Restriction Map of YVH1/YIR026C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YVH1/YIR026C on chromosome IX from coordinates 405967 to 404873.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.14240

EMBOSS_001 MwoI | CviRI* | | DdeI | | | MnlI | | | | AccI | | | | |Hpy166II | | | | || BspCNI | | | | || |BseMII | | | | || ||MaeIII | | | | || ||| BssKI | | | | || ||| EcoRII | | | | || ||| | ScrFI | | | | || ||| | BseBI CviJI | | | | || ||| | | MnlI \ \ \ \ \ \\ \\\ \ \ \ ATGGCTGGAAATGCAAACTCAGTAGACGAGGAAGTTACCAGGATATTAGGAGGCATATAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACCTTTACGTTTGAGTCATCTGCTCCTTCAATGGTCCTATAATCCTCCGTATATA / / / // // // / / / / | MwoI CviRI* || || |BseMII | | EcoRII TspGWI CviJI || || BspCNI | | BssKI || |AccI | | MnlI || Hpy166II | BseBI |DdeI | ScrFI MnlI MaeIII M A G N A N S V D E E V T R I L G G I Y W L E M Q T Q * T R K L P G Y * E A Y I G W K C K L S R R G S Y Q D I R R H I S ----:----|----:----|----:----|----:----|----:----|----:----| X A P F A F E T S S S T V L I N P P M Y X P Q F H L S L L R P L * W S I L L C I H S S I C V * Y V L F N G P Y * S A Y I TspGWI CviRI* | AciI | ApoI | | TfiI TspEI | TspEI | | HinfI | EciI TaqII | | MseI \ \ \ \ \ \ \ \ \ CTTGGCGGAATCCGTCCAATTATTGACCACAGACCATTGGGTGCAGAATTTAACATTACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAACCGCCTTAGGCAGGTTAATAACTGGTGTCTGGTAACCCACGTCTTAAATTGTAATGA / / / / / / / / / | HinfI | | TaqII CviRI* | MseI BsgI | TfiI | TspEI TspEI AciI EciI ApoI L G G I R P I I D H R P L G A E F N I T L A E S V Q L L T T D H W V Q N L T L L W R N P S N Y * P Q T I G C R I * H Y S ----:----|----:----|----:----|----:----|----:----|----:----| R P P I R G I I S W L G N P A S N L M V D Q R F G D L * Q G C V M P H L I * C * K A S D T W N N V V S W Q T C F K V N S ApoI TspEI | BssKI | EcoRII | | ScrFI | | BseBI MaeIII BsgI | | | SetI Hpy178III* | SetI \ \ \ \ \ \ \ \ CATATTCTTTCTGTTATCAAATTCCAGGTCATTCCAGAGTATCTAATAAGGAAAGGTTAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTATAAGAAAGACAATAGTTTAAGGTCCAGTAAGGTCTCATAGATTATTCCTTTCCAATG / // / / / / | || EcoRII Hpy178III* SetI MaeIII | || BssKI | |BseBI | |ScrFI | SetI TspEI ApoI H I L S V I K F Q V I P E Y L I R K G Y I F F L L S N S R S F Q S I * * G K V T Y S F C Y Q I P G H S R V S N K E R L H ----:----|----:----|----:----|----:----|----:----|----:----| * I R E T I L N W T M G S Y R I L F P * E Y E K Q * * I G P * E L T D L L S L N M N K R N D F E L D N W L I * Y P F T V TseI BbvI |BisI TaqI |MaeIII ||BlsI ClaI BccI |Tsp45I |||CviRI* TaqI \ \ \\ \\\\ \ ACGCTAAAAAACATACCCATCGATGATGATGATGTGACTGATGTGCTGCAATACTTCGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGATTTTTTGTATGGGTAGCTACTACTACTACACTGACTACACGACGTTATGAAGCTA / / / / /// / | BccI | Tsp45I ||CviRI* TaqI ClaI | MaeIII ||TseI TaqI BbvI |BisI BlsI T L K N I P I D D D D V T D V L Q Y F D R * K T Y P S M M M M * L M C C N T S M A K K H T H R * * * C D * C A A I L R * ----:----|----:----|----:----|----:----|----:----|----:----| V S F F M G M S S S S T V S T S C Y K S C A L F C V W R H H H H S Q H A A I S R R * F V Y G D I I I I H S I H Q L V E I XmnI |TfiI |HinfI || TspDTI || | MboI || | BclI || | | DpnI TspDTI || | | |BstKTI TspDTI \ \\ \ \ \\ \ GAAACGAACCGATTCATTGATCAATGCTTGTTCCCCAATGAAGTTGAGTATTCGCCCAGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGCTTGGCTAAGTAACTAGTTACGAACAAGGGGTTACTTCAACTCATAAGCGGGTCT / / / / // / / TspDTI | | | || BclI TspDTI | | | || MboI | | | |DpnI | | | BstKTI | | HinfI | | TfiI | TspDTI XmnI E T N R F I D Q C L F P N E V E Y S P R K R T D S L I N A C S P M K L S I R P D N E P I H * S M L V P Q * S * V F A Q I ----:----|----:----|----:----|----:----|----:----|----:----| S V F R N M S * H K N G L S T S Y E G L H F S G I * Q D I S T G W H L Q T N A W F R V S E N I L A Q E G I F N L I R G S MaeII MboII |PflMI |DraIII |BsiYI* || SetI MwoI MlyI Hpy178III* || TaiI | BcgI PleI HinfI \ \\ \ \ \ \ \ TTAGTAGATTTCAAGAAGAAACCACAACGTGGTGCTGTTTTTGCTCATTGTCAAGCAGGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AATCATCTAAAGTTCTTCTTTGGTGTTGCACCACGACAAAAACGAGTAACAGTTCGTCCT / // / / / // Hpy178III* || MaeII MwoI BcgI |PleI |MboII MlyI |TaiI |SetI BsiYI* DraIII PflMI L V D F K K K P Q R G A V F A H C Q A G * * I S R R N H N V V L F L L I V K Q D S R F Q E E T T T W C C F C S L S S R T ----:----|----:----|----:----|----:----|----:----|----:----| N T S K L F F G C R P A T K A * Q * A P I L L N * S S V V V H H Q K Q E N D L L * Y I E L L F W L T T S N K S M T L C S AvaI XhoI SmlI Hpy178III* |TaqI |BmeT110I ||Hpy178III* ||| MboI ||| BglII ||| XhoII ||| | DpnI ||| | TspDTI ||| | |BstKTI ||| | || MaeIII MaeIII ||| | || | BcgI Hin4II* Tsp45I ||| | || | |SetI |CviJI SetI | TsoI \\\ \ \\ \ \\ \\ \ \ \ CTCTCGAGATCTGTAACCTTCATAGTAGCCTACCTAATGTATCGTTATGGATTGTCACTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAGCTCTAGACATTGGAAGTATCATCGGATGGATTACATAGCAATACCTAACAGTGAT / ///// / /// / / / / / | ||||| | ||MaeIII | | SetI TsoI Tsp45I | ||||| | |BcgI | CviJI MaeIII | ||||| | SetI Hin4II* | ||||| XhoII | ||||| BglII | ||||| MboI | ||||DpnI | |||BstKTI | ||Hpy178III* | ||TspDTI | ||SmlI | ||XhoI | ||AvaI | |BmeT110I | |TaqI | Hpy178III* HinfI L S R S V T F I V A Y L M Y R Y G L S L S R D L * P S * * P T * C I V M D C H Y L E I C N L H S S L P N V S L W I V T I ----:----|----:----|----:----|----:----|----:----|----:----| S E L D T V K M T A * R I Y R * P N D S V R S I Q L R * L L R G L T D N H I T V E R S R Y G E Y Y G V * H I T I S Q * * CviJI CviJI | CviRI* | TspDTI | |MwoI | | ApoI | ||Cac8I | | TspEI | ||| MnlI | | | FatI | ||| | Hpy178III* MboII | | | |CviAII \ \\\ \ \ \ \ \ \ \\ TCAATGGCTATGCACGCTGTCAAGAGGAAGAAACCGAGTGTTGAGCCAAACGAGAATTTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTACCGATACGTGCGACAGTTCTCCTTCTTTGGCTCACAACTCGGTTTGCTCTTAAAG / / / / / / / // // | | | | MnlI Hpy178III* MboII |TspDTI |NlaIII | | | Cac8I CviJI TspEI | | CviRI* ApoI | MwoI CviJI S M A M H A V K R K K P S V E P N E N F Q W L C T L S R G R N R V L S Q T R I S N G Y A R C Q E E E T E C * A K R E F H ----:----|----:----|----:----|----:----|----:----|----:----| D I A I C A T L L F F G L T S G F S F K I L P * A R Q * S S S V S H Q A L R S N * H S H V S D L P L F R T N L W V L I E BsaXI NlaIII Hin4I |BseYI | TspEI TaqII BsaXI TaqI TaqI ||Hin4I \ \ \ \ \ \ \\\ ATGGAACAATTACATCTCTTTGAGAAAATGGGTGGAGATTTTGTCGATTTCGACAACCCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTGTTAATGTAGAGAAACTCTTTTACCCACCTCTAAAACAGCTAAAGCTGTTGGGT // / / / / / // / |FatI TspEI | | BsaXI TaqI || GsaI CviAII | Hin4I |BsaXI TaqII |Hin4I TaqI M E Q L H L F E K M G G D F V D F D N P W N N Y I S L R K W V E I L S I S T T Q G T I T S L * E N G W R F C R F R Q P S ----:----|----:----|----:----|----:----|----:----|----:----| M S C N C R K S F I P P S K T S K S L G * P V I V D R Q S F P H L N Q R N R C G H F L * M E K L F H T S I K D I E V V W BinI* MwoI | MboI |BtsI | XhoII TseI |TspRI | |Eco57I |BisI || AluI | |Eco57MI |BccI GsaI || CviJI | ||DpnI ||BlsI CviJI || | SetI | |||BstKTI ||| TspEI \ \\ \ \ \ \\\\ \\\ \ GCCTATAAGCAGTGGAAGCTGAAGCAATCTATCAAGTTAGATCCATCGGGCAGCGAATTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGATATTCGTCACCTTCGACTTCGTTAGATAGTTCAATCTAGGTAGCCCGTCGCTTAAC / / / / / / / / // / /// / BseYI | | | | CviJI | | || XhoII ||TseI TspEI CviJI | | | | AluI | | || MboI |BccI | | | SetI | | |DpnI |BisI | | BtsI | | BstKTI BlsI | MwoI | Eco57MI TspRI | Eco57I BinI* A Y K Q W K L K Q S I K L D P S G S E L P I S S G S * S N L S S * I H R A A N W L * A V E A E A I Y Q V R S I G Q R I G ----:----|----:----|----:----|----:----|----:----|----:----| A * L C H F S F C D I L N S G D P L S N L R Y A T S A S A I * * T L D M P C R I G I L L P L Q L L R D L * I W R A A F Q BbvI | TspEI | BsmAI | Eco31I | | Hpy178III* | | | Hin4I | | | Hin4I | | | | MseI Hin4I | | | | |AhaIII* Hin4I | | | | || TfiI | TspEI | | | | || HinfI PleI | | MseI | | | | || | Hpy188I Hpy99I | | |BseMII | | | | || | |HinfI |MlyI | | ||BspCNI \ \ \ \ \\ \ \\ \\ \ \ \\\ GTCTCCAATTCTGGAATGTTTAAAGATTCGGAGTCGTCGCAAGACTTGGATAAATTAACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGGTTAAGACCTTACAAATTTCTAAGCCTCAGCAGCGTTCTGAACCTATTTAATTGA / // / // // / / / //// | || | |MseI || | | Hin4I |||MseI | || | | || | | Hin4I ||TspEI | || | | || | PleI |BspCNI | || | | || | MlyI BseMII | || | | || Hpy99I | || | | || HinfI | || | | |Hpy188I | || | | HinfI | || | | TfiI | || | AhaIII* | || Hpy178III* | |Hin4I | |Hin4I | Eco31I | BsmAI | TspEI BbvI V S N S G M F K D S E S S Q D L D K L T S P I L E C L K I R S R R K T W I N * L L Q F W N V * R F G V V A R L G * I N * ----:----|----:----|----:----|----:----|----:----|----:----| T E L E P I N L S E S D D C S K S L N V P R W N Q F T * L N P T T A L S P Y I L D G I R S H K F I R L R R L V Q I F * S MaeIII Tsp45I BstEII | SetI SapI | Eco57I AluI | Eco57MI CviJI | |MboII Ksp632I* | || AciI |DdeI | || | OliI BtsI ||SetI HphI | || | MslI TspRI CviRI* TspEI BtgZI \\\ \ \ \\ \ \ \ \ \ \ GAAGCTGAGAAGAGCAAGGTCACCGCAGTGAGATGTAAGAAGTGCAGAACCAAATTGGCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGACTCTTCTCGTTCCAGTGGCGTCACTCTACATTCTTCACGTCTTGGTTTAACCGC / / // / / / / / / / / / | | || HphI | | | | MslI BtsI CviRI* TspEI | | |DdeI | | | | OliI | | Ksp632I* | | | | AciI | | SapI | | | BstEII | CviJI | | | Tsp45I | AluI | | | MaeIII SetI | | | TspRI | | MboII | Eco57MI | Eco57I SetI E A E K S K V T A V R C K K C R T K L A K L R R A R S P Q * D V R S A E P N W R S * E E Q G H R S E M * E V Q N Q I G V ----:----|----:----|----:----|----:----|----:----|----:----| S A S F L L T V A T L H L F H L V L N A Q L Q S S C P * R L S I Y S T C F W I P F S L L A L D G C H S T L L A S G F Q R Hin6I TfiI FnuDII* HinfI |GlaI | MnlI ||FatI | | Hin4I ||HhaI | | Hin4I BsgI |||CviAII | | | TspDTI TspDTI |||| NlaIII | | | Hpy188I MnlI \ \\\\ \ \ \ \ \ \ TTATCTACATCTTTCATCGCGCATGACCCACCAAGTAAGGAATCATCAGAGGGACACTTC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGATGTAGAAAGTAGCGCGTACTGGGTGGTTCATTCCTTAGTAGTCTCCCTGTGAAG / / /// // / / / // / | BtgZI ||| |FatI | | | |Hpy188I MnlI TspDTI ||| CviAII | | | TspDTI BsgI ||NlaIII | | HinfI ||Hin6I | | TfiI |GlaI | MnlI FnuDII* Hin4I HhaI Hin4I L S T S F I A H D P P S K E S S E G H F Y L H L S S R M T H Q V R N H Q R D T S I Y I F H R A * P T K * G I I R G T L H ----:----|----:----|----:----|----:----|----:----|----:----| N D V D K M A C S G G L L S D D S P C K T I * M K * R A H G V L Y P I M L P V S * R C R E D R M V W W T L F * * L S V E Hpy178III* | BslFI | | AsuI* | | |BmgT120I | | ||CviJI | | ||HaeIII | | |||AciI | | |||BisI | | ||||BlsI Hpy178III* | | |||||TauI | HinfI PleI | | |||||| Hin4I | |MaeIII |MlyI | | |||||| Hin4I BccI | |Tsp45I || TspEI TspDTI \ \ \\\\\\ \ \ \ \\ \\ \ \ ATCAAGAGGGCCGCCAACTCCCATCGTATTATTGATATTCAAGAGTCACAAGCAAATTGC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCTCCCGGCGGTTGAGGGTAGCATAATAACTATAAGTTCTCAGTGTTCGTTTAACG / ///// / / / / / / | ||||AciI BccI | | | PleI TspDTI | |||BisI | | | MlyI TspEI | ||Hin4I | | Tsp45I | ||Hin4I | | MaeIII | ||AsuI* | HinfI | ||BlsI Hpy178III* | |BmgT120I | |HaeIII | |CviJI | |TauI | BslFI Hpy178III* I K R A A N S H R I I D I Q E S Q A N C S R G P P T P I V L L I F K S H K Q I A Q E G R Q L P S Y Y * Y S R V T S K L L ----:----|----:----|----:----|----:----|----:----|----:----| M L L A A L E W R I I S I * S D C A F Q * * S P R W S G D Y * Q Y E L T V L L N D L P G G V G M T N N I N L L * L C I A SfaNI CviRI* |SetI | BseGI ||MseI | | SetI TaqI |||AhaIII* | | | FokI Cac8I Hin4II* \ \\\\ \ \ \ \ \ \ TCTCATTTTTTCATCGAACCTTTAAAATGGATGCAACCTGAACTACAAGGCAAGCAAGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTAAAAAAGTAGCTTGGAAATTTTACCTACGTTGGACTTGATGTTCCGTTCGTTCTC // // / / / / / |SetI |SfaNI | SetI FokI | Hin4II* TaqI |MseI CviRI* Cac8I AhaIII* BseGI S H F F I E P L K W M Q P E L Q G K Q E L I F S S N L * N G C N L N Y K A S K S S F F H R T F K M D A T * T T R Q A R V ----:----|----:----|----:----|----:----|----:----|----:----| E * K K M S G K F H I C G S S C P L C S S E N K * R V K L I S A V Q V V L C A L R M K E D F R * F P H L R F * L A L L L FatI |CviAII || NlaIII || |BssKI || |EcoRII || || ScrFI || || BseBI AciI TspDTI || || | CviJI | MaeIII BsrI \ \\ \\ \ \ \ \ \ TTAGAAGGGAAGTTTTCATGTCCAGGCTGTTCAAGTAAAGTTGGCGGTTACAACTGGAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTCCCTTCAAAAGTACAGGTCCGACAAGTTCATTTCAACCGCCAATGTTGACCTTT / / // / / / / / TspDTI | || | EcoRII AciI | BsrI | || | BssKI MaeIII | || | CviJI | || BseBI | || ScrFI | |FatI | CviAII NlaIII L E G K F S C P G C S S K V G G Y N W K * K G S F H V Q A V Q V K L A V T T G K R R E V F M S R L F K * S W R L Q L E R ----:----|----:----|----:----|----:----|----:----|----:----| N S P F N E H G P Q E L L T P P * L Q F T L L S T K M D L S N L Y L Q R N C S S * F P L K * T W A T * T F N A T V V P F MboI XhoII | DpnI | |BstKTI SetI | ||MaeI |CviRI* | ||| BinI* || SpeI | ||| |SetI || |MaeI | ||| ||CviRI* BseGI || |AarI | ||| ||| FokI |BsgI AciI FauI || |BspMI \ \\\ \\\ \ \\ \ \ \\ \\ GGATCTAGGTGCAGTTGTGGTAAGTGGGTCATCCCCGCTATCCACCTGCAAACTAGTAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGATCCACGTCAACACCATTCACCCAGTAGGGGCGATAGGTGGACGTTTGATCATTT // /// // / // / // / /// || ||| |CviRI* FokI |BsgI AciI || CviRI* ||BspMI || ||| BinI* BseGI |FauI ||AarI || ||MaeI SetI |SpeI || |SetI MaeI || XhoII || MboI |DpnI BstKTI G S R C S C G K W V I P A I H L Q T S K D L G A V V V S G S S P L S T C K L V K I * V Q L W * V G H P R Y P P A N * * S ----:----|----:----|----:----|----:----|----:----|----:----| P D L H L Q P L H T M G A I W R C V L L L I * T C N H Y T P * G R * G G A F * Y S R P A T T T L P D D G S D V Q L S T F MboI FatI | DpnI |CviAII | |BstKTI || NlaIII TfiI | ||TspEI TspRI || | MseI HinfI | ||| BinI* BtsI |TsoI || | |TspEI | Hpy188I \ \\\ \ \ \\ \\ \ \\ \ \ GTGGATCAATTTCCCTTACAATCCACTGCTTTGCCCAACATGGTTAATTTTGAATCCGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTAGTTAAAGGGAATGTTAGGTGACGAAACGGGTTGTACCAATTAAAACTTAGGCTC // / // / / / // / / // || | |BinI* TspRI TsoI | || | TspEI |Hpy188I || | TspEI BtsI | || MseI HinfI || MboI | |FatI TfiI |DpnI | CviAII BstKTI NlaIII V D Q F P L Q S T A L P N M V N F E S E W I N F P Y N P L L C P T W L I L N P R G S I S L T I H C F A Q H G * F * I R E ----:----|----:----|----:----|----:----|----:----|----:----| T S * N G K C D V A K G L M T L K S D S L P D I E R V I W Q K A W C P * N Q I R H I L K G * L G S S Q G V H N I K F G L AAAGTAAATAGATAA 1090 ----:----|----: TTTCATTTATCTATT K V N R * K * I D X S K * I X ----:----|----: F T F L Y S L L Y I F Y I S L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AhaIII* 2 DraI AluI 2 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 2 BseXI,BstV1I,Lsp1109I BccI 3 BcgI 1 BclI 1 FbaI,Ksp22I BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 1 BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseYI 1 BsgI 3 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 2 BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 5 BtgZI 1 BtsI 3 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII CviAII 4 CviJI 9 CviKI-1 CviRI* 8 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 5 MalI DraIII 1 AdeI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoRII 3 AjnI,Psp6I,PspGI FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 GsaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HinfI 8 HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 8 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MlyI 3 SchI MnlI 5 MseI 5 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI SapI 1 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SetI 12 SfaNI 1 LweI SmlI 1 SmoI SpeI 1 BcuI,AhlI TaiI 1 TaqI 6 TaqII 2 TauI 1 TfiI 5 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 4 NmuCI TspDTI 9 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BciVI BdaI BetI* BfiI BglI BmtI BplI Bpu10I BsaAI BsaBI BsePI BseRI BseSI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtrI CauII* Cfr10I Cfr9I CfrI Csp6I CspCI CviQI DinI DraII DrdI DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HindII HindIII HpaI HpaII KasI KpnI MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SauI* ScaI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TatI Tsp4CI* TspMI TstI Tth111I VspI XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769