BstXI 1 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 24 CviKI-1 CviRI* 3 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 11 MalI DraII 1 EcoO109I EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoP15I 3 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 4 FauI 1 SmuI FokI 4 GlaI 2 GsaI 2 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 2 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HinfI 7 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 10 Hpy99I 1 MaeI 9 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 2 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 1 MunI MlyI 2 SchI MmeI 3 MnlI 10 MseI 13 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 2 PleI 2 PpsI PsiI 1 AanI RsaI 4 AfaI SalI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 25 SfaNI 3 LweI SmlI 1 SmoI SplI* 2 Pfl23II,PspLI,BsiWI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 7 TaqI 8 TaqII 1 TatI 2 TauI 1 TfiI 5 PfeI TseI 6 ApeKI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 21 TasI,Tsp509I,Sse9I TspRI 1 TscAI XcmI 2 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaII BaeI BalI BarI BbvCI Bce83I* BdaI BfiI BglI BglII BplI Bpu10I BsePI BseRI BseSI BsgI BsiI* Bsp120I Bsp1407I BspHI BspMI BsrBI BsrDI BstEII BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EgeI EheI EspI* FalI FnuDII* FseI FspAI GsuI HgiAI* HgiCI* HgiJII* HindIII KasI KpnI Ksp632I* MauBI McrI* MluI MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NspBII* OliI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SrfI Sse232I* Sse8387I StuI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769