Restriction Map of BBC1/YJL020C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BBC1/YJL020C on chromosome X from coordinates 402410 to 398937.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.10049

EMBOSS_001 SetI BspCNI |Hin4II* |BseMII SduI || CviJI || MnlI Hpy166II BseSI || |DdeI || Hpy188I \ \ \\ \\ \\ \ ATGAGTGAACCCGAAGTGCCCTTCAAGGTGGTGGCTCAGTTCCCATACAAGTCCGATTAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCACTTGGGCTTCACGGGAAGTTCCACCACCGAGTCAAGGGTATGTTCAGGCTAATG / / / / / / // / Hpy166II BseSI | | | DdeI || Hpy188I SduI | | CviJI || MnlI | Hin4II* |BseMII SetI BspCNI M S E P E V P F K V V A Q F P Y K S D Y * V N P K C P S R W W L S S H T S P I T E * T R S A L Q G G G S V P I Q V R L R ----:----|----:----|----:----|----:----|----:----|----:----| X L S G S T G K L T T A * N G Y L D S * X S H V R L A R * P P P E T G M C T R N H T F G F H G E L H H S L E W V L G I V BdaI BdaI MaeIII | MseI | BdaI | |SwaI MboI | BdaI AjuI | |AhaIII* | DpnI | | MaeII | AcyI | ||ApoI | |BstKTI | | | SetI | |BaeI | ||TspEI | ||Hpy178III* | | | TaiI | || BbvII* \ \\\ \ \\\ \ \ \ \ \ \\ \ GAGGACGATTTAAATTTTGAAAAAGATCAAGAGATTATTGTTACGTCTGTTGAAGACGCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTGCTAAATTTAAAACTTTTTCTAGTTCTCTAATAACAATGCAGACAACTTCTGCGG / // / // / / / / // / / / BdaI || TspEI || | | | | || | BaeI AcyI BdaI || ApoI || | | | | || AjuI |MseI || | | | | |MaeII AhaIII* || | | | | MaeIII SwaI || | | | TaiI || | | | SetI || | | BdaI || | | BdaI || | Hpy178III* || MboI |DpnI BstKTI E D D L N F E K D Q E I I V T S V E D A R T I * I L K K I K R L L L R L L K T P G R F K F * K R S R D Y C Y V C * R R R ----:----|----:----|----:----|----:----|----:----|----:----| S S S K F K S F S * S I I T V D T S S A R P R N L N Q F L D L S * Q * T Q Q L R L V I * I K F F I L L N N N R R N F V G BssKI EcoRII | ScrFI | BseBI | | TfiI MaeII | | HphI |MnlI HgaI | | AjuI ||Hpy99I MboII | | HinfI |||SetI | Csp6I | | | XcmI |||TaiI | |RsaI | | | | BaeI |||| MboII Hpy178III* \ \\ \ \ \ \ \ \\\\ \ \ GAATGGTACTTTGGTGAATACCAGGATTCAAATGGCGACGTTATTGAGGGTATCTTCCCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACCATGAAACCACTTATGGTCCTAAGTTTACCGCTGCAATAACTCCCATAGAAGGGC / /// / /// // / // / / / | ||HgaI | ||| |HinfI | || | MboII Hpy178III* | |Csp6I | ||| |TfiI | || MaeII | RsaI | ||| XcmI | |MnlI BbvII* | ||EcoRII | TaiI MboII | ||BssKI | SetI | ||BaeI Hpy99I | |HphI | BseBI | ScrFI AjuI E W Y F G E Y Q D S N G D V I E G I F P N G T L V N T R I Q M A T L L R V S S R M V L W * I P G F K W R R Y * G Y L P E ----:----|----:----|----:----|----:----|----:----|----:----| S H Y K P S Y W S E F P S T I S P I K G R I T S Q H I G P N L H R R * Q P Y R G F P V K T F V L I * I A V N N L T D E R MboI XhoII CviJI | DpnI | TfiI | |BstKTI | HinfI | || Hpy188I | |Eco57I MmeI | || | BinI* | |Eco57MI Hpy188I \ \ \\ \ \ \ \\ \ AAAAGTTTTGTTGCTGTTCAGGGATCTGAAGTTGGAAAGGAAGCCGAATCATCTCCGAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCAAAACAACGACAAGTCCCTAGACTTCAACCTTTCCTTCGGCTTAGTAGAGGCTTA / // / / / / / / / / MmeI || | BinI* | | HinfI | | BseMII || Hpy188I | | TfiI | BsiYI* || XhoII | Eco57MI Hpy188I || MboI | Eco57I |DpnI CviJI BstKTI K S F V A V Q G S E V G K E A E S S P N K V L L L F R D L K L E R K P N H L R I K F C C C S G I * S W K G S R I I S E Y ----:----|----:----|----:----|----:----|----:----|----:----| F L K T A T * P D S T P F S A S D D G F S F N Q Q Q E P I Q L Q F P L R I M E S F T K N S N L S R F N S L F G F * R R I AgeI BetI* Cfr10I BsiYI* |HpaII |BseMII ||BspCNI ||| NlaIV ||| | DdeI ||| | | TspRI AsuI* ||| | | | MaeII AvaII ||| | | | | Csp6I DraII ||| | | | | |RsaI PpuMI ||| | | | | |SetI CviJI |BmgT120I ||| | | | | |TaiI |HpaII || SetI CviJI \\\ \ \ \ \ \\ \\ \\ \ \ ACCGGTTCCACTGAGCAACGTACAATCCAGCCGGAAGTAGAACAAAAGGACCTACCAGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCAAGGTGACTCGTTGCATGTTAGGTCGGCCTTCATCTTGTTTTCCTGGATGGTCTC / /// / / /// / / /// / / | ||NlaIV | | ||Csp6I | HpaII ||PpuMI | CviJI | ||TspRI | | |RsaI CviJI ||DraII HgiJII* | |Cfr10I | | MaeII ||AvaII SduI | |BetI* | TaiI ||AsuI* | |AgeI | SetI |BmgT120I | HpaII DdeI SetI BspCNI T G S T E Q R T I Q P E V E Q K D L P E P V P L S N V Q S S R K * N K R T Y Q S R F H * A T Y N P A G S R T K G P T R A ----:----|----:----|----:----|----:----|----:----|----:----| V P E V S C R V I W G S T S C F S R G S Y R N W Q A V Y L G A P L L V F P G V L G T G S L L T C D L R F Y F L L V * W L MboII | BssKI | |HpaII | ||ScrFI | ||CauII* CviJI | |||AsuI* |AciI | ||||BmgT120I |BisI | |||||CviJI ||BlsI SduI | |||||HaeIII BsrI |||TauI HgiJII* | ||||||BsrI |TspRI ||||SfeI* \ \ \\\\\\\ \\ \\\\\ CCCATTTCCCCTGAAACGAAGAAAGAAACTCTGTCCGGGCCAGTGCCAGTTCCAGCCGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTAAAGGGGACTTTGCTTCTTTCTTTGAGACAGGCCCGGTCACGGTCAAGGTCGGCGA / //// / ///// MboII |||| BsrI ||||TspRI |||AsuI* |||AciI ||BmgT120I ||BisI ||HaeIII |BlsI ||BssKI CviJI ||CviJI TauI |TspRI |BsrI CauII* HpaII ScrFI P I S P E T K K E T L S G P V P V P A A P F P L K R R K K L C P G Q C Q F Q P L H F P * N E E R N S V R A S A S S S R Y ----:----|----:----|----:----|----:----|----:----|----:----| G M E G S V F F S V R D P G T G T G A A A W K G Q F S S L F E T R A L A L E L R G N G R F R L F F S Q G P W H W N W G S CviJI |AciI |BisI ||BlsI CviJI |||TauI |AciI ||||SfeI* |BisI ||||| Tsp4CI* ||BlsI Tsp4CI* ||||| | BsrI |||TauI | BsrI ||||| | |TspRI ||||SfeI* AsuI* | |TspRI ||||| | || BaeI ||||| MwoI MwoI AvaII \ \\ \\\\\ \ \\ \ \\\\\ \ \ \ ACAGTGCCAGTTCCAGCCGCTACAGTGCCAGTTCCAGCCGCTACAGCAGTATCAGCACAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCACGGTCAAGGTCGGCGATGTCACGGTCAAGGTCGGCGATGTCGTCATAGTCGTGTC // / ///// // // //// / / / / || BsrI ||||| || |BaeI |||MwoI | MwoI | BaeI |SfeI* ||||| || BsrI |||AciI SfeI* SetI Tsp4CI* ||||| |SfeI* ||BisI ||||| Tsp4CI* |BlsI ||||TspRI CviJI |||AciI TauI ||BisI |BlsI CviJI TauI T V P V P A A T V P V P A A T A V S A Q Q C Q F Q P L Q C Q F Q P L Q Q Y Q H R S A S S S R Y S A S S S R Y S S I S T G ----:----|----:----|----:----|----:----|----:----|----:----| V T G T G A A V T G T G A A V A T D A C * L A L E L R * L A L E L R * L L I L V C H W N W G S C H W N W G S C C Y * C L FatI NcoI BmgT120I StyI |SetI SecI* || BaeI DsaI* || |FatI |CviAII FalI || ||CviAII || NlaIII FalI || ||| NlaIII || |TfiI | Hin4II* || ||| | EcoP15I || |HinfI | |TspEI \\ \\\ \ \ \\ \\ \ \\ GTCCAGCATGATAGTAGTAGTGGTAATGGCGAAAGAAAAGTTCCCATGGATTCTCCAAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGTCGTACTATCATCATCACCATTACCGCTTTCTTTTCAAGGGTACCTAAGAGGTTTT // / // / / // / / / || | |FatI EcoP15I | || | | Hin4II* || | CviAII | || | HinfI || NlaIII | || | TfiI |AvaII | || FalI |AsuI* | || FalI BmgT120I | |DsaI* | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII V Q H D S S S G N G E R K V P M D S P K S S M I V V V V M A K E K F P W I L Q N P A * * * * W * W R K K S S H G F S K I ----:----|----:----|----:----|----:----|----:----|----:----| T W C S L L L P L P S L F T G M S E G F P G A H Y Y Y H Y H R F F L E W P N E L D L M I T T T T I A F S F N G H I R W F MseI | FalI CviJI | FalI | Cac8I | |Hpy178III* TspGWI \ \ \ \\ \ TTGAAGGCTCGCTTATCTATGTTTAATCAAGATATAACGGAGCAAGTTCCTTTACCAAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCCGAGCGAATAGATACAAATTAGTTCTATATTGCCTCGTTCAAGGAAATGGTTTT / / / / / / / | | Cac8I | MseI Hpy178III* TspGWI | CviJI FalI TspEI FalI L K A R L S M F N Q D I T E Q V P L P K * R L A Y L C L I K I * R S K F L Y Q N E G S L I Y V * S R Y N G A S S F T K I ----:----|----:----|----:----|----:----|----:----|----:----| N F A R K D I N L * S I V S C T G K G F I S P E S I * T * D L Y L P A L E K V L Q L S A * R H K I L I Y R L L N R * W F MfeI MslI TspEI | SetI |SfaNI BslFI \ \ \\ \ TCAACTCACTTGGATTTAGAAAACATACCTGTGAAAAAAACAATTGTGGCAGATGCTCCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGAGTGAACCTAAATCTTTTGTATGGACACTTTTTTTGTTAACACCGTCTACGAGGA / / // / | MslI |SfaNI BslFI SetI TspEI MfeI S T H L D L E N I P V K K T I V A D A P Q L T W I * K T Y L * K K Q L W Q M L L N S L G F R K H T C E K N N C G R C S * ----:----|----:----|----:----|----:----|----:----|----:----| D V * K S K S F M G T F F V I T A S A G I L E S P N L F C V Q S F F L Q P L H E * S V Q I * F V Y R H F F C N H C I S R BssKI SecI* EcoRII | ScrFI | BseBI | | ApoI MaeII BslFI | | TspEI | SetI |Hpy178III* | | EcoRI | TaiI || MmeI \ \ \ \ \ \\ \ AAATACTATGTCCCCCCTGGAATTCCAACAAATGATACGTCCAATCTTGAAAGGAAAAAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGATACAGGGGGGACCTTAAGGTTGTTTACTATGCAGGTTAGAACTTTCCTTTTTC /// / / / /// ||| EcoRI | MaeII ||BslFI ||| TspEI TaiI |Hpy178III* ||| ApoI SetI MmeI ||EcoRII ||BssKI |SecI* BseBI ScrFI K Y Y V P P G I P T N D T S N L E R K K N T M S P L E F Q Q M I R P I L K G K S I L C P P W N S N K * Y V Q S * K E K V ----:----|----:----|----:----|----:----|----:----|----:----| L Y * T G G P I G V F S V D L R S L F F * I S H G G Q F E L L H Y T W D Q F S F F V I D G R S N W C I I R G I K F P F L ApaLI | CviRI* | Hpy166II Hpy178III* | | SduI | TspEI | | BseSI | | MseI | | HgiAI* | | VspI | | | SetI \ \ \ \ \ \ \ TCCCTAAAGGAAAACGAAAAAAAGATTGTTCCCGAACCAATTAATCGTGCACAGGTGGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGATTTCCTTTTGCTTTTTTTCTAACAAGGGCTTGGTTAATTAGCACGTGTCCACCTT / // / / // | || | | |SetI | || | | ApaLI | || | Hpy166II | || | CviRI* | || HgiAI* | || BseSI | || SduI | |VspI | |MseI | TspEI Hpy178III* S L K E N E K K I V P E P I N R A Q V E P * R K T K K R L F P N Q L I V H R W K P K G K R K K D C S R T N * S C T G G K ----:----|----:----|----:----|----:----|----:----|----:----| D R F S F S F F I T G S G I L R A C T S T G L P F R F F S Q E R V L * D H V P P G * L F V F F L N N G F W N I T C L H F TspEI BseMII DdeI | Hin4II* CviJI |BspCNI MboII | |MseI | MseI \\ \ \ \\ \ \ AGTGGAAGAATAGAAACTGAGAATGACCAATTAAAGAAGGATTTGCCCCAGATGAGCCTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCTTCTTATCTTTGACTCTTACTGGTTAATTTCTTCCTAAACGGGGTCTACTCGGAA // / / / // / |BspCNI | DdeI | |MseI CviJI BseMII MboII | TspEI Hin4II* S G R I E T E N D Q L K K D L P Q M S L V E E * K L R M T N * R R I C P R * A L W K N R N * E * P I K E G F A P D E P * ----:----|----:----|----:----|----:----|----:----|----:----| L P L I S V S F S W N F F S K G W I L R F H F F L F Q S H G I L S P N A G S S G T S S Y F S L I V L * L L I Q G L H A K TseI CviJI |BisI ||BlsI TspEI BbvI |||CviRI* \ \ \\\\ AAAGAAAGAATTGCTCTTTTACAGGAGCAACAAAGATTACAGGCTGCAAGAGAAGAAGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTCTTAACGAGAAAATGTCCTCGTTGTTTCTAATGTCCGACGTTCTCTTCTTCTT / / / //// MseI TspEI BbvI |||CviRI* |||TseI ||BisI |BlsI CviJI K E R I A L L Q E Q Q R L Q A A R E E E K K E L L F Y R S N K D Y R L Q E K K N R K N C S F T G A T K I T G C K R R R T ----:----|----:----|----:----|----:----|----:----|----:----| L S L I A R K C S C C L N C A A L S S S * L F F Q E K V P A V F I V P Q L L L L F F S N S K * L L L L S * L S C S F F F FatI |CviAII || NlaIII || | MaeII CviJI || | | SetI |DdeI || | | TaiI |EspI* || | | | AciI || AluI || | | | | MseI SmlI || CviJI || | | | | TspDTI Hpy178III* || | TaqI || | | | | |HpaI |MboII || | SetI || | | | | |HindII || MboII || | |Bce83I* || | | | | |Hpy166II \\ \ \\ \ \\ \\ \ \ \ \ \\ CTCTTGAGAAAAAAGGCTAAGCTCGAACAAGAACATGAACGTAGTGCGGTTAACAAGAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAACTCTTTTTTCCGATTCGAGCTTGTTCTTGTACTTGCATCACGCCAATTGTTCTTA / /// / //// / / /// / / // | ||SmlI | |||| TaqI | ||| MaeII | |MseI | |MboII | |||Bce83I* | ||TaiI | Hpy166II | Hpy178III* | ||CviJI | ||SetI | HindII MboII | ||AluI | |FatI | HpaI | |EspI* | CviAII TspDTI | |DdeI NlaIII AciI | SetI CviJI L L R K K A K L E Q E H E R S A V N K N S * E K R L S S N K N M N V V R L T R M L E K K G * A R T R T * T * C G * Q E * ----:----|----:----|----:----|----:----|----:----|----:----| S K L F F A L S S C S C S R L A T L L F V R S F F P * A R V L V H V Y H P * C S E Q S F L S L E F L F M F T T R N V L I CviJI Eco57I SetI | SduI TspGWI Eco57MI |ApoI | HgiJII* | MboII | MboII TspDTI |TspEI \ \ \ \ \ \ \ \\ GAGCCCTATACGGAAACTGAAGAAGCAGAAGAAAATGAAAAAACTGAACCGAAACCTGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGGATATGCCTTTGACTTCTTCGTCTTCTTTTACTTTTTTGACTTGGCTTTGGACTT / / / / / / / / | CviJI TspGWI MboII | MboII | SetI HgiJII* Eco57MI TspDTI SduI Eco57I E P Y T E T E E A E E N E K T E P K P E S P I R K L K K Q K K M K K L N R N L N A L Y G N * R S R R K * K N * T E T * I ----:----|----:----|----:----|----:----|----:----|----:----| S G * V S V S S A S S F S F V S G F G S H A R Y P F Q L L L L F H F F Q V S V Q L G I R F S F F C F F I F F S F R F R F DdeI | MnlI BseMII | | SduI NlaIV |BspCNI | | HgiAI* | AciI TspEI \\ \ \ \ \ \ \ TTTACGCCTGAAACTGAGCACAACGAGGAACCGCAAATGGAATTATTGGCACATAAAGAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGCGGACTTTGACTCGTGTTGCTCCTTGGCGTTTACCTTAATAACCGTGTATTTCTC /// // / / / ||BspCNI |DdeI | AciI TspEI |BseMII |MnlI NlaIV TspEI HgiAI* ApoI SduI F T P E T E H N E E P Q M E L L A H K E L R L K L S T T R N R K W N Y W H I K R Y A * N * A Q R G T A N G I I G T * R D ----:----|----:----|----:----|----:----|----:----|----:----| N V G S V S C L S S G C I S N N A C L S I * A Q F Q A C R P V A F P I I P V Y L K R R F S L V V L F R L H F * Q C M F L SetI | FnuDII* | | MnlI | | |Hin4II* TspDTI TspEI \ \ \\ \ \ ATTACTAAAACCTCACGCGAAGCAGATGAAGGCACGAATGACATAGAGAAAGAACAATTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGATTTTGGAGTGCGCTTCGTCTACTTCCGTGCTTACTGTATCTCTTTCTTGTTAAA / / // / / SetI | |Hin4II* TspDTI TspEI | MnlI FnuDII* I T K T S R E A D E G T N D I E K E Q F L L K P H A K Q M K A R M T * R K N N F Y * N L T R S R * R H E * H R E R T I F ----:----|----:----|----:----|----:----|----:----|----:----| I V L V E R S A S S P V F S M S F S C N S * * F R V R L L H L C S H C L S L V I N S F G * A F C I F A R I V Y L F F L K MnlI PleI |MlyI TatI || BseRI |Csp6I HinfI || | MnlI ||RsaI Hpy188I |MaeIII || | MwoI |||Hpy166II |MnlI |Tsp45I || | |BsaXI \\\\ \\ \\ \\ \ \\ TTAGATGAGTACACAAAGGAAAATCAGAAAGTTGAGGAGTCACAAGCAGACGAGGCAAGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTACTCATGTGTTTCCTTTTAGTCTTTCAACTCCTCAGTGTTCGTCTGCTCCGTTCT /// // / // // /// ||TatI |MnlI | || || ||MnlI |Hpy166II Hpy188I | || || |BsaXI |Csp6I | || || MwoI RsaI | || |BseRI | || PleI | || MlyI | |MnlI | Tsp45I | MaeIII HinfI L D E Y T K E N Q K V E E S Q A D E A R * M S T Q R K I R K L R S H K Q T R Q E R * V H K G K S E S * G V T S R R G K R ----:----|----:----|----:----|----:----|----:----|----:----| K S S Y V F S F * F T S S D C A S S A L K L H T C L P F D S L Q P T V L L R P L * I L V C L F I L F N L L * L C V L C S MaeIII | SetI | | CfrI | | | CviJI | | | HaeIII BbvII* DdeI | | | |FatI |BceAI BseMII BbvCI | | | ||CviAII || MboII |BspCNI BseRI | | | ||| NlaIII || |TspDTI || MnlI Bpu10I BsaXI | | | ||| | MnlI || || MnlI \\ \ \ \ \ \ \ \\\ \ \ \\ \\ \ GGAGAAAATGTTGCTGAGGAAAGCGAAATAGGTTACGGCCATGAAGACAGAGAGGGAGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCTTTTACAACGACTCCTTTCGCTTTATCCAATGCCGGTACTTCTGTCTCTCCCTCTA // / / / / / / /// /// // / || | | | BsaXI SetI | ||| ||MnlI || MnlI || | | Bpu10I | ||| |FatI |TspDTI || | | BbvCI | ||| CviAII |BbvII* || | | DdeI | ||CfrI |MboII || | BseRI | |NlaIII BceAI || MnlI | HaeIII |BspCNI | CviJI BseMII MaeIII G E N V A E E S E I G Y G H E D R E G D E K M L L R K A K * V T A M K T E R E I R K C C * G K R N R L R P * R Q R G R * ----:----|----:----|----:----|----:----|----:----|----:----| P S F T A S S L S I P * P W S S L S P S L L F H Q Q P F R F L N R G H L C L P L S F I N S L F A F Y T V A M F V S L S I MboII |AsuI* ||BmgT120I |||CviJI |||HaeIII Ksp632I* ||||AciI | MboII ||||BisI Ksp632I* | | TfiI |||||BlsI |MnlI | MboII | HinfI ||||||TauI TsoI \\ \ \ \ \ \\\\\\\ \ AATGATGAGGAAAAAGAAGAGGAAGATAGTGAAGAGAATCGTAGGGCCGCATTGAGAGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACTCCTTTTTCTTCTCCTTCTATCACTTCTCTTAGCATCCCGGCGTAACTCTCTT / / / / / / / //// / | Ksp632I* | | MboII | | |||| TsoI MnlI | Ksp632I* | | |||AciI MboII | | ||BisI | | |AsuI* | | |BlsI | | BmgT120I | | HaeIII | | CviJI | | TauI | MboII HinfI TfiI N D E E K E E E D S E E N R R A A L R E M M R K K K R K I V K R I V G P H * E K * * G K R R G R * * R E S * G R I E R K ----:----|----:----|----:----|----:----|----:----|----:----| L S S S F S S S S L S S F R L A A N L S Y H H P F L L P L Y H L S D Y P R M S L I I L F F F L F I T F L I T P G C Q S F Hin6I |GlaI ||HhaI |||MaeI TfiI SduI CviJI |||HaeII HinfI HgiAI* MseI MmeI \ \\\\ \ \ \ \ AGAATGGCTAAACTATCTGGCGCTAGTAGATTCGGTGCTCCTGTTGGTTTTAACCCCTTC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTACCGATTTGATAGACCGCGATCATCTAAGCCACGAGGACAACCAAAATTGGGGAAG / //// / / / / / CviJI |||| MaeI | HgiAI* | MmeI |||Hin6I | SduI MseI ||GlaI HinfI |HhaI TfiI HaeII R M A K L S G A S R F G A P V G F N P F E W L N Y L A L V D S V L L L V L T P S N G * T I W R * * I R C S C W F * P L R ----:----|----:----|----:----|----:----|----:----|----:----| L I A L S D P A L L N P A G T P K L G K F F P * V I Q R * Y I R H E Q Q N * G R S H S F * R A S T S E T S R N T K V G E SapI Ksp632I* | GsuI | Eco57MI Hin4II* | |Hpy188I |CviJI | || BccI Hin4II* || Hpy178III* | || | CviJI MboII | MnlI \\ \ \ \\ \ \ \ \ \ GGTATGGCTTCTGGAGTTGGAAATAAACCATCAGAAGAGCCGAAAAAGAAACAGCATAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACCGAAGACCTCAACCTTTATTTGGTAGTCTTCTCGGCTTTTTCTTTGTCGTATTC / / / / / / / / / / | CviJI Hpy178III* | | | CviJI MboII | MnlI Hin4II* | | BccI Hin4II* | Ksp632I* | Hpy188I | SapI Eco57MI GsuI G M A S G V G N K P S E E P K K K Q H K V W L L E L E I N H Q K S R K R N S I R Y G F W S W K * T I R R A E K E T A * G ----:----|----:----|----:----|----:----|----:----|----:----| P I A E P T P F L G D S S G F F F C C L R Y P K Q L Q F Y V M L L A S F S V A Y T H S R S N S I F W * F L R F L F L M L NlaIV | SetI | |BseRI | || BseRI | || | AluI MnlI | || | CviJI BsiI* MnlI | MnlI | || | | SetI |SetI | SetI \ \ \ \\ \ \ \ \\ \ \ GAGAAGGAGGAGGAGGAACCTGAACAGCTCCAAGAACTACCTCGTGCCATACCTGTTATG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCCTCCTCCTCCTTGGACTTGTCGAGGTTCTTGATGGAGCACGGTATGGACAATAC / / / / / / / / / // | MnlI | | | | CviJI SetI | |SetI MnlI | | | | AluI | MnlI | | | SetI BsiI* | | BseRI | BseRI NlaIV SetI E K E E E E P E Q L Q E L P R A I P V M R R R R R N L N S S K N Y L V P Y L L C E G G G G T * T A P R T T S C H T C Y A ----:----|----:----|----:----|----:----|----:----|----:----| S F S S S S G S C S W S S G R A M G T I P S P P P P V Q V A G L V V E H W V Q * L L L L L F R F L E L F * R T G Y R N H HindII BdaI TfiI Hpy166II BdaI DdeI HinfI \ \ \ \ CCATTTGTTGACCCAAGTTCTAACCCATTTTTTAGGAAATCAAATCTAAGTGAGAAGAAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAAACAACTGGGTTCAAGATTGGGTAAAAAATCCTTTAGTTTAGATTCACTCTTCTTA / / / / Hpy166II BdaI DdeI HinfI HindII BdaI TfiI P F V D P S S N P F F R K S N L S E K N H L L T Q V L T H F L G N Q I * V R R I I C * P K F * P I F * E I K S K * E E S ----:----|----:----|----:----|----:----|----:----|----:----| G N T S G L E L G N K L F D F R L S F F A M Q Q G L N * G M K * S I L D L H S S W K N V W T R V W K K P F * I * T L L I BinI* | MaeI | | MboI | | XhoII | | | DpnI | | | |HgaI | | | |BstKTI | | | || FatI | | | || |CviAII | | | || || CviRI* | | | || || NlaIII MboII | | | || || | MnlI | Hin4I | | | || || | | Hin4I | Hin4I | | | || || | | Hin4I | | TspRI | | | || || | | | FatI | | | BdaI | | | || || | | | |CviAII | | | BdaI | | | || || | | | || NlaIII \ \ \ \ \ \ \ \\ \\ \ \ \ \\ \ CAACCCACTGAAACAAAGACGCTAGATCCTCATGCAACCACAGAGCATGAACAGAAGCAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGGTGACTTTGTTTCTGCGATCTAGGAGTACGTTGGTGTCTCGTACTTGTCTTCGTT /// / / /// / / /// // / // / ||MboII BdaI | ||| | | ||| |MnlI | |FatI TspDTI |Hin4I BdaI | ||| | | ||| Hin4I | CviAII |Hin4I | ||| | | ||| Hin4I NlaIII TspRI | ||| | | ||CviRI* | ||| | | ||FatI | ||| | | |CviAII | ||| | | HgaI | ||| | NlaIII | ||| XhoII | ||| MboI | ||DpnI | |BstKTI | MaeI BinI* Q P T E T K T L D P H A T T E H E Q K Q N P L K Q R R * I L M Q P Q S M N R S K T H * N K D A R S S C N H R A * T E A R ----:----|----:----|----:----|----:----|----:----|----:----| * G V S V F V S S G * A V V S C S C F C D V W Q F L S A L D E H L W L A H V S A L G S F C L R * I R M C G C L M F L L L TspDTI |FatI ||CviAII TseI ||EcoP15I AluI ||| NlaIII CviJI ||| |Csp6I |BisI ||| ||RsaI ||BlsI CviRI* ||| |||Hpy166II ||SetI | BseGI ||| |||| BbvI TspEI ||| FokI | | Hpy178III* \\\ \\\\ \ \ \\\ \ \ \ \ GAACATGGTACACACGCCTATCACAATTTAGCTGCTGTTGATAATGCACATCCCGAATAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTACCATGTGTGCGGATAGTGTTAAATCGACGACAACTATTACGTGTAGGGCTTATG / // // / // //// / / / | || |Hpy166II BbvI || |||TseI FokI CviRI* Hpy178III* | || |Csp6I || ||BisI BseGI | || RsaI || |BlsI | |FatI || CviJI | EcoP15I || AluI | CviAII |SetI NlaIII TspEI E H G T H A Y H N L A A V D N A H P E Y N M V H T P I T I * L L L I M H I P N T T W Y T R L S Q F S C C * * C T S R I L ----:----|----:----|----:----|----:----|----:----|----:----| S C P V C A * * L K A A T S L A C G S Y L V H Y V R R D C N L Q Q Q Y H V D R I F M T C V G I V I * S S N I I C M G F V Hpy188I | FatI | |CviAII MboII | || TfiI |TspDTI | || HinfI || BsiI* BccI | || NlaIII || | MnlI CviRI* | || | Hpy188I || | SfaNI | BseGI FokI \ \\ \ \ \\ \ \ \ \ \ TCTGACCATGATTCTGATGAAGATACTGACGACCACGAGTTTGAGGATGCAAACGATGGG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTGGTACTAAGACTACTTCTATGACTGCTGGTGCTCAAACTCCTACGTTTGCTACCC / / // // / / / / // | | || |Hpy188I | | | SfaNI |BccI | | || HinfI | | BsiI* CviRI* | | || TfiI | MnlI BseGI | | |FatI TspDTI | | CviAII MboII | NlaIII Hpy188I S D H D S D E D T D D H E F E D A N D G L T M I L M K I L T T T S L R M Q T M G * P * F * * R Y * R P R V * G C K R W V ----:----|----:----|----:----|----:----|----:----|----:----| E S W S E S S S V S S W S N S S A F S P S Q G H N Q H L Y Q R G R T Q P H L R H R V M I R I F I S V V V L K L I C V I P Cac8I BccI HindIII HinfI BsmI | AluI | Hpy188I XmnI | CviJI Hpy188I | | PleI | TaqI | | SetI | SetI | | |MlyI \ \ \ \ \ \ \ \ \ \\ TTGAGAAAGCATTCGATGGTGGAGCAAGCTTTTCAGATAGGTAATAATGAGTCAGAGAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTTTCGTAAGCTACCACCTCGTTCGAAAAGTCTATCCATTATTACTCAGTCTCTTA / / // / / / / / / // / FokI | |BccI TaqI | | | | SetI || PleI | XmnI | | | Hpy188I || MlyI BsmI | | HindIII |Hpy188I | CviJI HinfI | AluI Cac8I SetI L R K H S M V E Q A F Q I G N N E S E N * E S I R W W S K L F R * V I M S Q R M E K A F D G G A S F S D R * * * V R E C ----:----|----:----|----:----|----:----|----:----|----:----| N L F C E I T S C A K * I P L L S D S F T S F A N S P P A L K E S L Y Y H T L S Q S L M R H H L L S K L Y T I I L * L I MseI |TspEI || BetI* || BspMII* Tsp4CI* || |HpaII |Csp6I || |Hpy178III* ||RsaI || || Bce83I* SmlI ||| SfeI* || || | ApoI | Hpy178III* ||| | CviRI* || || | TspEI | | MnlI ||| | | PstI \\ \\ \ \ \ \ \ \\\ \ \ \ GTTAATTCCGGAGAAAAAATTTACCCTCAAGAACCACCAATCTCCCACCGTACTGCAGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTAAGGCCTCTTTTTTAAATGGGAGTTCTTGGTGGTTAGAGGGTGGCATGACGTCTT / / /// / / / / /// / / | | ||BspMII* TspEI | MnlI | ||| | SfeI* | | ||BetI* ApoI Hpy178III* | ||| CviRI* | | |Hpy178III* SmlI | ||PstI | | |HpaII | |Csp6I | | Bce83I* | RsaI | TspEI Tsp4CI* MseI V N S G E K I Y P Q E P P I S H R T A E L I P E K K F T L K N H Q S P T V L Q K * F R R K N L P S R T T N L P P Y C R S ----:----|----:----|----:----|----:----|----:----|----:----| T L E P S F I * G * S G G I E W R V A S H * N R L F F K G E L V V L R G G Y Q L N I G S F F N V R L F W W D G V T S C F FatI |CviAII || NlaIII ApoI || |TspDTI TspEI BsrI MboII BsmAI \\ \\ \ \ \ \ GTATCACATGATATTGAAAATTCATCACAAAACACAACTGGAAATGTTTTGCCTGTCTCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGTGTACTATAACTTTTAAGTAGTGTTTTGTGTTGACCTTTACAAAACGGACAGAGA / // / / / | |FatI TspEI BsrI MboII | CviAII ApoI | TspDTI NlaIII V S H D I E N S S Q N T T G N V L P V S Y H M I L K I H H K T Q L E M F C L S L I T * Y * K F I T K H N W K C F A C L F ----:----|----:----|----:----|----:----|----:----|----:----| T D C S I S F E D C F V V P F T K G T E L I V H Y Q F N M V F C L Q F H K A Q R Y * M I N F I * * L V C S S I N Q R D R ApoI Ksp632I* Cac8I TaqI TspEI BsiYI* \ \ \ \ \ TCCCCACAAACAAGAGTTGCTCGCAACGGGTCGATAAATTCTTTGACTAAATCCATTTCA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGGTGTTTGTTCTCAACGAGCGTTGCCCAGCTATTTAAGAAACTGATTTAGGTAAAGT / / / / / / | Ksp632I* Cac8I TaqI TspEI BsiYI* BsmAI ApoI S P Q T R V A R N G S I N S L T K S I S P H K Q E L L A T G R * I L * L N P F Q P T N K S C S Q R V D K F F D * I H F R ----:----|----:----|----:----|----:----|----:----|----:----| E G C V L T A R L P D I F E K V L D M E K G V F L L Q E C R T S L N K S * I W K G W L C S N S A V P R Y I R Q S F G N * FatI BspHI |CviAII |Hpy178III* || NlaIII || | Tsp4CI* AciI EciI || | | TspDTI TspEI \ \ \\ \ \ \ \ GGGGAAAATCGGCGGAAATCCATAAACGAGTATCATGATACAGTTTCCACTAATTCATCT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTTTTAGCCGCCTTTAGGTATTTGCTCATAGTACTATGTCAAAGGTGATTAAGTAGA / / / // // / / AciI EciI | || |TspDTI | Bce83I* | || Tsp4CI* TspEI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII G E N R R K S I N E Y H D T V S T N S S G K I G G N P * T S I M I Q F P L I H L G K S A E I H K R V S * Y S F H * F I C ----:----|----:----|----:----|----:----|----:----|----:----| P S F R R F D M F S Y * S V T E V L E D L P F D A S I W L R T D H Y L K W * N M P F I P P F G Y V L I M I C N G S I * R AciI | BsrBI | |SmlI | || Hpy178III* | || | Hin4I | || | | GsuI | || | | Eco57MI | || | | |BccI | || | | || TaqI | || | | || | GsuI | || | | || | Eco57MI | || | | || | | TseI | || | | || | | |BisI | || | | || | | ||BlsI | || | | || | | |||AluI | || | | || | | |||CviJI | || | | || | | |||| SetI | || | | || | | |||| |MwoI | || | | || | | |||| || TseI | || | | || | | |||| || MwoI | || | | || | | |||| || |BisI | || | | || | | |||| || ||BlsI | || | | || | | |||| || |||AluI | || | | || | | |||| || |||BbvI | || | | || | | |||| || |||CviJI | || | | || | | |||| || |||| SetI | || | | || | | |||| || |||| |BsrI | || | | || | | |||| || |||| || Hin4I CviRI* | || | | || | | |||| || |||| || | DdeI |Bce83I* | || | | || | | |||| || |||| || | BbvI || MseI | || | | || | | |||| || |||| || | |FokI \\ \ \ \\ \ \ \\ \ \ \\\\ \\ \\\\ \\ \ \\ GCATTAACAGAAACCGCTCAAGATATTTCGATGGCAGCTCCAGCAGCTCCAGTTCTAAGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAATTGTCTTTGGCGAGTTCTATAAAGCTACCGTCGAGGTCGTCGAGGTCAAGATTCA / / / / / / /// / ///// / /// | MseI | | BccI | ||| | ||||| BbvI ||FokI CviRI* | | | ||| | ||||Hin4I |BbvI | | | ||| | |||BsrI DdeI | | | ||| | ||CviJI | | | ||| | ||TseI | | | ||| | ||AluI | | | ||| | |BisI | | | ||| | BlsI | | | ||| | SetI | | | ||| MwoI | | | ||CviJI | | | ||MwoI | | | ||TseI | | | ||AluI | | | |BisI | | | BlsI | | | SetI | | Eco57MI | | TaqI | | GsuI | Hpy178III* | Eco57MI | SmlI | GsuI BsrBI Hin4I AciI A L T E T A Q D I S M A A P A A P V L S H * Q K P L K I F R W Q L Q Q L Q F * V I N R N R S R Y F D G S S S S S S S K * ----:----|----:----|----:----|----:----|----:----|----:----| A N V S V A * S I E I A A G A A G T R L Q M L L F R E L Y K S P L E L L E L E L C * C F G S L I N R H C S W C S W N * T HgiCI* |HphI ||SetI ||NlaIV ||| BfiI ||| |BsgI ||| ||SetI ||| ||| BsrI ||| ||| | DraIII ||| ||| | | BsgI SetI ||| ||| | | MnlI BseMII ||| ||| | | | TspRI MaeIII ||| ||| | | | | GsuI Tsp45I ||| ||| | | | | Eco57MI |BspCNI ||| ||| | | | | | CviRI* || MnlI ||| ||| | | | | | |TaqII || BseGI ||| ||| | | | | | || Hin4II* || | EcoP15I ||| ||| | | | | | || | MwoI || | | Hpy178III* ||| ||| | | | | | || | BstAPI || | | |DdeI ||| ||| | | | | | || | | CviRI* || | | |SauI* ||| ||| | | | | | || | | |BsgI \\ \ \ \\ \\\ \\\ \ \ \ \ \ \\ \ \ \\ AAGGTGTCACATCCTGAGGACAAGGTGCCACCTCACCCAGTGCCTTCTGCACCCTCTGCA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCACAGTGTAGGACTCCTGTTCCACGGTGGAGTGGGTCACGGAAGACGTGGGAGACGT / // // / / / / / / / /// // // / // / /// | || || | | | | | | | ||BfiI || |MnlI | || | ||SetI | || || | | | | | | | ||BsgI || BsgI | || | |CviRI* | || || | | | | | | | |SetI |DraIII | || | BsgI | || || | | | | | | | HgiCI* TspRI | || Hin4II* | || || | | | | | | NlaIV BsrI | || BstAPI | || || | | | | | HphI | || MwoI | || || | | | | SetI | |CviRI* | || || | | | SauI* | TaqII | || || | | | DdeI Eco57MI | || || | | Hpy178III* GsuI | || || | EcoP15I | || || Tsp45I | || || MaeIII | || |MnlI | || BseGI | |BspCNI | BseMII SetI K V S H P E D K V P P H P V P S A P S A R C H I L R T R C H L T Q C L L H P L H G V T S * G Q G A T S P S A F C T L C T ----:----|----:----|----:----|----:----|----:----|----:----| L T D C G S S L T G G * G T G E A G E A Y P T V D Q P C P A V E G L A K Q V R Q L H * M R L V L H W R V W H R R C G R C CviRI* |BsgI || SetI || MnlI || | GsuI || | Eco57MI || | | Csp6I || | | |RsaI || | | || Hin4II* || | | || | GsuI || | | || | Eco57MI || | | || | | CviRI* || | | || | | | SetI SetI || | | || | | | MnlI MnlI || | | || | | | |BsrI |BsrI || | | || | | | ||GsuI BsgI ||Eco57I || | | || | | | ||Eco57MI | MnlI ||Eco57MI || | | || | | | ||| Csp6I | |SetI ||| Csp6I || | | || | | | ||| |RsaI | ||MwoI ||| |RsaI || | | || | | | ||| || MnlI | |||Eco57I ||| || MnlI || | | || | | | ||| || |SetI | |||Eco57MI \\\ \\ \ \\ \ \ \\ \ \ \ \\\ \\ \\ \ \\\\ CCTCCAGTACCCTCTGCACCTTCAGTACCCTCTGCACCTCCAGTACCTCCAGCACCTCCA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGGTCATGGGAGACGTGGAAGTCATGGGAGACGTGGAGGTCATGGAGGTCGTGGAGGT // /// /// // /// / // // /// / / / / || ||MnlI ||| || ||| | || || ||MnlI | | | Eco57MI || |Csp6I ||| || ||| | || || |Csp6I | | | Eco57I || RsaI ||| || ||| | || || RsaI | | MnlI |Eco57MI ||| || ||| | || || SetI | | MwoI |Eco57I ||| || ||| | || |Eco57MI | SetI MnlI ||| || ||| | || |GsuI BsgI BsrI ||| || ||| | || MnlI ||| || ||| | || BsrI ||| || ||| | |SetI ||| || ||| | CviRI* ||| || ||| Eco57MI ||| || ||| GsuI ||| || ||Hin4II* ||| || |Csp6I ||| || RsaI ||| |Eco57MI ||| |GsuI ||| MnlI ||SetI |CviRI* BsgI P P V P S A P S V P S A P P V P P A P P L Q Y P L H L Q Y P L H L Q Y L Q H L Q S S T L C T F S T L C T S S T S S T S S ----:----|----:----|----:----|----:----|----:----|----:----| G G T G E A G E T G E A G G T G G A G G V E L V R Q V K L V R Q V E L V E L V E R W Y G R C R * Y G R C R W Y R W C R W MnlI | MwoI | BstAPI | | CviRI* | | | SetI BsrI | | | | BfiI |Eco57I | | | | Csp6I |Eco57MI | | | | |RsaI || Csp6I | | | | || Hin4II* || |RsaI | | | | || | BsrI || || MboII | | | | || | |GsuI || || |SetI | | | | || | |Eco57MI || || ||BsrI | | | | || | || BfiI || || |||GsuI | | | | || | || Csp6I || || |||Eco57MI | | | | || | || |RsaI || || |||| MnlI SetI \ \ \ \ \\ \ \\ \\ \\ \\ \\\\ \ \ GCACTCTCTGCACCTTCAGTACCCCCAGTACCCCCAGTACCTCCAGTATCTTCAGCACCT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGAGAGACGTGGAAGTCATGGGGGTCATGGGGGTCATGGAGGTCATAGAAGTCGTGGA / // / ///// / // // ///// / / / | |SetI | ||||| | || || ||||| MnlI | MwoI | CviRI* | ||||| | || || ||||Eco57MI SetI BstAPI | ||||| | || || ||||GsuI MnlI | ||||| | || || |||BsrI MwoI | ||||| | || || ||MboII | ||||| | || || |Csp6I | ||||| | || || RsaI | ||||| | || || SetI | ||||| | || |Eco57MI | ||||| | || |Eco57I | ||||| | || BsrI | ||||| | |Csp6I | ||||| | RsaI | ||||| BfiI | ||||Eco57MI | ||||GsuI | |||BsrI | ||Hin4II* | |Csp6I | RsaI BfiI A L S A P S V P P V P P V P P V S S A P H S L H L Q Y P Q Y P Q Y L Q Y L Q H L T L C T F S T P S T P S T S S I F S T S ----:----|----:----|----:----|----:----|----:----|----:----| A S E A G E T G G T G G T G G T D E A G L V R Q V K L V G L V G L V E L I K L V C E R C R * Y G W Y G W Y R W Y R * C R MnlI |DdeI ||MwoI |||GsuI |||Eco57MI |||| SetI |||| | BspCNI |||| | |BseMII |||| | || Hin4II* |||| | || |SetI |||| | || ||BsrI |||| | || |||GsuI |||| | || |||Eco57MI |||| | || |||| Csp6I |||| | || |||| |RsaI |||| | || |||| || MnlI |||| | || |||| || |SetI |||| | || |||| || || GsuI |||| | || |||| || || Eco57MI |||| | || |||| || || | MnlI |||| | || |||| || || | |SetI |||| | || |||| || || | || GsuI |||| | || |||| || || | || Eco57MI |||| | || |||| || || | || | MnlI |||| | || |||| || || | || | |SetI MwoI |||| | || |||| || || | || | ||MwoI \ \\\\ \ \\ \\\\ \\ \\ \ \\ \ \\\ CCAGCACTCTCAGCACCTTCAATACCTCCAGTACCTCCAACACCTCCAGCACCTCCAGCA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTGAGAGTCGTGGAAGTTATGGAGGTCATGGAGGTTGTGGAGGTCGTGGAGGTCGT / / / / // / /// /// / / / / / / / | | | SetI || | ||| ||| | | | | | MnlI MmeI | | DdeI || | ||| ||| | | | | | MwoI SetI | Eco57MI || | ||| ||| | | | | SetI | GsuI || | ||| ||| | | | Eco57MI MnlI || | ||| ||| | | | GsuI MwoI || | ||| ||| | | MnlI || | ||| ||| | SetI || | ||| ||| Eco57MI || | ||| ||| GsuI || | ||| ||MnlI || | ||| |Csp6I || | ||| RsaI || | ||| SetI || | ||Eco57MI || | ||GsuI || | |BsrI || | Hin4II* || SetI |BseMII BspCNI P A L S A P S I P P V P P T P P A P P A Q H S Q H L Q Y L Q Y L Q H L Q H L Q H S T L S T F N T S S T S N T S S T S S T ----:----|----:----|----:----|----:----|----:----|----:----| G A S E A G E I G G T G G V G G A G G A E L V R L V K L V E L V E L V E L V E L W C E * C R * Y R W Y R W C R W C R W C MmeI |MnlI ||SetI |||MwoI ||||BbvI ||||| Hin6I ||||| |GlaI ||||| ||HhaI ||||| |||HaeII ||||| ||||MnlI ||||| ||||| MwoI ||||| ||||| | MwoI FatI ||||| ||||| | |Hin6I AflIII ||||| ||||| | ||GlaI BspLU11I* ||||| ||||| | |||TseI |CviAII ||||| ||||| | |||HhaI ||TspDTI ||||| ||||| | ||||BisI ||| NspI ||||| ||||| | |||||BlsI ||| NlaIII ||||| ||||| | |||||MnlI ||| | MboII \\\\\ \\\\\ \ \\\\\\ \\\ \ \ CCTCCAGCGCCTCTTGCGCTGCCTAAACACAATGAAGTAGAAGAACATGTCAAGTCATCT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGGTCGCGGAGAACGCGACGGATTTGTGTTACTTCATCTTCTTGTACAGTTCAGTAGA / ///// / ////// / // / MnlI ||||| | |||||TseI | || MboII MwoI ||||| | ||||BisI | |BspLU11I* ||||| | |||MnlI | |AflIII ||||| | |||BlsI | |FatI ||||| | ||Hin6I | CviAII ||||| | |GlaI TspDTI ||||| | HhaI NlaIII ||||| MwoI NspI ||||MnlI ||||MwoI |||Hin6I |||BbvI ||GlaI |HhaI HaeII P P A P L A L P K H N E V E E H V K S S L Q R L L R C L N T M K * K N M S S H L S S A S C A A * T Q * S R R T C Q V I C ----:----|----:----|----:----|----:----|----:----|----:----| G G A G R A S G L C L S T S S C T L D D V E L A E Q A A * V C H L L L V H * T M R W R R K R Q R F V I F Y F F M D L * R MnlI SetI |Hin4II* ||FokI ||| SecI* ||| |Hpy188I ||| || BciVI ||| || | BseGI EciI AciI \\\ \\ \ \ \ \ GCTCCCCTTCCACCTGTATCCGAGGAATATCATCCTATGCCAAATACTGCTCCGCCACTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGGGAAGGTGGACATAGGCTCCTTATAGTAGGATACGGTTTATGACGAGGCGGTGAA / // // / / / / / | || || | | BseGI EciI AciI | || || | BciVI | || || SecI* | || |FokI | || Hpy188I | |Hin4II* | MnlI SetI A P L P P V S E E Y H P M P N T A P P L L P F H L Y P R N I I L C Q I L L R H F S P S T C I R G I S S Y A K Y C S A T S ----:----|----:----|----:----|----:----|----:----|----:----| A G R G G T D S S Y * G I G F V A G G S Q E G E V Q I R P I D D * A L Y Q E A V S G K W R Y G L F I M R H W I S S R W K MaeII |PmaCI |BsaAI ||ApaLI |||SetI |||TaiI ||||CviRI* ||||Hpy166II ||||| SduI ||||| BseSI ||||| HgiAI* ||||| | BsrI ||||| | | Csp6I ||||| | | |RsaI MlyI ||||| | | || Cfr10I PleI ||||| | | || |HpaII ApoI HinfI ||||| | | || || CviJI TspEI | Hpy188I CviJI \\\\\ \ \ \\ \\ \ \ \ \ \ CCACGTGCACCACCAGTACCACCGGCTACTTTTGAATTTGACTCTGAACCAACAGCCACT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGCACGTGGTGGTCATGGTGGCCGATGAAAACTTAAACTGAGACTTGGTTGTCGGTGA / // / / / // // // / // / | || | | BsrI |Csp6I |Cfr10I || | |Hpy188I CviJI | || | ApaLI RsaI |CviJI || | HinfI | || Hpy166II HpaII || TspEI | || CviRI* || ApoI | |HgiAI* |PleI | |MaeII MlyI | |BseSI | |SduI | BsaAI | PmaCI TaiI SetI P R A P P V P P A T F E F D S E P T A T H V H H Q Y H R L L L N L T L N Q Q P L T C T T S T T G Y F * I * L * T N S H S ----:----|----:----|----:----|----:----|----:----|----:----| G R A G G T G G A V K S N S E S G V A V E V H V V L V V P * K Q I Q S Q V L L W W T C W W Y W R S S K F K V R F W C G S Hin4II* BseRI | MnlI | AluI | | MslI SetI | CviJI | | | MaeIII CviJI MnlI | | SetI | | | Tsp45I HaeIII | BceAI \ \ \ \ \ \ \ \ \ \ CATTCACATACAGCTCCTTCTCCTCCACCACATCAAAATGTCACGGCCTCTACACCTTCA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGTGTATGTCGAGGAAGAGGAGGTGGTGTAGTTTTACAGTGCCGGAGATGTGGAAGT / / / / / / / / / / | | CviJI | | MslI | HaeIII | MnlI | | AluI | MnlI | CviJI SetI | SetI Hin4II* Tsp45I BseRI MaeIII H S H T A P S P P P H Q N V T A S T P S I H I Q L L L L H H I K M S R P L H L Q F T Y S S F S S T T S K C H G L Y T F N ----:----|----:----|----:----|----:----|----:----|----:----| * E C V A G E G G G C * F T V A E V G E E N V Y L E K E E V V D F H * P R * V K M * M C S R R R W W M L I D R G R C R * DdeI |SetI || TatI || |Csp6I || ||RsaI MaeII || ||ScaI Hin4II* AflIII || ||| MnlI TfiI | Csp6I | SetI || ||| | BspCNI HinfI | |RsaI | TaiI || ||| | |BseMII | Hpy178III* \ \\ \ \ \\ \\\ \ \\ \ \ ATGATGAGTACGCAACAACGTGTGCCAACCTCAGTACTATCTGGGGCAGAAAAAGAATCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTCATGCGTTGTTGCACACGGTTGGAGTCATGATAGACCCCGTCTTTTTCTTAGT / / // / / / / / //// // / | | |Csp6I | | | SetI | |||| |BseMII HinfI | | RsaI | | AflIII | |||| BspCNI TfiI | Hin4II* | MaeII | |||MnlI BceAI TaiI | ||TatI SetI | |Csp6I | ScaI | RsaI DdeI M M S T Q Q R V P T S V L S G A E K E S * * V R N N V C Q P Q Y Y L G Q K K N H D E Y A T T C A N L S T I W G R K R I T ----:----|----:----|----:----|----:----|----:----|----:----| I I L V C C R T G V E T S D P A S F S D L S S Y A V V H A L R L V I Q P L F L I H H T R L L T H W G * Y * R P C F F F * AciI | TspDTI | |FatI Hin4I | ||CviAII Hin4II* Hin4I | ||| MwoI |TfiI |FatI | ||| |NlaIII |HinfI ||CviAII | ||| || Hin4I || Eam1105I TfiI ||| HinfI | ||| || Hin4I || | TspDTI HinfI ||| NlaIII \ \\\ \\ \ \\ \ \ \ \\\ \ CGAACCCTACCGCCCCATGTGCCTTCATTGACGAATCGTCCTGTGGATTCATTCCATGAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTGGGATGGCGGGGTACACGGAAGTAACTGCTTAGCAGGACACCTAAGTAAGGTACTC / / // // / / / // / // Hpy178III* | || |FatI | | TspDTI || | |FatI | || CviAII | | HinfI || | CviAII | |Hin4I | | TfiI || NlaIII | |Hin4I | Eam1105I |HinfI | NlaIII Hin4II* |TfiI | MwoI Hin4I TspDTI Hin4I AciI R T L P P H V P S L T N R P V D S F H E E P Y R P M C L H * R I V L W I H S M S N P T A P C A F I D E S S C G F I P * V ----:----|----:----|----:----|----:----|----:----|----:----| R V R G G W T G E N V F R G T S E N W S V F G V A G H A K M S S D D Q P N M G H S G * R G M H R * Q R I T R H I * E M L SetI | CviJI | HaeIII | | Hin4II* | | | MnlI | | | | SetI | | | | |HindII | | | | |Hpy166II | | | | || FatI Hpy188I | | | | || Hpy99I | PleI | | | | || |CviAII | |MlyI | | | | || || NlaIII | || Hin4II* | | | | || || | HgaI \ \\ \ \ \ \ \ \\ \\ \ \ TCAGATACTACACCGAAGGTGGCCTCTATAAGAAGGTCAACGACGCATGATGTAGGCGAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCTATGATGTGGCTTCCACCGGAGATATTCTTCCAGTTGCTGCGTACTACATCCGCTC // // / / / // / / / // / || |Hin4II* SetI | | |SetI | | | |FatI HgaI || PleI | | MnlI | | | CviAII || MlyI | Hin4II* | | NlaIII |Hpy188I HaeIII | Hpy99I HinfI CviJI Hpy166II HindII S D T T P K V A S I R R S T T H D V G E Q I L H R R W P L * E G Q R R M M * A R R Y Y T E G G L Y K K V N D A * C R R D ----:----|----:----|----:----|----:----|----:----|----:----| D S V V G F T A E I L L D V V C S T P S T L Y * V S P P R * L F T L S A H H L R * I S C R L H G R Y S P * R R M I Y A L MaeII MseI | SetI | MmeI | TaiI | | CviRI* MseI Hin6I | |Hpy178III* | | | BccI VspI |GlaI \ \\ \ \ \ \ \ \\ ATTTCCAACAACGTCAAGATAGAGTTTAATGCACAAGAAAGATGGTGGATTAATAAAAGC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGTTGTTGCAGTTCTATCTCAAATTACGTGTTCTTTCTACCACCTAATTATTTTCG / / / // / / / // | | | || | BccI VspI |GlaI | | | || CviRI* MseI HhaI | | | |MseI | | | MmeI | | Hpy178III* | MaeII TaiI SetI I S N N V K I E F N A Q E R W W I N K S F P T T S R * S L M H K K D G G L I K A F Q Q R Q D R V * C T R K M V D * * K R ----:----|----:----|----:----|----:----|----:----|----:----| I E L L T L I S N L A C S L H H I L L L S K W C R * S L T * H V L F I T S * Y F N G V V D L Y L K I C L F S P P N I F A BsaBI Eco57I Eco57MI |MboI || DpnI || |TaqI || |ClaI || |BstKTI || ||FalI || ||FalI || ||TspDTI || ||| MboI SetI MnlI BccI || ||| BclI |MwoI | FalI | Hin4I || ||| | DpnI HhaI |BstAPI | FalI Hpy188I | Hin4I || ||| | |BstKTI \ \\ \ \ \ \ \ \\ \\\ \ \\ GCACCTCCTGCTATAAGCAATCTGAAGTTGAACTTTTTGATGGAGATCGATGATCATTTC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGAGGACGATATTCGTTAGACTTCAACTTGAAAAACTACCTCTAGCTACTAGTAAAG // / / / / / / / / // // // / || BstAPI | MnlI Hpy188I | BccI | | || || || BclI || MwoI FalI Hin4I | | || || || MboI |SetI FalI Hin4I | | || || |DpnI Hin6I | | || || BstKTI | | || |ClaI | | || |TaqI | | || MboI | | |TspDTI | | |DpnI | | BstKTI | BsaBI | FalI | FalI Eco57MI Eco57I A P P A I S N L K L N F L M E I D D H F H L L L * A I * S * T F * W R S M I I S T S C Y K Q S E V E L F D G D R * S F H ----:----|----:----|----:----|----:----|----:----|----:----| A G G A I L L R F N F K K I S I S S * K R V E Q * L C D S T S S K S P S R H D N C R R S Y A I Q L Q V K Q H L D I I M E Hin4I Hin4I TaqII \ \ ATTTCCAAAAGATTACATCAAAAATGGGTGGTAAGGGATTTTTACTTCTTGTTTGAAAAC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGTTTTCTAATGTAGTTTTTACCCACCATTCCCTAAAAATGAAGAACAAACTTTTG / / Hin4I TaqII Hin4I I S K R L H Q K W V V R D F Y F L F E N F P K D Y I K N G W * G I F T S C L K T F Q K I T S K M G G K G F L L L V * K L ----:----|----:----|----:----|----:----|----:----|----:----| M E L L N C * F H T T L S K * K K N S F * K W F I V D F I P P L P N K S R T Q F N G F S * M L F P H Y P I K V E Q K F V MlyI PleI MaeIII DdeI TatI Tsp4CI* | TfiI SetI |Csp6I |MboII | HinfI |MseI ||RsaI CviJI BarI || HinfI \ \ \\ \\\ \ \ \\ \ TATTCGCAACTAAGATTCTCCTTGACCTTTAATAGTACAAGCCCAGAGAAAACGGTAACG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGCGTTGATTCTAAGAGGAACTGGAAATTATCATGTTCGGGTCTCTTTTGCCATTGC / / / / /// // /// / | HinfI SetI MseI ||| |BarI ||| MaeIII | TfiI ||| CviJI ||PleI DdeI ||TatI |MboII |Csp6I |MlyI RsaI Tsp4CI* Y S Q L R F S L T F N S T S P E K T V T I R N * D S P * P L I V Q A Q R K R * R F A T K I L L D L * * Y K P R E N G N D ----:----|----:----|----:----|----:----|----:----|----:----| * E C S L N E K V K L L V L G S F V T V S N A V L I R R S R * Y Y L G L S F P L I R L * S E G Q G K I T C A W L F R Y R MaeII |BdaI |BdaI BtgZI |BsaAI | Hpy178III* BsrI || SetI | |Ksp632I* | BccI || TaiI | || XmnI BarI | | TaqI || | Hpy178III* \ \\ \ \ \ \ \ \\ \ \ ACTCTTCAAGAACGCTTTCCATCGCCAGTCGAAACACAATCAGCACGTATTCTTGATGAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGAAGTTCTTGCGAAAGGTAGCGGTCAGCTTTGTGTTAGTCGTGCATAAGAACTACTT / / / / / / / / // / HinfI | | BarI BsrI | TaqI | |MaeII Hpy178III* | | XmnI BccI | BsaAI | Ksp632I* TaiI Hpy178III* SetI BtgZI BdaI BdaI T L Q E R F P S P V E T Q S A R I L D E L F K N A F H R Q S K H N Q H V F L M N S S R T L S I A S R N T I S T Y S * * I ----:----|----:----|----:----|----:----|----:----|----:----| V R * S R K G D G T S V C D A R I R S S S E E L V S E M A L R F V I L V Y E Q H S K L F A K W R W D F C L * C T N K I F TspDTI | SetI BdaI ApoI | |MseI BdaI TspDTI TspEI \ \\ \ \ \ TACGCTCAAAGGTTTAATGCGAAAGTTGTAGAGAAATCTCATTCATTGATAAATTCACAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCGAGTTTCCAAATTACGCTTTCAACATCTCTTTAGAGTAAGTAACTATTTAAGTGTA / / / / / TspDTI | BdaI TspDTI TspEI SetI | BdaI ApoI MseI Y A Q R F N A K V V E K S H S L I N S H T L K G L M R K L * R N L I H * * I H I R S K V * C E S C R E I S F I D K F T Y ----:----|----:----|----:----|----:----|----:----|----:----| Y A * L N L A F T T S F D * E N I F E C I R E F T * H S L Q L S I E N M S L N V V S L P K I R F N Y L F R M * Q Y I * M Hpy188I CviJI |ApoI |DdeI MaeIII |TspEI || ApoI Tsp45I |EcoRI || TspEI | TspEI || BciVI \\ \ \ \ \\ \ ATTGGGGCTAAGAATTTCGTGTCACAAATTGTATCCGAATTCAAAGACGAAGTTATACAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCCCGATTCTTAAAGCACAGTGTTTAACATAGGCTTAAGTTTCTGCTTCAATATGTT / / / / / / / | DdeI TspEI | | | BciVI CviJI ApoI | | | EcoRI | | | TspEI | | | ApoI | | Hpy188I | TspEI Tsp45I MaeIII I G A K N F V S Q I V S E F K D E V I Q L G L R I S C H K L Y P N S K T K L Y N W G * E F R V T N C I R I Q R R S Y T T ----:----|----:----|----:----|----:----|----:----|----:----| I P A L F K T D C I T D S N L S S T I C Y Q P * S N R T V F Q I R I * L R L * V N P S L I E H * L N Y G F E F V F N Y L AclI Hin4II* MaeII | SetI | SetI | | EcoNI | TaiI | | | BsiYI* | | Hin6I | | | | TfiI | | |GlaI | | | | HinfI | | ||HhaI PsiI | | | | | TaqI \ \ \\\ \ \ \ \ \ \ \ CCCATAGGAGCAAGAACGTTTGGCGCAACTATATTGAGTTATAAACCTGAAGAAGGAATC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTATCCTCGTTCTTGCAAACCGCGTTGATATAACTCAATATTTGGACTTCTTCCTTAG / / /// / // / / // | | ||Hin6I | || | EcoNI |MboII | | |GlaI | || BsiYI* HinfI | | HhaI | |Hin4II* TfiI | MaeII | SetI | AclI PsiI TaiI SetI P I G A R T F G A T I L S Y K P E E G I P * E Q E R L A Q L Y * V I N L K K E S H R S K N V W R N Y I E L * T * R R N R ----:----|----:----|----:----|----:----|----:----|----:----| G M P A L V N P A V I N L * L G S S P I V W L L L F T Q R L * I S N Y V Q L L F G Y S C S R K A C S Y Q T I F R F F S D MboII |TspDTI || MseI || | BssKI || | SexAI || | EcoRII MboII || | | ScrFI | Tsp4CI* || | | BseBI | | SapI || | | |MboII | | Ksp632I* AluI || | | ||MaeIII | | |Eco57I CviJI || | | ||Tsp45I HphI | | |Eco57MI | SetI || | | ||| SetI |TspEI \ \ \\ \ \ \\ \ \ \\\ \ \\ GAACAGTTGATGAAGAGCTTACAGAAGATTAAACCAGGTGACATTCTTGTAATTAGAAAG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCAACTACTTCTCGAATGTCTTCTAATTTGGTCCACTGTAAGAACATTAATCTTTC / / / / / / / / // / / / / | | | | | CviJI TspDTI | || | | HphI TspEI | | | | | AluI MboII | || | Tsp45I | | | | SetI | || | MaeIII | | | Ksp632I* | || EcoRII | | | SapI | || SexAI | | Eco57MI | || BssKI | | Eco57I | |BseBI | Tsp4CI* | |ScrFI TaqI | MboII | SetI MseI E Q L M K S L Q K I K P G D I L V I R K N S * * R A Y R R L N Q V T F L * L E R T V D E E L T E D * T R * H S C N * K G ----:----|----:----|----:----|----:----|----:----|----:----| S C N I F L K C F I L G P S M R T I L F R V T S S S S V S S * V L H C E Q L * F F L Q H L A * L L N F W T V N K Y N S L AclI MaeII MboI | SetI CviJI | DpnI | TaiI HaeIII AluI | |BstKTI | |EciI | ApoI CviJI | || Hpy188I | ||MlyI HinfI | TspEI | SetI | || | MmeI TspEI | ||PleI |TspGWI \ \ \ \ \ \\ \ \ \ \ \\\ \\ GCCAAATTTGAAGCTCATAAAAAGATCGGAAAAAACGAAATTATCAACGTTGGAATGGAC 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTAAACTTCGAGTATTTTTCTAGCCTTTTTTGCTTTAATAGTTGCAACCTTACCTG / / / / // // / / / // / HaeIII | | CviJI || |MmeI | | | || TspGWI CviJI | | AluI || Hpy188I | | | |PleI | SetI || MboI | | | MlyI TspEI |DpnI | | MaeII ApoI BstKTI | | AclI | | EciI | TaiI | SetI TspEI A K F E A H K K I G K N E I I N V G M D P N L K L I K R S E K T K L S T L E W T Q I * S S * K D R K K R N Y Q R W N G L ----:----|----:----|----:----|----:----|----:----|----:----| A L N S A * L F I P F F S I I L T P I S P W I Q L E Y F S R F F R F * * R Q F P G F K F S M F L D S F V F N D V N S H V AciI | AciI | BisI | |BlsI | ||TauI | ||BsrBI TaqI MaeIII \ \\\ \ \ TCCGCCGCTCCGTATTCGAGTGTTGTTACTGATTATGATTTTACAAAGAATAAGTTTAGA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGGCGAGGCATAAGCTCACAACAATGACTAATACTAAAATGTTTCTTATTCAAATCT / //// / / | |||BsrBI TaqI MaeIII | |||AciI | ||BisI | |BlsI | AciI | TauI HinfI S A A P Y S S V V T D Y D F T K N K F R P P L R I R V L L L I M I L Q R I S L E R R S V F E C C Y * L * F Y K E * V * S ----:----|----:----|----:----|----:----|----:----|----:----| E A A G Y E L T T V S * S K V F F L N L S R R E T N S H Q * Q N H N * L S Y T * G G S R I R T N N S I I I K C L I L K S AluI CviJI |DdeI TaqI |EspI* | MnlI AluI ||SetI | | BsiI* CviJI ||| CviJI | | Hpy178III* | SetI ||| | NdeI XcmI \ \ \ \ \ \\\ \ \ \ GTTATCGAAAATCACGAGGGAAAGATTATTCAAAACAGCTACAAGCTAAGCCATATGAAA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGCTTTTAGTGCTCCCTTTCTAATAAGTTTTGTCGATGTTCGATTCGGTATACTTT // / / / / / / // / / |MnlI | BsiI* | | | | || | XcmI TaqI Hpy178III* | | | | || NdeI | | | | |CviJI | | | | EspI* | | | | DdeI | | | CviJI | | | AluI | | SetI | CviJI | AluI SetI V I E N H E G K I I Q N S Y K L S H M K L S K I T R E R L F K T A T S * A I * K Y R K S R G K D Y S K Q L Q A K P Y E K ----:----|----:----|----:----|----:----|----:----|----:----| T I S F * S P F I I * F L * L S L W I F L * R F D R P F S * E F C S C A L G Y S N D F I V L S L N N L V A V L * A M H F MaeII |BsaAI Hpy188I |SnaBI |TspEI || SetI MseI || MnlI || TaiI TspDTI SetI || | BciVI || | SetI \ \ \\ \ \ \\ \ \ AGTGGGAAGTTAAAGGTTTTCAGAATTGTTGCGAGAGGATACGTAGGTTGGTAA 3430 3440 3450 3460 3470 ----:----|----:----|----:----|----:----|----:----|---- TCACCCTTCAATTTCCAAAAGTCTTAACAACGCTCTCCTATGCATCCAACCATT / // / / / / /// | |SetI | | BciVI | ||SetI | MseI | TspEI | |MaeII TspDTI | MnlI | SnaBI Hpy188I | BsaAI TaiI SetI S G K L K V F R I V A R G Y V G W * V G S * R F S E L L R E D T * V G X W E V K G F Q N C C E R I R R L V X ----:----|----:----|----:----|----:----|----:----|---- L P F N F T K L I T A L P Y T P Q Y F H S T L P K * F Q Q S L I R L N T T P L * L N E S N N R S S V Y T P L # Enzymes that cut Frequency Isoschizomers AciI 12 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AluI 11 AluBI ApaLI 2 Alw44I,VneI ApoI 11 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BarI 1 BbvCI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 3 BpuEI BceAI 2 BciVI 3 BfuI BclI 1 FbaI,Ksp22I BdaI 6 BetI* 2 BsaWI BfiI 3 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 4 Bpu10I 1 BsaAI 3 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 8 BseRI 5 BseSI 3 BaeGI,BstSLI BsgI 5 BsiI* 3 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 8 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 2 AccBSI,MbiI BsrI 15 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 3 BstKTI 6 BtgZI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 16 CviQI,RsaNI CviAII 14 CviJI 37 CviKI-1 CviRI* 14 HpyCH4V DdeI 14 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 3 Eco57I 7 AcuI Eco57MI 20 EcoNI 1 BstENI,XagI EcoP15I 3 EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 14 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 5 GsuI 13 BpmI HaeII 2 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 17 HpyAV Hin6I 5 HinP1I,HspAI HindII 3 HincII HindIII 1 HinfI 18 HpaI 1 KspAI HpaII 5 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 18 Hpy188III Hpy188I 16 Hpy99I 2 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 12 HpyCH4IV MaeIII 9 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 22 MfeI 1 MunI MlyI 6 SchI MmeI 6 MnlI 43 MseI 15 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 16 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 14 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PleI 6 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 1 RsaI 16 AfaI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 7 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 64 SexAI 1 MabI SfaNI 2 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 3 SmoI SnaBI 1 Eco105I,BstSNI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 12 TaqI 9 TaqII 2 TatI 3 TauI 5 TfiI 12 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 5 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 16 TspEI 25 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 6 TscAI VspI 2 PshBI,AseI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AlfI AloI AlwNI ApaI AscI Asp718I AsuII AvaI AvrII BalI BamHI BcgI BglI BglII BmeT110I BmtI BplI BsePI BseYI Bsp120I Bsp1407I BspMI BspOI BsrDI BssNAI Bst1107I BstEII BstXI BstZ17I BtrI BtsI Cfr9I CspCI DinI DrdI Ecl136II Eco31I Eco47III EcoICRI EcoRV EcoT22I EgeI EheI Esp3I FauI FseI FspAI GsaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769