Restriction Map of TDH1/YJL052W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TDH1/YJL052W on chromosome X from coordinates 338271 to 339269.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.6488

BcgI MboI BclI | DpnI | |BstKTI SmlI | || Hpy188I TfiI Hpy178III* | || |TspEI MseI Tsp4CI* HinfI | CviJI \ \\ \\ \ \ \ \ \ ATGATCAGAATTGCTATTAACGGTTTCGGTAGAATCGGTAGATTGGTCTTGAGATTGGCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAGTCTTAACGATAATTGCCAAAGCCATCTTAGCCATCTAACCAGAACTCTAACCGA // / / / / / / / / || | TspEI | Tsp4CI* HinfI | SmlI CviJI || Hpy188I MseI TfiI Hpy178III* || BclI || MboI |DpnI BstKTI M I R I A I N G F G R I G R L V L R L A * S E L L L T V S V E S V D W S * D W L D Q N C Y * R F R * N R * I G L E I G F ----:----|----:----|----:----|----:----|----:----|----:----| X I L I A I L P K P L I P L N T K L N A X S * F Q * * R N R Y F R Y I P R S I P H D S N S N V T E T S D T S Q D Q S Q S BinI* | HindII | Hpy166II | | MboI CviRI* | | | DpnI | Bce83I* | | | |BstKTI | | MnlI SetI | | | || BcgI BbvI \ \ \ \ \ \ \ \\ \ \ TTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGATCCATTTATCTCTAACGATTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTCTTTTCTGTAACTCCAACAACGACAGTTGCTAGGTAAATAGAGATTGCTAATA / / / / // // // / | | MnlI SetI || || |BcgI BbvI | Bce83I* || || MboI CviRI* || |DpnI || BstKTI |Hpy166II |HindII BinI* L Q R K D I E V V A V N D P F I S N D Y C K E K T L R L L L S T I H L S L T I M A K K R H * G C C C Q R S I Y L * R L C ----:----|----:----|----:----|----:----|----:----|----:----| K C L F S M S T T A T L S G N I E L S * K A F F L C Q P Q Q Q * R D M * R * R N Q L S F V N L N N S D V I W K D R V I I FatI |CviAII || NlaIII || | BcgI Csp6I || | |Csp6I BaeI |RsaI TseI || | ||RsaI FatI || Tsp4CI* |BisI || | ||| TfiI |CviAII || | FatI ||BlsI || | ||| HinfI || NlaIII || | |CviAII \\\ \\ \ \\\ \ \\ \ \\ \ \\ GCTGCTTACATGGTCAAGTACGATTCTACTCATGGTAGATACAAGGGTACTGTTTCCCAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGAATGTACCAGTTCATGCTAAGATGAGTACCATCTATGTTCCCATGACAAAGGGTA /// / // / // / / // /// // / ||| | || | || | | |FatI ||| || CviAII ||| | || | || | | CviAII ||| |BaeI ||| | || | || | NlaIII ||| NlaIII ||| | || | || HinfI ||Tsp4CI* ||| | || | || TfiI |Csp6I ||| | || | || BaeI RsaI ||| | || | |Csp6I ||| | || | RsaI ||| | || BcgI ||| | |FatI ||| | CviAII ||| NlaIII ||TseI |BisI BlsI A A Y M V K Y D S T H G R Y K G T V S H L L T W S S T I L L M V D T R V L F P M C L H G Q V R F Y S W * I Q G Y C F P * ----:----|----:----|----:----|----:----|----:----|----:----| A A * M T L Y S E V * P L Y L P V T E W H Q K C P * T R N * E H Y I C P Y Q K G S S V H D L V I R S M T S V L T S N G M Hpy178III* | MboI SetI NlaIII | | DpnI | BsmAI | BaeI BccI | | |BstKTI | Eco31I BseYI \ \ \ \ \ \\ \ \ \ GACGACAAGCACATCATCATTGATGGTGTCAAGATCGCTACCTACCAAGAAAGAGACCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGTTCGTGTAGTAGTAACTACCACAGTTCTAGCGATGGATGGTTCTTTCTCTGGGT / / /// / / / / / FatI BccI ||| | SetI | | SetI ||| MboI | GsaI ||DpnI Eco31I |BstKTI BsmAI Hpy178III* D D K H I I I D G V K I A T Y Q E R D P T T S T S S L M V S R S L P T K K E T Q R Q A H H H * W C Q D R Y L P R K R P S ----:----|----:----|----:----|----:----|----:----|----:----| S S L C M M M S P T L I A V * W S L S G H R C A C * * Q H H * S R * R G L F L G V V L V D D N I T D L D S G V L F S V W FatI NcoI StyI MboI AluI SecI* | DpnI GsaI DsaI* | |TaqI HindII CviJI |CviAII | |ClaI MlyI Hpy166II BsrI | SetI || NlaIII | |BstKTI PleI |HinfI TspRI \ \ \\ \ \ \\ \ \\ \ GCTAACTTGCCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCCACTGGTGTTTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGAACGGTACCCCAAGAGATTTCTAGCTACAGCGACAACTGAGGTGACCACAAAAG / / // // // // / // / BseYI | |DsaI* || |ClaI || | |HinfI BsrI CviJI | |SecI* || |TaqI || | TspRI AluI | |StyI || MboI || Hpy166II | |NcoI |DpnI || HindII | |FatI BstKTI |PleI | CviAII MlyI NlaIII A N L P W G S L K I D V A V D S T G V F L T C H G V L * R S M S L L T P L V F S * L A M G F S K D R C R C * L H W C F Q ----:----|----:----|----:----|----:----|----:----|----:----| A L K G H P E R F I S T A T S E V P T K L * S A M P N E L S R H R Q Q S W Q H K S V Q W P T R * L D I D S N V G S T N E HgiCI* | NlaIV AciI | Hin4II* BtsI TspEI | BsrBI | |HgaI SetI | MboII \ \ \ \ \\ \ \ \ AAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGGTGCCAAGAAGGTTGTCATCACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTAACCTGTGGCGAGTTTTCGTGTAACTGCGACCACGGTTCTTCCAACAGTAGTGA / / // / // / / TspEI BsrBI || | |SetI | MboII AciI || | HgaI TspRI || HgiCI* BtsI |NlaIV Hin4II* K E L D T A Q K H I D A G A K K V V I T R N W T P L K S T L T L V P R R L S S L G I G H R S K A H * R W C Q E G C H H C ----:----|----:----|----:----|----:----|----:----|----:----| L S N S V A * F C M S A P A L F T T M V * P I P C R E F A C Q R Q H W S P Q * * L F Q V G S L L V N V S T G L L N D D S MseI |HpaI |HindII |Hpy166II MboII || GsuI TsoI |TspRI BccI || Eco57MI | Hpy178III* \\ \ \\ \ \ \ GCTCCATCTTCTTCTGCTCCAATGTTTGTTGTTGGTGTTAACCACACTAAATACACTCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTAGAAGAAGACGAGGTTACAAACAACAACCACAATTGGTGTGATTTATGTGAGGT / / // / / MboII BccI |MseI TsoI Hpy178III* Hpy166II Eco57MI HindII HpaI GsuI A P S S S A P M F V V G V N H T K Y T P L H L L L L Q C L L L V L T T L N T L Q S I F F C S N V C C W C * P H * I H S R ----:----|----:----|----:----|----:----|----:----|----:----| A G D E E A G I N T T P T L W V L Y V G Q E M K K Q E L T Q Q Q H * G C * I C E S W R R R S W H K N N T N V V S F V S W XcmI |Tsp4CI* ||MmeI |||BstXI |||| CviJI |||| |NlaIV |||| || MwoI |||| || |CfrI |||| || || BalI |||| || || CviJI |||| || || HaeIII |||| || || |StyI BsmAI Csp6I |||| || || |SecI* MboII |RsaI |||| || || || SfaNI \ \\ \\\\ \\ \\ \\ \ GACAAGAAGATTGTCTCCAACGCTTCTTGTACCACCAACTGTTTGGCTCCATTGGCCAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCTTCTAACAGAGGTTGCGAAGAACATGGTGGTTGACAAACCGAGGTAACCGGTTC / / // // // / / // / | BsmAI |Csp6I || || MwoI | || SecI* MboII RsaI || |NlaIV | || StyI || CviJI | |SetI |Tsp4CI* | CfrI |MmeI HaeIII BstXI CviJI XcmI BalI D K K I V S N A S C T T N C L A P L A K T R R L S P T L L V P P T V W L H W P R Q E D C L Q R F L Y H Q L F G S I G Q G ----:----|----:----|----:----|----:----|----:----|----:----| S L F I T E L A E Q V V L Q K A G N A L L C S S Q R W R K K Y W W S N P E M P W V L L N D G V S R T G G V T Q S W Q G L Tsp4CI* | Hin4I | TspRI | Hpy166II | | FatI | | |CviAII SetI | | || NlaIII SetI Hin4II* | MboII | | || | AciI \ \ \ \ \ \ \\ \ \ GTTATCAACGATGCTTTCGGTATTGAAGAAGGTTTGATGACCACTGTTCACTCCATGACC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGTTGCTACGAAAGCCATAACTTCTTCCAAACTACTGGTGACAAGTGAGGTACTGG / / / / / // / / // SfaNI Hin4II* SetI | | || | | |FatI | | || | | CviAII | | || | NlaIII | | || Hpy166II | | |Tsp4CI* | | Hin4I | TspRI MboII V I N D A F G I E E G L M T T V H S M T L S T M L S V L K K V * * P L F T P * P Y Q R C F R Y * R R F D D H C S L H D R ----:----|----:----|----:----|----:----|----:----|----:----| T I L S A K P I S S P K I V V T * E M V P * * R H K R Y Q L L N S S W Q E S W S N D V I S E T N F F T Q H G S N V G H G Hin4I Hin4I | FokI | |BccI | || Tsp4CI* | || | Hin4I | || | | AsuI* BarI AciI | || | | AvaII BccI Hin4I |XmnI | || | | |BmgT120I BsaXI Hin4I || GsuI | || | | || BseGI | MnlI |BsrI SetI || Eco57MI \ \\ \ \ \\ \ \ \ \\ \ \\ \ GCCACTCAAAAGACTGTTGATGGTCCATCCCACAAGGACTGGAGAGGTGGTAGAACCGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGAGTTTTCTGACAACTACCAGGTAGGGTGTTCCTGACCTCTCCACCATCTTGGCGA / / /// /// / / // / / // / | Hin4I ||FokI ||| | | || | SetI || BsaXI | Hin4I |Hin4I ||| | | || BsrI |Eco57MI AciI Tsp4CI* ||| | | |Hin4I |GsuI BccI ||| | | |Hin4I |AciI ||| | | |BarI XmnI ||| | | MnlI ||| | BccI ||| BsaXI ||AvaII ||AsuI* |BmgT120I BseGI A T Q K T V D G P S H K D W R G G R T A P L K R L L M V H P T R T G E V V E P L H S K D C * W S I P Q G L E R W * N R F ----:----|----:----|----:----|----:----|----:----|----:----| A V * F V T S P G D W L S Q L P P L V A R W E F S Q Q H D M G C P S S L H Y F R G S L L S N I T W G V L V P S T T S G S BccI |AgeI |BetI* |Cfr10I ||HpaII ||| MnlI ||| |TseI ||| ||BisI BetI* ||| |||BlsI |HpaII ||| |||| DdeI ||FokI BarI ||| |||| Bpu10I ||BsaXI | BseGI ||| |||| | MwoI |||MaeIII | | BbvI ||| |||| | | CviJI SetI \\\\ \ \ \ \\\ \\\\ \ \ \ \ TCCGGTAACATTATCCCATCCTCTACCGGTGCTGCTAAGGCTGTCGGTAAGGTCTTGCCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCATTGTAATAGGGTAGGAGATGGCCACGACGATTCCGACAGCCATTCCAGAACGGT // / / / / / // /// / / / / || | | BseGI | | || ||| | CviJI SetI MwoI || | MaeIII | | || ||| Bpu10I || | BarI | | || ||| DdeI || FokI | | || ||MwoI |BetI* | | || ||TseI HpaII | | || |BisI | | || BlsI | | |Cfr10I | | |BetI* | | |MnlI | | |AgeI | | HpaII | BccI BbvI S G N I I P S S T G A A K A V G K V L P P V T L S H P L P V L L R L S V R S C Q R * H Y P I L Y R C C * G C R * G L A R ----:----|----:----|----:----|----:----|----:----|----:----| E P L M I G D E V P A A L A T P L T K G K R Y C * G M R * R H Q * P Q R Y P R A G T V N D W G R G T S S L S D T L D Q W HindII Hpy166II PleI | AgeI |MlyI TspEI | BetI* ||TspGWI | MwoI | Cfr10I ||Tsp4CI* | | CviRI* | |HpaII Hpy188I ||| TaqI | | | SetI | || BslFI CviJI |HinfI ||| | Hpy99I MmeI \ \ \ \ \ \\ \ \ \\ \\\ \ \ \ GAATTGCAAGGTAAGTTGACCGGTATGGCTTTCAGAGTCCCAACCGTCGATGTTTCCGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACGTTCCATTCAACTGGCCATACCGAAAGTCTCAGGGTTGGCAGCTACAAAGGCAA // / / // / / / / // / / || SetI | || | | | | || TaqI MmeI |CviRI* | || | | | | |Tsp4CI* TspEI | || | | | | |Hpy99I | || | | | | |PleI | || | | | | |MlyI | || | | | | TspGWI | || | | | HinfI | || | | Hpy188I | || | CviJI | || BslFI | |Cfr10I | |BetI* | |AgeI | HpaII Hpy166II HindII E L Q G K L T G M A F R V P T V D V S V N C K V S * P V W L S E S Q P S M F P L I A R * V D R Y G F Q S P N R R C F R C ----:----|----:----|----:----|----:----|----:----|----:----| S N C P L N V P I A K L T G V T S T E T L I A L Y T S R Y P K * L G L R R H K R F Q L T L Q G T H S E S D W G D I N G N Hin4II* HindII | Hpy178III* Hpy166II AluI | | BbvI | DrdI CviJI | | | CviJI | | Tsp4CI* | SetI | | | | MseI \ \ \ \ \ \ \ \ \ \ GTTGACTTGACTGTCAAGTTGGAAAAGGAAGCTACTTACGACCAAATCAAGAAGGCTGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTGAACTGACAGTTCAACCTTTTCCTTCGATGAATGCTGGTTTAGTTCTTCCGACAA / / / / / / / / / | | Tsp4CI* | CviJI | | | MwoI | DrdI | AluI | | CviJI Hpy166II SetI | | BbvI HindII | Hpy178III* Hin4II* V D L T V K L E K E A T Y D Q I K K A V L T * L S S W K R K L L T T K S R R L L * L D C Q V G K G S Y L R P N Q E G C * ----:----|----:----|----:----|----:----|----:----|----:----| T S K V T L N S F S A V * S W I L F A T Q Q S S Q * T P F P L * K R G F * S P Q N V Q S D L Q F L F S S V V L D L L S N MwoI | TseI | CviJI | |BisI | ||BlsI | |||Hin4II* | ||||AciI | ||||BisI | |||||BlsI | ||||||TauI | ||||||NspBII* | ||||||| AjuI | ||||||| AsuI* Eco57I | ||||||| AvaII Eco57MI | ||||||| |BmgT120I | BceAI | ||||||| ||SetI | MaeIII | ||||||| ||Hin4II* | TspDTI AjuI | ||||||| ||| BsiYI* | | SfaNI | BseRI MboII \ \\\\\\\ \\\ \ \ \ \ \ \ \ AAGGCTGCCGCTGAAGGTCCAATGAAGGGTGTTTTGGGTTACACCGAAGATGCCGTTGTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGACGGCGACTTCCAGGTTACTTCCCACAAAACCCAATGTGGCTTCTACGGCAACAG / //////// / /// / / / / // / / | |||||||| | ||| BsiYI* | | | |SfaNI BseRI MboII | |||||||| | ||AvaII | | | |AjuI | |||||||| | ||AsuI* | | | MaeIII | |||||||| | |BmgT120I | | BceAI | |||||||| | Hin4II* | TspDTI | |||||||| SetI Eco57MI | |||||||AjuI Eco57I | ||||||NspBII* | ||||||AciI | |||||BisI | ||||BlsI | |||TseI | |||TauI | ||Hin4II* | ||BisI | |BlsI | CviJI MseI K A A A E G P M K G V L G Y T E D A V V R L P L K V Q * R V F W V T P K M P L S G C R * R S N E G C F G L H R R C R C L ----:----|----:----|----:----|----:----|----:----|----:----| L A A A S P G I F P T K P * V S S A T T * P Q R Q L D L S P H K P N C R L H R Q L S G S F T W H L T N Q T V G F I G N D BsmAI |TaqII AciI || Hpy188I | NspBII* || | MnlI MboII | | MnlI || | | MaeIII |HphI TaqI | | | MfeI || | | Tsp45I || SfaNI | BccI | | | TspEI \\ \ \ \ \\ \ \ \ \ \ \ \ TCCTCTGATTTCTTGGGTGACACTCACGCTTCCATCTTCGATGCCTCCGCTGGTATCCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGACTAAAGAACCCACTGTGAGTGCGAAGGTAGAAGCTACGGAGGCGACCATAGGTT / / / / / // / // / / | | | MnlI | |HphI SfaNI |BccI | MnlI | | BsmAI | MboII TaqI NspBII* | Hpy188I Tsp45I AciI TaqII MaeIII S S D F L G D T H A S I F D A S A G I Q P L I S W V T L T L P S S M P P L V S N L * F L G * H S R F H L R C L R W Y P I ----:----|----:----|----:----|----:----|----:----|----:----| E E S K K P S V * A E M K S A E A P I W R R Q N R P H C E R K W R R H R R Q Y G G R I E Q T V S V S G D E I G G S T D L BssKI EcoRII | ScrFI | BseBI EciI | | Csp6I | MaeIII BciVI | | |RsaI | Tsp4CI* | BsmAI | | || BsaXI | | AciI \ \ \ \ \\ \ \ \ \ TTGTCTCCAAAGTTCGTCAAGTTGATTTCCTGGTACGATAACGAATACGGTTACTCCGCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGAGGTTTCAAGCAGTTCAACTAAAGGACCATGCTATTGCTTATGCCAATGAGGCGG // / / /// / / / / |BciVI BsmAI | ||Csp6I EciI | | AciI TspEI | |BsaXI | MaeIII MfeI | |RsaI Tsp4CI* | EcoRII | BssKI BseBI ScrFI L S P K F V K L I S W Y D N E Y G Y S A C L Q S S S S * F P G T I T N T V T P P V S K V R Q V D F L V R * R I R L L R Q ----:----|----:----|----:----|----:----|----:----|----:----| N D G F N T L N I E Q Y S L S Y P * E A I T E L T R * T S K R T R Y R I R N S R Q R W L E D L Q N G P V I V F V T V G G BcgI BsaXI | HindII | Hpy166II | | MboI StyI | | | DpnI SecI* | | | |TaqI | CviJI | | | |BstKTI | | MseI \ \ \ \\ \ \ \ AGAGTTGTTGACTTGATCGAATATGTTGCCAAGGCTTAA 970 980 990 ----:----|----:----|----:----|----:---- TCTCAACAACTGAACTAGCTTATACAACGGTTCCGAATT // / // // // // || | || |TaqI || |BcgI || | || MboI || MseI || | |DpnI |CviJI || | BstKTI SecI* || Hpy166II StyI || HindII |BcgI BsaXI R V V D L I E Y V A K A * E L L T * S N M L P R L X S C * L D R I C C Q G L X ----:----|----:----|----:----|----:---- L T T S K I S Y T A L A * W L Q Q S S R I H Q W P K S N N V Q D F I N G L S L # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AgeI 2 AsiGI,BshTI,CspAI,PinAI AjuI 1 AluI 2 AluBI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BccI 6 Bce83I* 1 BpuEI BceAI 1 BcgI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 3 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 2 Bpu10I 1 BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseRI 1 BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 5 BstXI 1 BtsI 1 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 5 CviJI 10 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 5 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 3 EcoRII 1 AjnI,Psp6I,PspGI FatI 5 FokI 2 GsaI 1 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 3 Hin4II* 5 HpyAV HindII 6 HincII HinfI 4 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Hpy99I 1 MaeIII 4 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 5 MseI 4 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PleI 2 PpsI RsaI 4 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 11 SfaNI 3 LweI SmlI 1 SmoI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaqI 4 TaqII 1 TauI 1 TfiI 2 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI XcmI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AhaIII* AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BamHI BbvCI BbvII* BdaI BfiI BglI BglII BmeT110I BmtI BplI BsaAI BsaBI BseMII BsePI BseSI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI Cac8I CauII* Cfr9I CspCI DinI DraII DraIII Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GlaI HaeII HgiAI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaiI TatI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769