Restriction Map of DAL3/YIR032C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DAL3/YIR032C on chromosome IX from coordinates 415617 to 415030.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.30880

EMBOSS_001 MaeIII Tsp45I BstEII | SecI* | DsaI* | |Tsp4CI* EciI | || BsmAI | DrdI TaqI | || | HphI | |HinfI |PleI BseRI | || | |AciI | || MnlI ||MlyI Hin4II* |TspEI \ \\ \ \\ \ \\ \ \\\ \ \\ ATGGTGACCGTGGTGGCGGAGACATTGACGAAAGAGTCCTTCGAGGAGTATGGGACGATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCACTGGCACCACCGCCTCTGTAACTGCTTTCTCAGGAAGCTCCTCATACCCTGCTAT / / / // / / / / / / / | | | |AciI | | | HinfI | Hin4II* BseRI | | | BsmAI | | MnlI PleI | | HphI | DrdI MlyI | DsaI* EciI TaqI | SecI* Tsp4CI* BstEII Tsp45I MaeIII M V T V V A E T L T K E S F E E Y G T I W * P W W R R H * R K S P S R S M G R * G D R G G G D I D E R V L R G V W D D N ----:----|----:----|----:----|----:----|----:----|----:----| X T V T T A S V N V F S D K S S Y P V I X P S R P P P S M S S L T R R P T H S S H H G H H R L C Q R F L G E L L I P R Y SetI |CviRI* || BssKI || EcoRII MboII || |BcgI |TspDTI || |SecI* BslFI || CviRI* SetI || ||ScrFI | Ksp632I* SfaNI || | BseGI |FokI || ||BseBI \ \ \ \\ \ \ \\ \\ \\\ ATTTCGCCAGATGAAGAGATTTCAAGGATGCAAAACCTTGAAAAAGGTGCAAACCAGGGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGCGGTCTACTTCTCTAAAGTTCCTACGTTTTGGAACTTTTTCCACGTTTGGTCCCT / // / / / / // / / / / TspEI |Ksp632I* | | | SetI |SetI | | | EcoRII BslFI | | CviRI* FokI | | | BssKI | | BseGI | | | SecI* | TspDTI | | BseBI | MboII | | ScrFI SfaNI | BcgI CviRI* I S P D E E I S R M Q N L E K G A N Q G F R Q M K R F Q G C K T L K K V Q T R E F A R * R D F K D A K P * K R C K P G N ----:----|----:----|----:----|----:----|----:----|----:----| I E G S S S I E L I C F R S F P A F W P L K A L H L S K L S A F G Q F L H L G P N R W I F L N * P H L V K F F T C V L S Hin4I |BssKI |CviJI |EcoRII MboI || BcgI | DpnI || ScrFI Hin4I | |BstKTI || BseBI | MfeI | || TspEI || | SetI BsrI | TspEI \ \\ \ \\ \ \ \ \ \ ACAGCGATCAAATTGCTTCAAGTAAGCCAGGTAGAGAATAAATCTACCAGTAAAGTTCCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGCTAGTTTAACGAAGTTCATTCGGTCCATCTCTTATTTAGATGGTCATTTCAAGGG // / / / / // / / / || MboI TspEI Hin4I | || EcoRII BsrI Hin4I |DpnI | || BssKI BstKTI | |BseBI | |ScrFI | SetI CviJI BcgI T A I K L L Q V S Q V E N K S T S K V P Q R S N C F K * A R * R I N L P V K F P S D Q I A S S K P G R E * I Y Q * S S Q ----:----|----:----|----:----|----:----|----:----|----:----| V A I L N S * T L W T S F L D V L L T G F L S * I A E L L G P L S Y I * W Y L E C R D F Q K L Y A L Y L I F R G T F N G CviJI TspGWI |AciI | NlaIV |BisI | | XmnI ||BlsI SetI CviJI | | |SetI |||TauI Bce83I* SmlI |NlaIV \ \ \\ \\\\ \ \ \\ AATTGGAACCTATTCCGTTGCTTTCCACAGCCGCACCTGAATAGAGTATTCACTCAAGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACCTTGGATAAGGCAACGAAAGGTGTCGGCGTGGACTTATCTCATAAGTGAGTTCCG / / / / ///// / / // | | | XmnI ||||| Bce83I* | |NlaIV | | NlaIV ||||SetI | CviJI | | SetI |||AciI SmlI | TspEI ||BisI | MfeI |BlsI TspGWI CviJI TauI N W N L F R C F P Q P H L N R V F T Q G I G T Y S V A F H S R T * I E Y S L K A L E P I P L L S T A A P E * S I H S R L ----:----|----:----|----:----|----:----|----:----|----:----| L Q F R N R Q K G C G C R F L T N V * P W N S G I G N S E V A A G S Y L I * E L I P V * E T A K W L R V Q I S Y E S L A SfaNI TaqI BseGI | Csp6I FokI TspGWI |MnlI | |RsaI \ \ \\ \ \\ TCCAATCAGGCGATTTCTCATTCTATCAAAGTCCTCGAAAAGCATCCGTGTAGTACGCAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTAGTCCGCTAAAGAGTAAGATAGTTTCAGGAGCTTTTCGTAGGCACATCATGCGTC / / / / // / | | | MnlI || TaiI | | BseGI || SetI | TaqI |SfaNI TspGWI |Csp6I FokI RsaI S N Q A I S H S I K V L E K H P C S T Q P I R R F L I L S K S S K S I R V V R R Q S G D F S F Y Q S P R K A S V * Y A D ----:----|----:----|----:----|----:----|----:----|----:----| E L * A I E * E I L T R S F C G H L V C S W D P S K E N * * L G R F A D T Y Y A G I L R N R M R D F D E F L M R T T R L MaeII | SetI | TaiI MaeII | | AciI | SetI | | NspBII* | TaiI | | | MwoI \ \ \ \ \ \ ACGTTTGTGCCTATGGGGAGAACGTCAGCGGAAGTAGCATACTTGGTAGTAGTCGCTAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAAACACGGATACCCCTCTTGCAGTCGCCTTCATCGTATGAACCATCATCAGCGATTT / / / / // / MaeII | | | |MwoI FalI | | | AciI FalI | | NspBII* | MaeII TaiI SetI T F V P M G R T S A E V A Y L V V V A K R L C L W G E R Q R K * H T W * * S L K V C A Y G E N V S G S S I L G S S R * R ----:----|----:----|----:----|----:----|----:----|----:----| V N T G I P L V D A S T A Y K T T T A L S T Q A * P S F T L P L L M S P L L R * R K H R H P S R * R F Y C V Q Y Y D S F FatI AccI AflIII |MnlI BspLU11I* |Hpy166II |CviAII TspEI || MaeII FalI || BceAI | FalI || | SetI FalI || |NspI | FalI CviJI || | TaiI |CviJI || |NlaIII \ \ \ \\ \ \ \\ \\ \\ GAAATTGGAAATAAGCCAGACTTGTCTACGTTGAGGGCTTTTACATGTTTGGGTAATCAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAACCTTTATTCGGTCTGAACAGATGCAACTCCCGAAAATGTACAAACCCATTAGTC / / /// // / / /// TspEI CviJI ||| |FalI CviJI | ||BceAI ||| |FalI | |BspLU11I* ||| MaeII | |AflIII ||AccI | |FatI ||TaiI | CviAII ||SetI NlaIII |Hpy166II NspI MnlI E I G N K P D L S T L R A F T C L G N Q K L E I S Q T C L R * G L L H V W V I R N W K * A R L V Y V E G F Y M F G * S G ----:----|----:----|----:----|----:----|----:----|----:----| S I P F L G S K D V N L A K V H K P L * L F Q F Y A L S T * T S P K * M N P Y D F N S I L W V Q R R Q P S K C T Q T I L SetI | CviJI | |DdeI | |Bpu10I | || Acc65I | || HgiCI* | || |Csp6I | || ||RsaI | || ||SetI | || ||NlaIV | || |||BssKI | || |||EcoRII | || ||||KpnI | || |||||ScrFI | || |||||BseBI | || ||||||SetI | || ||||||| FatI | || ||||||| |CviAII | || ||||||| ||Cac8I | || ||||||| ||| SphI | || ||||||| ||| NspI | || ||||||| ||| Hin6I | || ||||||| ||| NlaIII | || ||||||| ||| |GlaI | || ||||||| ||| ||HhaI | || ||||||| ||| ||| FatI | || ||||||| ||| ||| |CviAII | || ||||||| ||| ||| || NlaIII | || ||||||| ||| ||| || | TatI CviJI | || ||||||| ||| ||| || | |Csp6I HaeIII | || ||||||| ||| ||| || | ||RsaI | MaeIII | || ||||||| ||| ||| || | ||ScaI \ \ \ \\ \\\\\\\ \\\ \\\ \\ \ \\\ GCCGTTACCTATGGCTTAGGTACCTGGCATGCGCCCATGATAGTACTTGGCAAGGAAGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCAATGGATACCGAATCCATGGACCGTACGCGGGTACTATCATGAACCGTTCCTTCTT / / / / /// /// / / ///// / // /// | | | | ||| ||| | | ||||| | |FatI ||TatI | | | | ||| ||| | | ||||| | | |Csp6I | | | | ||| ||| | | ||||| | | ScaI | | | | ||| ||| | | ||||| | | RsaI | | | | ||| ||| | | ||||| | CviAII | | | | ||| ||| | | ||||| NlaIII | | | | ||| ||| | | ||||Hin6I | | | | ||| ||| | | |||GlaI | | | | ||| ||| | | ||FatI | | | | ||| ||| | | ||HhaI | | | | ||| ||| | | |CviAII | | | | ||| ||| | | Cac8I | | | | ||| ||| | EcoRII | | | | ||| ||| | NlaIII | | | | ||| ||| | BssKI | | | | ||| ||| | NspI | | | | ||| ||| | SphI | | | | ||| ||| BseBI | | | | ||| ||| ScrFI | | | | ||| ||HgiCI* | | | | ||| ||Acc65I | | | | ||| |Csp6I | | | | ||| NlaIV | | | | ||| RsaI | | | | ||| SetI | | | | ||KpnI | | | | |Bpu10I | | | | |DdeI | | | | SetI | | | CviJI | | MaeIII | SetI HaeIII CviJI A V T Y G L G T W H A P M I V L G K E E P L P M A * V P G M R P * * Y L A R K N R Y L W L R Y L A C A H D S T W Q G R T ----:----|----:----|----:----|----:----|----:----|----:----| A T V * P K P V Q C A G M I T S P L S S P R * R H S L Y R A H A W S L V Q C P L G N G I A * T G P M R G H Y Y K A L F F AsuI* |CviJI Hpy178III* |HaeIII | AsuI* |Hin4II* | AvaII |BmgT120I | |BmgT120I ||AvaI MboII MseI | ||NlaIV |||BmeT110I \ \ \ \\\ \\\\ CATTTGGATTTTTCAGTCTTAATCTACGAAAGTCTGGACCCTGACAGGCCCGAGAAGGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAACCTAAAAAGTCAGAATTAGATGCTTTCAGACCTGGGACTGTCCGGGCTCTTCCTG / / / // //// // / MboII MseI | |AvaII |||| |AvaI Tsp4CI* | |AsuI* |||| BmeT110I | BmgT120I |||AsuI* | NlaIV ||BmgT120I Hpy178III* |HaeIII |CviJI Hin4II* H L D F S V L I Y E S L D P D R P E K D I W I F Q S * S T K V W T L T G P R R T F G F F S L N L R K S G P * Q A R E G L ----:----|----:----|----:----|----:----|----:----|----:----| C K S K E T K I * S L R S G S L G S F S V N P N K L R L R R F D P G Q C A R S P M Q I K * D * D V F T Q V R V P G L L V MaeII | Hpy99I SfeI* | |SetI |BccI | |TaiI Tsp4CI* || MboII | || BtgZI \ \\ \ \ \\ \ TGTGTGGAAGAACACTACAGCGATGGCGACGTTTGTATTATCATCTAA 550 560 570 580 ----:----|----:----|----:----|----:----|----:--- ACACACCTTCTTGTGATGTCGCTACCGCTGCAAACATAATAGTAGATT /// / / / / ||SfeI* | | MaeII BtgZI |MboII | TaiI BccI | SetI Hpy99I C V E E H Y S D G D V C I I I * V W K N T T A M A T F V L S S X C G R T L Q R W R R L Y Y H L X ----:----|----:----|----:----|----:----|----:--- Q T S S C * L S P S T Q I I M * S H P L V S C R H R R K Y * * R T H F F V V A I A V N T N D D L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BccI 1 Bce83I* 1 BpuEI BceAI 1 BcgI 1 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 2 Bpu10I 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseRI 1 BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspLU11I* 1 PscI,PciI BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 1 BtgZI 1 Cac8I 1 BstC8I Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 8 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 1 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 EcoRII 3 AjnI,Psp6I,PspGI FalI 2 FatI 3 FokI 2 GlaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HinfI 1 HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III Hpy99I 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 4 HpyCH4IV MaeIII 2 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 1 MunI MlyI 1 SchI MnlI 3 MseI 1 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PleI 1 PpsI RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 12 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SphI 1 PaeI,BbuI TaiI 4 TaqI 2 TatI 1 TauI 1 Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 2 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI AsuII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmtI BplI BsaAI BsaBI BsaXI BseMII BsePI BseSI BseYI BsgI BsiI* BsiYI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* HindII HindIII HpaI HpaII Hpy188I KasI MaeI MauBI McrI* MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TfiI TseI TsoI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769