Restriction Map of CSS1/YIL169C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CSS1/YIL169C on chromosome IX from coordinates 26106 to 23119.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28710

EMBOSS_001 TseI AluI CviJI |BisI ||BlsI ||SetI ||| MwoI ||| | AluI MseI ||| | CviJI |PmeI ||| | | SetI |AhaIII* ||| | | | AsuI* ||BbvI ||| | | | |CviJI ||| ApoI ||| | | | |HaeIII ||| TspEI ||| | | | |BmgT120I \\\ \ \\\ \ \ \ \\ ATGTTCAATCGTTTAAACAAATTCCAAGCTGCTTTAGCTTTGGCCCTTTACTCTCAAAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAGTTAGCAAATTTGTTTAAGGTTCGACGAAATCGAAACCGGGAAATGAGAGTTTCA // / / / //// / / /// || | | | |||| | CviJI ||AsuI* || | | | |||| | AluI |BmgT120I || | | | |||| SetI HaeIII || | | | |||MwoI CviJI || | | | |||TseI || | | | ||BisI || | | | |BlsI || | | | CviJI || | | | AluI || | | SetI || | TspEI || | ApoI || BbvI |MseI AhaIII* PmeI M F N R L N K F Q A A L A L A L Y S Q S C S I V * T N S K L L * L W P F T L K V V Q S F K Q I P S C F S F G P L L S K C ----:----|----:----|----:----|----:----|----:----|----:----| X N L R K F L N W A A K A K A R * E * L X T * D N L C I G L Q K L K P G K S E F H E I T * V F E L S S * S Q G K V R L T TatI |Csp6I SetI AluI SetI ||RsaI |TspEI CviJI OliI ||ScaI || FokI | SetI MslI CviRI* ||| SfeI* || | MnlI | BseGI | BstXI \ \\\ \ \\ \ \ \ \ \ \ GCATTGGGTCAGTACTATAGCAATAGCACCTCAATTTCAAGCAACAGCTCATCCACCTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAACCCAGTCATGATATCGTTATCGTGGAGTTAAAGTTCGTTGTCGAGTAGGTGGAGA / /// / / / / / / / / / / CviRI* ||| SfeI* SetI | | FokI | CviJI | | MslI ||TatI | MnlI | BseGI | | OliI |Csp6I TspEI | AluI | BstXI ScaI SetI SetI RsaI A L G Q Y Y S N S T S I S S N S S S T S H W V S T I A I A P Q F Q A T A H P P L I G S V L * Q * H L N F K Q Q L I H L C ----:----|----:----|----:----|----:----|----:----|----:----| A N P * Y * L L L V E I E L L L E D V E H M P D T S Y C Y C R L K L C C S M W R C Q T L V I A I A G * N * A V A * G G R TspGWI | BinI* | | Hpy178III* | | | MboI | | | BamHI | | | XhoII | | | | DpnI | | | | NlaIV | | | | |BstKTI | | | | || MnlI | | | | || | BinI* | | | | || | |TaqI | | | | || | ||MboI | | | | || | ||| DpnI | | | | || | ||| |BstKTI | | | | || | ||| || BseMII | | | | || | ||| || |FokI | | | | || | ||| || |BspCNI | | | | || | ||| || ||BplI | | | | || | ||| || ||BplI | | | | || | ||| || ||| BsmAI BseGI MnlI | | | | || | ||| || ||| | DdeI | DrdI \ \ \ \ \ \\ \ \\\ \\ \\\ \ \ \ \ GTGGTATCAAGTTCCTCTGGATCCGTTTCGATCAGTAGTTCTATTGCTGAGACATCCTCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATAGTTCAAGGAGACCTAGGCAAAGCTAGTCATCAAGATAACGACTCTGTAGGAGC / / / /// / / // / /// / / / / MnlI | | ||| | | || | ||| | | | DrdI | | ||| | | || | ||| | | BseGI | | ||| | | || | ||| | | DdeI | | ||| | | || | ||| | BsmAI | | ||| | | || | ||| FokI | | ||| | | || | ||BspCNI | | ||| | | || | |BseMII | | ||| | | || | BplI | | ||| | | || | BplI | | ||| | | || MboI | | ||| | | |DpnI | | ||| | | BstKTI | | ||| | | TaqI | | ||| | BinI* | | ||| XhoII | | ||| BamHI | | ||| MnlI | | ||| MboI | | ||NlaIV | | ||DpnI | | |BstKTI | | Hpy178III* | BinI* TspGWI V V S S S S G S V S I S S S I A E T S S W Y Q V P L D P F R S V V L L L R H P R G I K F L W I R F D Q * F Y C * D I L V ----:----|----:----|----:----|----:----|----:----|----:----| T T D L E E P D T E I L L E I A S V D E Q P I L N R Q I R K S * Y N * Q Q S M R H Y * T G R S G N R D T T R N S L C G R AvaI XhoI SmlI BplI Hpy178III* BplI |TaqI EcoRV AluI |TaqII | SmlI CviJI |BmeT110I AciI | AflII FokI | SetI || FokI | MnlI | |MseI | TspDTI | |BseGI || BsmAI \ \ \ \\ \ \ \ \\ \\ \ TCCGCTACCGATATCTTAAGTTCTATCACACAATCAGCTTCATCCACTTCTGGTGTCTCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGATGGCTATAGAATTCAAGATAGTGTGTTAGTCGAAGTAGGTGAAGACCACAGAGC // / / // / / / // / // || BplI EcoRV |AflII | | | |BseGI | |BmeT110I || BplI |SmlI | | | CviJI | |HgiJII* |MnlI MseI | | | AluI | |HgiAI* AciI | | SetI | |TaqI | FokI | |SacI TspDTI | |SduI | |SetI | Hpy178III* TaqII S A T D I L S S I T Q S A S S T S G V S P L P I S * V L S H N Q L H P L L V S R R Y R Y L K F Y H T I S F I H F W C L E ----:----|----:----|----:----|----:----|----:----|----:----| D A V S I K L E I V C D A E D V E P T E T R * R Y R L N * * V I L K M W K Q H R G S G I D * T R D C L * S * G S R T D R AluI CviJI Ecl136II | SetI | SduI | SacI SmlI | HgiAI* MnlI | HgiJII* | BsmAI | | AsuI* | | AluI | | AvaII | | CviJI | | |MboII | | | SetI | | |BmgT120I | | | | MwoI | | || BseGI | | | | |FokI | | || | Bce83I* | | | | || MboII | | || | | BccI | | | | || CviJI | | || | | | Ksp632I* | | | | || TspDTI BseGI | | || | | | | MnlI | | | | || | TspGWI | Ksp632I* \ \ \\ \ \ \ \ \ \ \ \ \ \\ \ \ \ \ AGCTCTGTCGGTCCATCCTCTTCCTCTGTTGTCTCAAGCTCTGTCAGCCAATCCTCTTCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGACAGCCAGGTAGGAGAAGGAGACAACAGAGTTCGAGACAGTCGGTTAGGAGAAGT // / //// / / // / /// // /// / / || BsmAI |||| | | || | ||| || ||| TspGWI BseGI || FokI |||| | | || | ||| || ||| FokI || |||| | | || | ||| || ||CviJI || |||| | | || | ||| || |MboII || |||| | | || | ||| || TspDTI || |||| | | || | ||| |MwoI || |||| | | || | ||| BsmAI || |||| | | || | ||CviJI || |||| | | || | ||AluI || |||| | | || | |SmlI || |||| | | || | SetI || |||| | | || MnlI || |||| | | |Ksp632I* || |||| | | MnlI || |||| | BccI || |||| Bce83I* || |||AvaII || |||AsuI* || ||BmgT120I || |BseGI || MboII |Ecl136II |CviJI |AluI SmlI XhoI AvaI S S V G P S S S S V V S S S V S Q S S S A L S V H P L P L L S Q A L S A N P L H L C R S I L F L C C L K L C Q P I L F I ----:----|----:----|----:----|----:----|----:----|----:----| L E T P G D E E E T T E L E T L W D E E S S Q R D M R K R Q Q R L S Q * G I R K A R D T W G R G R N D * A R D A L G R * AluI Bce83I* CviJI | AluI | SetI | CviJI | | MboII | | SetI | | Eco57I | | |AlwNI | | Eco57MI | | || Hpy188I | | | MboII | | || | SmlI MnlI Hpy188I | | | | MboII | | || | | BsmAI \ \ \ \ \ \ \ \ \ \\ \ \ \ TCCGTTTCTGATGTATCAAGCTCTGTCAGTCAATCTTCTTCTTCAGCTTCTGATGTCTCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAAAGACTACATAGTTCGAGACAGTCAGTTAGAAGAAGAAGTCGAAGACTACAGAGT // / / / // / / / / / / / || Hpy188I | | || | MboII | | | Hpy188I SetI |Ksp632I* | | || MboII | | AlwNI MnlI | | |MboII | | CviJI | | Eco57MI | | AluI | | Eco57I | SetI | CviJI Bce83I* | AluI SetI S V S D V S S S V S Q S S S S A S D V S P F L M Y Q A L S V N L L L Q L L M S Q R F * C I K L C Q S I F F F S F * C L K ----:----|----:----|----:----|----:----|----:----|----:----| D T E S T D L E T L * D E E E A E S T E M R K Q H I L S Q * D I K K K L K Q H R G N R I Y * A R D T L R R R * S R I D * MnlI Hpy188I | SmlI | | BsmAI | | | AluI | | | CviJI | | | | SetI | | | | | MboII AluI | | | | | Eco57I AluI CviJI | | | | | Eco57MI CviJI | SetI | | | | | | MboII | SetI | | Bce83I* | | | | | | | MboII \ \ \ \ \ \ \ \ \ \ \ \ \ AGCTCTGTCAGTCAATCAGCTTCCTCTACTTCTGATGTCTCAAGCTCTGTCAGTCAATCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGACAGTCAGTTAGTCGAAGGAGATGAAGACTACAGAGTTCGAGACAGTCAGTTAGA // / / / / / /// / // / / || BsmAI | | Bce83I* Hpy188I ||| | || | MboII |CviJI | CviJI MnlI ||| | || MboII |AluI | AluI ||| | |MboII SmlI SetI ||| | Eco57MI ||| | Eco57I ||| BsmAI ||CviJI ||AluI |SmlI SetI S S V S Q S A S S T S D V S S S V S Q S A L S V N Q L P L L L M S Q A L S V N L L C Q S I S F L Y F * C L K L C Q S I F ----:----|----:----|----:----|----:----|----:----|----:----| L E T L * D A E E V E S T E L E T L * D L S Q * D I L K R * K Q H R L S Q * D I A R D T L * S G R S R I D * A R D T L R DdeI BbvCI Bpu10I Bce83I* | AluI AluI AluI | CviJI CviJI CviJI | | SetI | SetI | SetI | | |AlwNI | |AlwNI | | MboII | | || MnlI | || Hpy188I | | | MboII | | || Hpy188I \ \\ \ \ \ \ \ \ \ \\ \ TCTTCTTCAGCTTCTGATGTATCAAGCTCTGTCAGTCAATCTTCTTCCTCAGCTTCTGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGAAGTCGAAGACTACATAGTTCGAGACAGTCAGTTAGAAGAAGGAGTCGAAGACTA / / / / / / / / /// / // | | Hpy188I | | | MboII | ||| | |BseMII | AlwNI | | MboII | ||| | BspCNI | CviJI | CviJI | ||| Hpy188I | AluI | AluI | ||| MnlI SetI SetI | ||AlwNI | ||CviJI | ||AluI | |Bpu10I | |BbvCI | |DdeI | SetI Bce83I* S S S A S D V S S S V S Q S S S S A S D L L Q L L M Y Q A L S V N L L P Q L L M F F S F * C I K L C Q S I F F L S F * C ----:----|----:----|----:----|----:----|----:----|----:----| E E E A E S T D L E T L * D E E E A E S K K K L K Q H I L S Q * D I K K R L K Q R R * S R I Y * A R D T L R R G * S R I AluI CviJI | SetI | | DdeI | | BbvCI | | Bpu10I | | Bce83I* | | |MwoI | | || AluI | | || CviJI | | || | SetI | | || | |AlwNI | | || | || MnlI | | || | || Hpy188I BspCNI | | || | || | BspCNI |BseMII | | || | || | |BseMII ||SmlI | | || | || | ||SmlI ||| BsmAI | | || | || | ||| BsmAI ||| | AluI | | || | || | ||| | AluI ||| | CviJI | | || | || | ||| | CviJI ||| | | SetI | | || | || | ||| | | SetI \\\ \ \ \ \ \ \\ \ \\ \ \\\ \ \ \ GTCTCAAGCTCTGTCAGTCAATCAGCTTCCTCAGCTTCTGATGTCTCAAGCTCTGTCAGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGTTCGAGACAGTCAGTTAGTCGAAGGAGTCGAAGACTACAGAGTTCGAGACAGTCA /// / / / / /// / // /// / ||| BsmAI | | | ||| | || ||| BsmAI ||CviJI | | | ||| | || ||CviJI ||AluI | | | ||| | || ||AluI |SmlI | | | ||| | || |SmlI SetI | | | ||| | || SetI | | | ||| | |BseMII | | | ||| | BspCNI | | | ||| Hpy188I | | | ||| MnlI | | | ||AlwNI | | | ||CviJI | | | ||AluI | | | |Bpu10I | | | |BbvCI | | | |DdeI | | | SetI | | Bce83I* | | MwoI | CviJI | AluI SetI V S S S V S Q S A S S A S D V S S S V S S Q A L S V N Q L P Q L L M S Q A L S V L K L C Q S I S F L S F * C L K L C Q S ----:----|----:----|----:----|----:----|----:----|----:----| T E L E T L * D A E E A E S T E L E T L H R L S Q * D I L K R L K Q H R L S Q * D * A R D T L * S G * S R I D * A R D T MnlI Hpy188I | SmlI | | BsmAI | | | AluI | | | CviJI | | | | SetI | | | | | MboII AluI | | | | | Eco57I CviJI | | | | | Eco57MI AluI | SetI | | | | | | MboII CviJI | | Bce83I* | | | | | | | MboII | SetI \ \ \ \ \ \ \ \ \ \ \ \ \ CAATCAGCTTCCTCTACTTCTGATGTCTCAAGCTCTGTCAGTCAATCTTCTTCTTCAGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGTCGAAGGAGATGAAGACTACAGAGTTCGAGACAGTCAGTTAGAAGAAGAAGTCGA / / / / /// / // / / / / | | Bce83I* Hpy188I ||| | || | MboII | AlwNI | CviJI MnlI ||| | || MboII | CviJI | AluI ||| | |MboII | AluI SetI ||| | Eco57MI SetI ||| | Eco57I ||| BsmAI ||CviJI ||AluI |SmlI SetI Q S A S S T S D V S S S V S Q S S S S A N Q L P L L L M S Q A L S V N L L L Q L I S F L Y F * C L K L C Q S I F F F S F ----:----|----:----|----:----|----:----|----:----|----:----| * D A E E V E S T E L E T L * D E E E A D I L K R * K Q H R L S Q * D I K K K L L * S G R S R I D * A R D T L R R R * S DdeI BbvCI Bpu10I Bce83I* | AluI | CviJI | | SetI | | |AlwNI | | || MnlI | | || Hpy188I | | || | BspCNI | | || | |BseMII AluI | | || | ||SmlI CviJI | | || | ||| BsmAI | SetI | | || | ||| | AluI AlwNI | | MboII | | || | ||| | CviJI | Hpy188I | | | MboII | | || | ||| | | SetI \ \ \ \ \ \ \ \ \\ \ \\\ \ \ \ TCTGATGTATCAAGCTCTGTCAGTCAATCTTCTTCCTCAGCTTCTGATGTCTCAAGCTCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTACATAGTTCGAGACAGTCAGTTAGAAGAAGGAGTCGAAGACTACAGAGTTCGAGA / / / / / / /// / // /// / Hpy188I | | | MboII | ||| | || ||| BsmAI | | MboII | ||| | || ||CviJI | CviJI | ||| | || ||AluI | AluI | ||| | || |SmlI SetI | ||| | || SetI | ||| | |BseMII | ||| | BspCNI | ||| Hpy188I | ||| MnlI | ||AlwNI | ||CviJI | ||AluI | |Bpu10I | |BbvCI | |DdeI | SetI Bce83I* S D V S S S V S Q S S S S A S D V S S S L M Y Q A L S V N L L P Q L L M S Q A L * C I K L C Q S I F F L S F * C L K L C ----:----|----:----|----:----|----:----|----:----|----:----| E S T D L E T L * D E E E A E S T E L E K Q H I L S Q * D I K K R L K Q H R L S R I Y * A R D T L R R G * S R I D * A R MnlI Hpy188I | SmlI AluI | | BsmAI AluI CviJI | | | AluI CviJI | SetI | | | CviJI | SetI | | Bce83I* | | | | SetI | | Bce83I* \ \ \ \ \ \ \ \ \ \ \ GTCAGTCAATCAGCTTCCTCTACTTCTGATGTCTCAAGCTCTGTCAGTCAATCAGCTTCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTCAGTTAGTCGAAGGAGATGAAGACTACAGAGTTCGAGACAGTCAGTTAGTCGAAGG / / / / /// / / / / | | Bce83I* Hpy188I ||| BsmAI | | Bce83I* | CviJI MnlI ||CviJI | CviJI | AluI ||AluI | AluI SetI |SmlI SetI SetI V S Q S A S S T S D V S S S V S Q S A S S V N Q L P L L L M S Q A L S V N Q L P Q S I S F L Y F * C L K L C Q S I S F L ----:----|----:----|----:----|----:----|----:----|----:----| T L * D A E E V E S T E L E T L * D A E Q * D I L K R * K Q H R L S Q * D I L K D T L * S G R S R I D * A R D T L * S G SmlI | BsmAI | | AluI | | CviJI | | | SetI | | | | TseI | | | | MwoI BbvI | | | | |FokI | BseGI AluI | | | | |BisI | | BsmAI CviJI | | | | ||BlsI | | Bce83I* |SmlI MnlI | | | | |||CviJI | | | AciI ||SetI \ \ \ \ \ \\\\ \ \ \ \ \\\ TCTACTTCTGGTGTCTCAAGCTCTGGCAGCCAATCAGTCTCATCCGCTTCTGGTAGCTCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGAAGACCACAGAGTTCGAGACCGTCGGTTAGTCAGAGTAGGCGAAGACCATCGAGT / /// // /// / / / / / / / / MnlI ||| || ||| FokI | | | BsmAI | | SetI ||| || ||CviJI | | | AciI | CviJI ||| || ||TseI | | BbvI | AluI ||| || |BisI | Bce83I* SetI ||| || BlsI BseGI ||| |MwoI ||| BsmAI ||CviJI ||AluI |SmlI SetI S T S G V S S S G S Q S V S S A S G S S L L L V S Q A L A A N Q S H P L L V A Q Y F W C L K L W Q P I S L I R F W * L K ----:----|----:----|----:----|----:----|----:----|----:----| E V E P T E L E P L W D T E D A E P L E R * K Q H R L S Q C G I L R M R K Q Y S R S R T D * A R A A L * D * G S R T A * MnlI | SetI | BseGI AluI | | AciI CviJI | | | MnlI BetI* | SetI FokI | | | | MwoI |HpaII MnlI TspEI \ \ \ \ \ \ \ \ \\ \ \ AGCTCATTCCCTCAATCAACCTCATCCGCTTCTACTGCCTCCGGTTCTGCCACTTCCAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGTAAGGGAGTTAGTTGGAGTAGGCGAAGATGACGGAGGCCAAGACGGTGAAGGTTA // / /// // / // / |CviJI FokI ||BseGI || MwoI || MnlI |AluI |MnlI |MnlI |BetI* SmlI SetI AciI HpaII S S F P Q S T S S A S T A S G S A T S N A H S L N Q P H P L L L P P V L P L P I L I P S I N L I R F Y C L R F C H F Q F ----:----|----:----|----:----|----:----|----:----|----:----| L E N G * D V E D A E V A E P E A V E L L S M G E I L R M R K * Q R R N Q W K W A * E R L * G * G S R S G G T R G S G I Bce83I* | MaeI | | MwoI | | BstAPI | | | SfaNI | | | CviRI* SmlI | | | | Cac8I | Eco57I | | | | | Hin6I | Eco57MI | | | | | |GlaI | | MboII | | | | | ||HhaI MboII \ \ \ \ \ \ \ \ \\\ \ TCCTTGAGTTCCATTACTTCTTCAGCATCTAGTGCAAGCGCAACTGCTTCCAACTCCCTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAACTCAAGGTAATGAAGAAGTCGTAGATCACGTTCGCGTTGACGAAGGTTGAGGGAA / / / / / / / / / /// / | | | MboII | | | | | ||Hin6I MboII | | SmlI | | | | | |GlaI | Eco57MI | | | | | SfaNI | Eco57I | | | | | HhaI TspEI | | | | Cac8I | | | CviRI* | | MaeI | BstAPI | MwoI Bce83I* S L S S I T S S A S S A S A T A S N S L P * V P L L L Q H L V Q A Q L L P T P F L E F H Y F F S I * C K R N C F Q L P F ----:----|----:----|----:----|----:----|----:----|----:----| E K L E M V E E A D L A L A V A E L E R N R S N W * K K L M * H L R L Q K W S G G Q T G N S R * C R T C A C S S G V G K MboI MmeI TspRI Csp6I | DpnI BccI |RsaI BtgZI | |BstKTI HphI \ \\ \ \ \\ \ TCTTCCAGCGATGGTACTATCTATCTACCAACTACTACAATCAGTGGTGATCTAACTCTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGTCGCTACCATGATAGATAGATGGTTGATGATGTTAGTCACCACTAGATTGAGAA / / // / / // / / BccI | |Csp6I BtgZI TspRI || MboI HphI | RsaI |DpnI MmeI BstKTI S S S D G T I Y L P T T T I S G D L T L L P A M V L S I Y Q L L Q S V V I * L L F Q R W Y Y L S T N Y Y N Q W * S N S Y ----:----|----:----|----:----|----:----|----:----|----:----| E E L S P V I * R G V V V I L P S R V R K K W R H Y * R D V L * * L * H H D L E R G A I T S D I * W S S C D T T I * S K TseI |BisI ||BlsI |||AluI |||CviJI |||PvuII |||NspBII* |||| SetI |||| |MwoI |||| |HgiCI* |||| |BstAPI |||| || NlaIV |||| || | MlyI |||| || | PleI TspEI |||| || | |BbvI | CviRI* |||| || | |TspEI BsrI | Hin4II* SetI |||| || | || HinfI \ \ \ \ \\\\ \\ \ \\ \ ACTGGTAAAGTAATTGCAACAGAAGGTGTTGTGGTCGCAGCTGGTGCCAAATTGACTCTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCATTTCATTAACGTTGTCTTCCACAACACCAGCGTCGACCACGGTTTAACTGAGAT / // / /// / /// / / BsrI |CviRI* SetI ||| | ||| | HinfI Hin4II* ||| | ||| TspEI TspEI ||| | ||| BbvI ||| | ||PleI ||| | |MlyI ||| | HgiCI* ||| NlaIV ||NspBII* ||BstAPI ||PvuII ||CviJI ||MwoI ||TseI ||AluI |BisI BlsI SetI T G K V I A T E G V V V A A G A K L T L L V K * L Q Q K V L W S Q L V P N * L Y W * S N C N R R C C G R S W C Q I D S T ----:----|----:----|----:----|----:----|----:----|----:----| V P L T I A V S P T T T A A P A L N V R * Q Y L L Q L L L H Q P R L Q H W I S E S T F Y N C C F T N H D C S T G F Q S * DdeI | AluI | CviJI | PvuII | NspBII* | | SetI | | | DrdI | | | BspCNI | | | |BseMII | | | || AccI | | | || |Hpy166II MaeIII | | | || || MaeIII Tsp45I SspI | | | || || Tsp45I Tsp4CI* | HphI | | SetI | || || Tsp4CI* HphI \ \ \ \ \ \ \ \\ \\ \ \ CTTGACGGTGACAAATATTCTTTCTCAGCTGACCTAAAAGTCTACGGTGACTTGCTTGTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTGCCACTGTTTATAAGAAAGAGTCGACTGGATTTTCAGATGCCACTGAACGAACAC / / / / /// / // // / / / | | | HphI ||| | || || | | HphI | | SspI ||| | || || | Tsp45I | Tsp45I ||| | || || | MaeIII | MaeIII ||| | || || Tsp4CI* Tsp4CI* ||| | || |AccI ||| | || Hpy166II ||| | |BseMII ||| | BspCNI ||| | DrdI ||| SetI ||NspBII* ||PvuII ||CviJI ||AluI |DdeI SetI L D G D K Y S F S A D L K V Y G D L L V L T V T N I L S Q L T * K S T V T C L * * R * Q I F F L S * P K S L R * L A C E ----:----|----:----|----:----|----:----|----:----|----:----| S S P S L Y E K E A S R F T * P S K S T V Q R H C I N K R L Q G L L R R H S A Q K V T V F I R E * S V * F D V T V Q K H SetI | BssKI | EcoRII | | ScrFI | | BseBI | | | Acc65I | | | HgiCI* | | | |Csp6I | | | ||RsaI | | | ||SetI | | | ||NlaIV | | | ||| KpnI HphI | | | ||| | ApoI |MaeII | | | ||| | TspEI ||BtrI | | | ||| | EcoRI BetI* ||MaeIII | | | ||| | | TaqI |HpaII ||Tsp45I \ \ \ \\\ \ \ \ \\ \\\ AAAAAGTCCAAAGAAACCTATCCAGGTACCGAATTCGACATCTCCGGTGAAAACTTTGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCAGGTTTCTTTGGATAGGTCCATGGCTTAAGCTGTAGAGGCCACTTTTGAAACTG / /////// / / // // / SetI ||||||| | TaqI |BetI* || BtrI ||||||| EcoRI HpaII |TaiI ||||||| TspEI |SetI ||||||| ApoI HphI ||||||HgiCI* ||||||Acc65I |||||Csp6I ||||NlaIV ||||RsaI |||EcoRII |||BssKI ||KpnI |BseBI |ScrFI SetI K K S K E T Y P G T E F D I S G E N F D K S P K K P I Q V P N S T S P V K T L T K V Q R N L S R Y R I R H L R * K L * R ----:----|----:----|----:----|----:----|----:----|----:----| F F D L S V * G P V S N S M E P S F K S S F T W L F R D L Y R I R C R R H F S Q F L G F F G I W T G F E V D G T F V K V TfiI SetI HinfI MwoI SetI | AciI |Eco57I TaiI | |FokI |Eco57MI | AgeI | ||TseI || BseGI | BetI* | ||NspBII* || CviRI* | Cfr10I | |||BisI || | MnlI | |HpaII | ||||BlsI || | | SfaNI | || MaeIII BbvI | |||||MboII || | | | BccI \ \\ \ \ \ \\\\\\ \\ \ \ \ \ GTGACCGGTAACTTCAACGCTGAAGAATCCGCTGCCACCTCTGCATCCATCTACTCCTTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACTGGCCATTGAAGTTGCGACTTCTTAGGCGACGGTGGAGACGTAGGTAGATGAGGAAG / / // / / / //// // / / / / / | | || MaeIII BbvI | |||| || | | | MnlI SfaNI | | |Cfr10I | |||| || | | CviRI* BccI | | |BetI* | |||| || | BseGI | | |AgeI | |||| || Eco57MI | | HpaII | |||| || Eco57I | Tsp45I | |||| |MwoI | MaeIII | |||| SetI MaeII | |||TseI | |||FokI | ||MboII | ||BisI | |BlsI | NspBII* | AciI HinfI TfiI V T G N F N A E E S A A T S A S I Y S F * P V T S T L K N P L P P L H P S T P S D R * L Q R * R I R C H L C I H L L L H ----:----|----:----|----:----|----:----|----:----|----:----| T V P L K L A S S D A A V E A D M * E K R S R Y S * R Q L I R Q W R Q M W R S R H G T V E V S F F G S G G R C G D V G E Tsp4CI* SmlI | MaeIII AflII | Tsp45I |MseI TstI Hin4II* | | TspRI |HphI Hin4II* BsaXI \ \ \ \ \\ \ \ ACTCCAAGTTCTTTTGACAACAGTGGTGACATTTCCTTAAGTCTATCAAAGTCCAAGAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTTCAAGAAAACTGTTGTCACCACTGTAAAGGAATTCAGATAGTTTCAGGTTCTTC / / / / / // / / / Hin4II* | Tsp4CI* | | |AflII | | BsaXI TspRI | | |SmlI | TstI | | MseI Hin4II* | HphI Tsp45I MaeIII T P S S F D N S G D I S L S L S K S K K L Q V L L T T V V T F P * V Y Q S P R R S K F F * Q Q W * H F L K S I K V Q E G ----:----|----:----|----:----|----:----|----:----|----:----| V G L E K S L L P S M E K L R D F D L F * E L N K Q C C H H C K R L D I L T W S S W T R K V V T T V N G * T * * L G L L TspEI | BsaXI | | TstI Hin4II* MaeIII | | | HgiCI* Hpy178III* Tsp45I HphI | | | | NlaIV |TaqI \ \ \ \ \ \ \ \\ GGTGAAGTCACTTTCTCTCCATACTCCAATTCTGGTGCCTTCTCTTTCTCGAACGCTATT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTCAGTGAAAGAGAGGTATGAGGTTAAGACCACGGAAGAGAAAGAGCTTGCGATAA // / / / / / // |HphI | | | HgiCI* | |TaqI Tsp45I | | NlaIV | Hpy178III* MaeIII | TspEI Hin4II* BsaXI TstI G E V T F S P Y S N S G A F S F S N A I V K S L S L H T P I L V P S L S R T L F * S H F L S I L Q F W C L L F L E R Y S ----:----|----:----|----:----|----:----|----:----|----:----| P S T V K E G Y E L E P A K E K E F A I P H L * K R E M S W N Q H R R K R S R * T F D S E R W V G I R T G E R E R V S N BetI* |HpaII || AccI || |Hpy166II || || Esp3I || || BsmAI || || |MaeII || || || SetI TspRI Tsp4CI* || || || TaiI Hin4II* | SetI Hpy166II \ \\ \\ \\ \ \ \ \ \ CTCAACGGTGGTTCTGTTTCCGGTCTACAACGTAGAGACGACACTGAAGGTTCAGTAAAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTGCCACCAAGACAAAGGCCAGATGTTGCATCTCTGCTGTGACTTCCAAGTCATTTG / // // / // / / / Tsp4CI* || || | |BsmAI Hin4II* SetI Hpy166II || || | |Esp3I TspRI || || | MaeII || || TaiI || || SetI || |AccI || Hpy166II |BetI* HpaII L N G G S V S G L Q R R D D T E G S V N S T V V L F P V Y N V E T T L K V Q * T Q R W F C F R S T T * R R H * R F S K Q ----:----|----:----|----:----|----:----|----:----|----:----| R L P P E T E P R C R L S S V S P E T F E * R H N Q K R D V V Y L R C Q L N L L E V T T R N G T * L T S V V S F T * Y V Tsp4CI* |Eco57I AlwNI |Eco57MI MaeI Csp6I PflMI || TspEI HphI |RsaI BsiYI* || | MseI |SetI || SetI TaqI BsrI |Hpy178III* \\ \ \ \\ \\ \ \ \ \\ AACGGTGAAATTAACCTAGACAATGGAAGTACCTATGTTATTGTCGAACCAGTTTCTGGA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCACTTTAATTGGATCTGTTACCTTCATGGATACAATAACAGCTTGGTCAAAGACCT / // / / // // / / Eco57MI || | MaeI |Csp6I |BsrI | Hpy178III* Tsp4CI* || HphI RsaI TaqI BsiYI* Eco57I |MseI SetI PflMI |SetI AlwNI TspEI N G E I N L D N G S T Y V I V E P V S G T V K L T * T M E V P M L L S N Q F L E R * N * P R Q W K Y L C Y C R T S F W K ----:----|----:----|----:----|----:----|----:----|----:----| L P S I L R S L P L V * T I T S G T E P C R H F * G L C H F Y R H * Q R V L K Q V T F N V * V I S T G I N N D F W N R S Csp6I |RsaI |SetI BetI* || Tsp4CI* |HpaII || | HindII || MaeIII || | Hpy166II || BstEII SetI CfrI \\ \ \ \\ \ \ \ AAAGGTACAGTCAACATCATTTCCGGTAACCTATACTTACACTACCCTGACACATTTACT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCATGTCAGTTGTAGTAAAGGCCATTGGATATGAATGTGATGGGACTGTGTAAATGA / /// / // / / | ||| Hpy166II || | BstEII | ||| HindII || | MaeIII | ||Tsp4CI* || SetI | |Csp6I |BetI* | RsaI HpaII SetI K G T V N I I S G N L Y L H Y P D T F T K V Q S T S F P V T Y T Y T T L T H L L R Y S Q H H F R * P I L T L P * H I Y W ----:----|----:----|----:----|----:----|----:----|----:----| F P V T L M M E P L R Y K C * G S V N V F L Y L * C * K R Y G I S V S G Q C M * F T C D V D N G T V * V * V V R V C K S BcgI BalI | HindII CviJI FalI | Hpy166II HaeIII FalI SetI | | FalI |BsrI Tsp4CI* | Hin4II* | HphI | | FalI TstI \\ \ \ \ \ \ \ \ \ \ GGCCAAACTGTTGTATTCAAGGGTGAAGGTGTCCTTGCTGTTGACCCAACCGAAACCAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTTGACAACATAAGTTCCCACTTCCACAGGAACGACAACTGGGTTGGCTTTGGTTA // / / / / / / / / / / || | | FalI Hin4II* SetI HphI | | FalI TstI || | | FalI | | FalI || | Tsp4CI* | Hpy166II || CfrI | HindII |HaeIII BcgI |CviJI |BalI BsrI G Q T V V F K G E G V L A V D P T E T N A K L L Y S R V K V S L L L T Q P K P M P N C C I Q G * R C P C C * P N R N Q C ----:----|----:----|----:----|----:----|----:----|----:----| P W V T T N L P S P T R A T S G V S V L Q G F Q Q I * P H L H G Q Q Q G L R F W A L S N Y E L T F T D K S N V W G F G I BsiYI* MwoI TsoI | CviJI BsrI |AciI | BcgI | | TstI TspRI TspEI || NspBII* \ \ \ \ \ \ \ \\ \ GCCACTCCTATTCCTGTTGTTGGCTACACTGGTAAGAACCAAATTGCCATTACCGCTGAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGAGGATAAGGACAACAACCGATGTGACCATTCTTGGTTTAACGGTAATGGCGACTG / / / / // / / / / / | | | | |TspRI BsrI | MwoI | TspRI | | | | CviJI TspEI | BtsI | | | TstI NspBII* | | BsiYI* AciI | BcgI TsoI A T P I P V V G Y T G K N Q I A I T A D P L L F L L L A T L V R T K L P L P L T H S Y S C C W L H W * E P N C H Y R * H ----:----|----:----|----:----|----:----|----:----|----:----| A V G I G T T P * V P L F W I A M V A S H W E * E Q Q Q S C Q Y S G F Q W * R Q G S R N R N N A V S T L V L N G N G S V Tsp4CI* |Csp6I ||RsaI CviRI* ||| AgeI | StyI ||| BetI* | SecI* ||| Cfr10I | | MaeIII BtsI TspRI ||| |HpaII | | | SetI \ \ \\\ \\ \ \ \ \ ATCACTGCTCTTTCTTATGACGGTACTACCGGTGTTCTAACTGCAACCCAAGGTAACAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGACGAGAAAGAATACTGCCATGATGGCCACAAGATTGACGTTGGGTTCCATTGTCT / // // / / / / | |Csp6I |Cfr10I CviRI* | | MaeIII | RsaI |BetI* | SecI* Tsp4CI* |AgeI | StyI HpaII SetI I T A L S Y D G T T G V L T A T Q G N R S L L F L M T V L P V F * L Q P K V T D H C S F L * R Y Y R C S N C N P R * Q T ----:----|----:----|----:----|----:----|----:----|----:----| M V A R E * S P V V P T R V A V W P L L C * Q E K K H R Y * R H E L Q L G L Y C D S S K R I V T S G T N * S C G L T V S GsuI AluI Eco57MI CviJI | Acc65I |HgaI | HgiCI* ||SetI | |Csp6I ||| Hpy188I | ||RsaI ||| | DrdI | ||NlaIV ||| | | Hin4II* | |||BetI* ||| | | | BsmAI | ||||KpnI ||| | | | Esp3I | ||||HpaII ||| | | | Hpy188I | ||||| TfiI ||| | | | | AarI | ||||| HinfI ||| | | | | BspMI | ||||| |Eco57I ||| | | | | |TfiI TspEI | ||||| |Eco57MI ||| | | | | |HinfI \ \ \\\\\ \\ \\\ \ \ \ \ \\ CAATTCTCTTTTGCTATTGGTACCGGATTCTCCAGCTCTGACTTCAGCGTCTCTGAAGGA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAGAGAAAACGATAACCATGGCCTAAGAGGTCGAGACTGAAGTCGCAGAGACTTCCT / / / /// // / / / / / / / / / TspEI | | ||| || | | | | | | | | Esp3I | | ||| || | | | | | | | | BsmAI | | ||| || | | | | | | | Hpy188I | | ||| || | | | | | | Hin4II* | | ||| || | | | | | DrdI | | ||| || | | | | HgaI | | ||| || | | | Hpy188I | | ||| || | | CviJI | | ||| || | | AluI | | ||| || | SetI | | ||| || HinfI | | ||| || TfiI | | ||| |BetI* | | ||| Eco57MI | | ||| Eco57I | | ||| HpaII | | ||HgiCI* | | ||Acc65I | | |Csp6I | | NlaIV | | RsaI | KpnI Eco57MI GsuI Q F S F A I G T G F S S S D F S V S E G N S L L L L V P D S P A L T S A S L K E I L F C Y W Y R I L Q L * L Q R L * R N ----:----|----:----|----:----|----:----|----:----|----:----| C N E K A I P V P N E L E S K L T E S P V I R K Q * Q Y R I R W S Q S * R R Q L L E R K S N T G S E G A R V E A D R F S SpeI |MaeI ||FokI |||MwoI ||||MboII CviRI* ||||TspDTI | SetI ||||| AciI | | Eco57I ||||| BisI | | Eco57MI SetI ||||| |BlsI \ \ \ \ \\\\\ \\ ATCTTTGCAGGTGCTTACGCTTACTACCTAAACTACAATGGTGTTGTCGCTACTAGTGCC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAACGTCCACGAATGCGAATGATGGATTTGATGTTACCACAACAGCGATGATCACGG / // / / / /// /// | || Eco57MI SetI | ||| ||BisI | || Eco57I | ||| |BlsI | |SetI | ||| TauI | CviRI* | ||| FokI HinfI | ||SpeI BspMI | |MboII TfiI | |MaeI AarI | TspDTI MwoI I F A G A Y A Y Y L N Y N G V V A T S A S L Q V L T L T T * T T M V L S L L V P L C R C L R L L P K L Q W C C R Y * C R ----:----|----:----|----:----|----:----|----:----|----:----| I K A P A * A * * R F * L P T T A V L A F R Q L H K R K S G L S C H H Q R * * H D K C T S V S V V * V V I T N D S S T G CviRI* | TspRI MaeIII | | MwoI | AgeI | | BstAPI | BetI* | | | TspGWI | Cfr10I BseGI | | | |SfaNI | |HpaII TauI | BtsI | | | || AciI | |TspDTI TspGWI \ \ \ \ \ \ \\ \ \ \\ \ GCTTCTTCATCCACTGCATCTGGTGCTTCCGCTTCCGTTACCGGTTCTACTTCATTCGGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGAAGTAGGTGACGTAGACCACGAAGGCGAAGGCAATGGCCAAGATGAAGTAAGCCA / / / / / / / / / / // / | | TspRI | | TspGWI | AciI | | |Cfr10I TspGWI | | BtsI | BstAPI SfaNI | | |BetI* | BseGI | MwoI | | |AgeI AciI CviRI* | | HpaII | MaeIII TspDTI A S S S T A S G A S A S V T G S T S F G L L H P L H L V L P L P L P V L L H S V F F I H C I W C F R F R Y R F Y F I R C ----:----|----:----|----:----|----:----|----:----|----:----| A E E D V A D P A E A E T V P E V E N P R K K M W Q M Q H K R K R * R N * K M R S R * G S C R T S G S G N G T R S * E T MaeIII | AgeI MaeIII | BetI* | AgeI | Cfr10I | BetI* | |HpaII | Cfr10I | || CspCI | |HpaII TspDTI TspGWI | || | TspDTI \ \\ \ \ \ \\ \ \ GCTTCCGTTACCGGTTCAACTGCTTCCACTTCATTCGGTGCTTCCGTTACCGGTTCAACT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGGCAATGGCCAAGTTGACGAAGGTGAAGTAAGCCACGAAGGCAATGGCCAAGTTGA / // / / / // / | || TspDTI TspGWI | || TspDTI | |Cfr10I | |Cfr10I | |BetI* | |BetI* | |AgeI | |AgeI | HpaII | HpaII MaeIII | CspCI MaeIII A S V T G S T A S T S F G A S V T G S T L P L P V Q L L P L H S V L P L P V Q L F R Y R F N C F H F I R C F R Y R F N C ----:----|----:----|----:----|----:----|----:----|----:----| A E T V P E V A E V E N P A E T V P E V H K R * R N L Q K W K M R H K R * R N L S G N G T * S S G S * E T S G N G T * S MaeIII | AgeI | BetI* | Cfr10I | |HpaII TspGWI | |CspCI Hpy166II MaeI \ \ \\ \ \ GCTTCCACTTCATTTGGTGCTTCCGTTACCGGTTCAACATCTGTTTACACTACAACACTA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGGTGAAGTAAACCACGAAGGCAATGGCCAAGTTGTAGACAAATGTGATGTTGTGAT / / / // / / TspGWI | | |Cfr10I Hpy166II MaeI | | |BetI* | | |AgeI | | HpaII | MaeIII CspCI A S T S F G A S V T G S T S V Y T T T L L P L H L V L P L P V Q H L F T L Q H * F H F I W C F R Y R F N I C L H Y N T R ----:----|----:----|----:----|----:----|----:----|----:----| A E V E N P A E T V P E V D T * V V V S Q K W K M Q H K R * R N L M Q K C * L V S G S * K T S G N G T * C R N V S C C * BsmAI | Hpy188I | | MlyI Tsp4CI* | | PleI HinfI \ \ \ \ \ GACTATGTAAATGCCACAAGCACAGTCGTAGTTTCTTGTTCAGAGACAACTGACTCCAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATACATTTACGGTGTTCGTGTCAGCATCAAAGAACAAGTCTCTGTTGACTGAGGTTA / / // / Tsp4CI* | |PleI HinfI | MlyI Hpy188I BsmAI D Y V N A T S T V V V S C S E T T D S N T M * M P Q A Q S * F L V Q R Q L T P M L C K C H K H S R S F L F R D N * L Q W ----:----|----:----|----:----|----:----|----:----|----:----| S * T F A V L V T T T E Q E S V V S E L L S H L H W L C L R L K K N L S L Q S W V I Y I G C A C D Y N R T * L C S V G I FokI MaeIII | Tsp4CI* | MaeII | | FatI | | SetI | | |CviAII | | TaiI | | || NlaIII TstI | | | TstI | | || | BseGI | AciI \ \ \ \ \ \ \\ \ \ \ \ GGTAACGTCTATACCATTACCACAACCGTTCCATGCTCATCCACTACCGCCACTATTACT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGCAGATATGGTAATGGTGTTGGCAAGGTACGAGTAGGTGATGGCGGTGATAATGA / // / / / // / / | |MaeII | | | || TstI AciI | |TstI | | | |BseGI | MaeIII | | | |FatI TaiI | | | CviAII SetI | | NlaIII | FokI Tsp4CI* G N V Y T I T T T V P C S S T T A T I T V T S I P L P Q P F H A H P L P P L L L * R L Y H Y H N R S M L I H Y R H Y Y F ----:----|----:----|----:----|----:----|----:----|----:----| P L T * V M V V V T G H E D V V A V I V H Y R R Y W * W L R E M S M W * R W * * T V D I G N G C G N W A * G S G G S N S BsrI |MaeIII |Tsp45I || BseGI || |MaeII || |TspDTI || || SetI || || TaiI || || | TatI AgeI || || | |FokI BetI* || || | |Csp6I Cfr10I MboII || || | ||RsaI |HpaII MaeIII | Tsp4CI* \\ \\ \ \\\ \\ \ \ \ TCTTGTGATGAAACTGGATGTCACGTTAGTACATCAACCGGTGCTGTTGTAACTGAAACC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGAACACTACTTTGACCTACAGTGCAATCATGTAGTTGGCCACGACAACATTGACTTTGG / /// // //// // / / / | ||| || |||FokI |Cfr10I | | Tsp4CI* | ||| || ||TatI |BetI* | MboII | ||| || |Csp6I |AgeI MaeIII | ||| || RsaI HpaII | ||| |MaeII | ||| Tsp45I | ||| MaeIII | ||TaiI | ||SetI | |TspDTI | BseGI BsrI S C D E T G C H V S T S T G A V V T E T L V M K L D V T L V H Q P V L L * L K P L * * N W M S R * Y I N R C C C N * N R ----:----|----:----|----:----|----:----|----:----|----:----| E Q S S V P H * T L V D V P A T T V S V K K H H F Q I D R * Y M L R H Q Q L Q F R T I F S S T V N T C * G T S N Y S F G MaeIII MaeIII Tsp45I Tsp4CI* Tsp4CI* CviJI | TspRI | TspRI | MaeIII \ \ \ \ \ \ GTTTCTTCCAAATCATACACAACTGCCACTGTAACTCACTGTGACGATAATGGCTGTAAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAAGGTTTAGTATGTGTTGACGGTGACATTGAGTGACACTGCTATTACCGACATTG / / // / / / / | | || | Tsp45I CviJI MaeIII | | || | MaeIII | | || Tsp4CI* | | |MaeIII | | TspRI | Tsp4CI* TspRI V S S K S Y T T A T V T H C D D N G C N F L P N H T Q L P L * L T V T I M A V T F F Q I I H N C H C N S L * R * W L * H ----:----|----:----|----:----|----:----|----:----|----:----| T E E L D Y V V A V T V * Q S S L P Q L R K K W I M C L Q W Q L E S H R Y H S Y N R G F * V C S G S Y S V T V I I A T V MaeIII Tsp45I MwoI Tsp4CI* Hpy188I BsaXI BstAPI \ \ \ \ ACCAAGACTGTCACTTCTGAATGTTCCAAAGAAACATCAGCAACAACTGCTTCTCCAAAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCTGACAGTGAAGACTTACAAGGTTTCTTTGTAGTCGTTGTTGACGAAGAGGTTTT / / / / / | | Hpy188I BsaXI BstAPI | Tsp45I MwoI | MaeIII Tsp4CI* T K T V T S E C S K E T S A T T A S P K P R L S L L N V P K K H Q Q Q L L L Q N Q D C H F * M F Q R N I S N N C F S K I ----:----|----:----|----:----|----:----|----:----|----:----| V L V T V E S H E L S V D A V V A E G F C W S Q * K Q I N W L F M L L L Q K E L G L S D S R F T G F F C * C C S S R W F MaeIII Tsp45I Tsp4CI* MaeIII | TspRI Tsp45I MaeIII HphI | | MaeIII Tsp4CI* CviJI Tsp45I BsaXI | | Tsp4CI* | TspRI | MaeIII HphI Tsp4CI* \ \ \ \ \ \ \ \ \ \ TCATACACCACTGTCACCGTAACCCACTGTGACGACAATGGCTGTAACACCAAGACTGTC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGTATGTGGTGACAGTGGCATTGGGTGACACTGCTGTTACCGACATTGTGGTTCTGACAG / // / / // / / / / / / / | || | | || | Tsp45I CviJI | HphI | SetI | || | | || | MaeIII MaeIII Tsp4CI* | || | | || Tsp4CI* | || | | |MaeIII | || | | TspRI | || | Tsp4CI* | || | Tsp45I | || | MaeIII | || Tsp4CI* | |TspRI | HphI BsaXI S Y T T V T V T H C D D N G C N T K T V H T P L S P * P T V T T M A V T P R L S I H H C H R N P L * R Q W L * H Q D C H ----:----|----:----|----:----|----:----|----:----|----:----| D Y V V T V T V W Q S S L P Q L V L V T I M C W Q * R L G S H R C H S Y C W S Q * V G S D G Y G V T V V I A T V G L S D SetI | Hpy188I | | AluI | | CviJI | | | SetI | | | MnlI Eco57I | | | |Hpy178III* Eco57MI Csp6I | | | || MwoI | MboII |RsaI | | | || | AluI | | Eco57I ||Hpy166II | | | || | CviJI | | Eco57MI ||| BtsI | | | || | | SetI | | |Tsp4CI* ||| | HphI \ \ \ \\ \ \ \ \ \ \\ \\\ \ \ ACCTCTGAAGCTCCTGAAGCTACCACCACAACTACTGTTTCTTCTCAATCGTACACCACT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGACTTCGAGGACTTCGATGGTGGTGTTGATGACAAAGAAGAGTTAGCATGTGGTGA / / / // / / / / / / / / /// / | | | || | | | | | | | Tsp4CI* ||| HphI | | | || | | | | | | Eco57MI ||TspRI | | | || | | | | | | Eco57I ||BtsI | | | || | | | | | MboII |Hpy166II | | | || | | | | Eco57MI |Csp6I | | | || | | | | Eco57I RsaI | | | || | | | CviJI | | | || | | | AluI | | | || | | SetI | | | || | Hpy178III* | | | || MwoI | | | |MnlI | | | CviJI | | | AluI | | SetI | Hpy188I Tsp45I MaeIII T S E A P E A T T T T T V S S Q S Y T T P L K L L K L P P Q L L F L L N R T P L L * S S * S Y H H N Y C F F S I V H H C ----:----|----:----|----:----|----:----|----:----|----:----| V E S A G S A V V V V V T E E * D Y V V * R Q L E Q L * W W L * Q K K E I T C W G R F S R F S G G C S S N R R L R V G S TspRI FokI Hpy188I | MaeIII Tsp4CI* | MaeIII | AluI | Tsp45I |MslI | Tsp45I | CviJI | Tsp4CI* || TspRI TaqII BseGI | Tsp4CI* | | SetI \ \ \\ \ \ \ \ \ \ \ \ GCCACCGTCACCCACTGTGATGACAATGGATGTAAGACCAAGACTGTCACTTCTGAAGCT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGGCAGTGGGTGACACTACTGTTACCTACATTCTGGTTCTGACAGTGAAGACTTCGA / // / / / / // / / / / | || | MslI TaqII BseGI |FokI | | | CviJI | || Tsp4CI* | | | | AluI | |Tsp45I | | | SetI | |MaeIII | | Hpy188I | TspRI | Tsp45I Tsp4CI* | MaeIII Tsp4CI* A T V T H C D D N G C K T K T V T S E A P P S P T V M T M D V R P R L S L L K L H R H P L * * Q W M * D Q D C H F * S S ----:----|----:----|----:----|----:----|----:----|----:----| A V T V W Q S S L P H L V L V T V E S A Q W R * G S H H C H I Y S W S Q * K Q L G G D G V T I V I S T L G L S D S R F S Hpy178III* | MwoI | | CviJI | | | BsaXI | | | | Eco57I | | | | Eco57MI | | | | | Tsp4CI* MaeIII | | | | | | Eco57I BsaXI Tsp4CI* | | | | | | Eco57MI | AciI | DdeI \ \ \ \ \ \ \ \ \ \ \ CCTGAAGCCACAACCACTACTGTTTCTCCAAAGACATACACCACCGCTACTGTTACTCAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTCGGTGTTGGTGATGACAAAGAGGTTTCTGTATGTGGTGGCGATGACAATGAGTC / / // / // / / / // / | | || Eco57MI |Eco57MI BsaXI | | || DdeI | | || Eco57I |Eco57I | | |MaeIII | | |CviJI Tsp4CI* | | TspRI | | BsaXI | Tsp4CI* | Hpy178III* AciI MwoI P E A T T T T V S P K T Y T T A T V T Q L K P Q P L L F L Q R H T P P L L L L S * S H N H Y C F S K D I H H R Y C Y S V ----:----|----:----|----:----|----:----|----:----|----:----| G S A V V V V T E G F V Y V V A V T V * E Q L W L W * Q K E L S M C W R * Q * E R F G C G S S N R W L C V G G S S N S L FokI Hpy188I TspRI | MaeIII | Eco57I | BspCNI | Tsp45I | Eco57MI | |BseMII BseGI | Tsp4CI* | | Hpy178III* BsaXI \ \\ \ \ \ \ \ \ \ TGTGATGACAATGGATGTAGCACCAAGACTGTCACTTCTGAATGTCCTGAAGAAACTTCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTACTGTTACCTACATCGTGGTTCTGACAGTGAAGACTTACAGGACTTCTTTGAAGT // / // / // / / / |BseMII BseGI |FokI | |Eco57MI | BsaXI MboII BspCNI | | |Eco57I Hpy178III* | | Hpy188I | Tsp45I | MaeIII Tsp4CI* C D D N G C S T K T V T S E C P E E T S V M T M D V A P R L S L L N V L K K L Q * * Q W M * H Q D C H F * M S * R N F S ----:----|----:----|----:----|----:----|----:----|----:----| H S S L P H L V L V T V E S H G S S V E T H H C H I Y C W S Q * K Q I D Q L F K T I V I S T A G L S D S R F T R F F S * MaeIII MaeIII Tsp4CI* Tsp45I Eco57I | MaeIII Tsp4CI* MboII Eco57MI BsaXI | Tsp4CI* | TspRI \ \ \ \ \ \ \ GCAACTACTACTTCTCCAAAATCATACACTACTGTTACCGTTACTCACTGTGACGACAAC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTGATGATGAAGAGGTTTTAGTATGTGATGACAATGGCAATGAGTGACACTGCTGTTG / / / / // / / Eco57MI BsaXI | | || | Tsp45I Eco57I | | || | MaeIII | | || Tsp4CI* | | |MaeIII | | TspRI | Tsp4CI* | MaeIII Tsp4CI* A T T T S P K S Y T T V T V T H C D D N Q L L L L Q N H T L L L P L L T V T T T N Y Y F S K I I H Y C Y R Y S L * R Q R ----:----|----:----|----:----|----:----|----:----|----:----| A V V V E G F D Y V V T V T V * Q S S L L L * * K E L I M C * Q * R * E S H R C C S S S R W F * V S S N G N S V T V V V DdeI |HphI || BceAI || | BseMII || | |BspCNI || | |MaeIII || | |Tsp45I || | |Tsp4CI* || | || MnlI || | || | SetI || | || | |DdeI || | || | ||Hpy188I || | || | ||| AsuI* || | || | ||| DraII || | || | ||| |CviJI || | || | ||| |HaeIII || | || | ||| |BmgT120I || | || | ||| ||NlaIV || | || | ||| |||MnlI || | || | ||| |||| MwoI Tsp4CI* CviJI || | || | ||| |||| | CviJI | Eco57I | MaeIII || | || | ||| |||| | | BsaXI | Eco57MI \ \ \\ \ \\ \ \\\ \\\\ \ \ \ \ \ GGCTGTAACACTAAGACTGTCACCTCTGAGGCCCCTGAAGCCACAACCACTACTGTTTCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CCGACATTGTGATTCTGACAGTGGAGACTCCGGGGACTTCGGTGTTGGTGATGACAAAGA / / / //// // / / / //// // // CviJI | | |||| || | | | |||MwoI |CviJI |Eco57MI | | |||| || | | | ||DraII BsaXI |Eco57I | | |||| || | | | ||AsuI* Tsp4CI* | | |||| || | | | |BmgT120I | | |||| || | | | |NlaIV | | |||| || | | | |MnlI | | |||| || | | | HaeIII | | |||| || | | | CviJI | | |||| || | | DdeI | | |||| || | Hpy188I | | |||| || Tsp45I | | |||| || MaeIII | | |||| |SetI | | |||| MnlI | | |||Tsp4CI* | | |||BceAI | | ||BspCNI | | |BseMII | | DdeI | HphI MaeIII G C N T K T V T S E A P E A T T T T V S A V T L R L S P L R P L K P Q P L L F L L * H * D C H L * G P * S H N H Y C F S ----:----|----:----|----:----|----:----|----:----|----:----| P Q L V L V T V E S A G S A V V V V T E R S Y C * S Q * R Q P G Q L W L W * Q K A T V S L S D G R L G R F G C G S S N R MaeIII TspRI BsaXI Tsp4CI* | BspCNI BtgZI | AciI | DdeI | |BseMII | BseGI FokI \ \ \ \ \ \\ \ \ \ CCAAAGACATACACCACCGCTACTGTTACTCAGTGCGATGACAATGGATGTAGCACCAAG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCTGTATGTGGTGGCGATGACAATGAGTCACGCTACTGTTACCTACATCGTGGTTC / / / // / // / / BsaXI | | || DdeI |BseMII | BtgZI | | |MaeIII BspCNI BseGI | | TspRI | Tsp4CI* AciI P K T Y T T A T V T Q C D D N G C S T K Q R H T P P L L L L S A M T M D V A P R K D I H H R Y C Y S V R * Q W M * H Q D ----:----|----:----|----:----|----:----|----:----|----:----| G F V Y V V A V T V * H S S L P H L V L E L S M C W R * Q * E T R H C H I Y C W W L C V G G S S N S L A I V I S T A G L Hpy188I Eco57I TseI | Eco57I Eco57MI |BisI | Eco57MI |Hpy188I ||BlsI MaeIII | | AluI || BbvI ||TspRI Tsp45I | | CviJI Eco57I || | Hpy188I ||| DdeI Tsp4CI* | | | SetI Eco57MI || | | BsrI ||| SauI* \ \ \ \ \ \ \\ \ \ \ \\\ \ ACTGTCACTTCTGAAGCTCCTAAAGAAACTTCAGAAACTTCAGAAACCAGTGCTGCCCCT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAGTGAAGACTTCGAGGATTTCTTTGAAGTCTTTGAAGTCTTTGGTCACGACGGGGA // / // / / / / / / / / /// |FokI | || | | Eco57MI | Hpy188I | | TspRI ||TseI | | || | | Eco57I Eco57MI | | BsrI |BisI | | || | CviJI Eco57I | BbvI BlsI | | || | AluI Hpy188I | | || SetI | | |Eco57MI | | |Eco57I | | Hpy188I | Tsp45I | MaeIII Tsp4CI* T V T S E A P K E T S E T S E T S A A P L S L L K L L K K L Q K L Q K P V L P L C H F * S S * R N F R N F R N Q C C P * ----:----|----:----|----:----|----:----|----:----|----:----| V T V E S A G L S V E S V E S V L A A G S Q * K Q L E * L F K L F K L F W H Q G S D S R F S R F F S * F S * F G T S G R HphI | MaeIII | | MaeII | | | SetI MaeIII | | | TaiI | BsrI | | | |HphI TsoI | TspRI | | | |Hpy178III* \ \ \ \ \ \ \\ AAGGACATACACTACTGCCACTGGTTACTCAATGGTGATGACAATGGTTGTAACGTCAAG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGTATGTGATGACGGTGACCAATGAGTTACCACTACTGTTACCAACATTGCAGTTC / / / / / / / /// / SauI* TsoI TspRI BsrI MaeIII HphI | ||| Hpy178III* DdeI | ||HphI | |MaeII | MaeIII TaiI SetI K D I H Y C H W L L N G D D N G C N V K R T Y T T A T G Y S M V M T M V V T S R G H T L L P L V T Q W * * Q W L * R Q D ----:----|----:----|----:----|----:----|----:----|----:----| L S M C * Q W Q N S L P S S L P Q L T L * P C V S S G S T V * H H H C H N Y R * L V Y V V A V P * E I T I V I T T V D L MaeIII Tsp45I Tsp4CI* | Eco57I MnlI | Eco57MI | SetI | | SpeI | | AluI | | |MaeI | | CviJI | | || MwoI SetI | | | SetI | | || BstAPI \ \ \ \ \ \ \ \\ \ ATAATCACCTCTAAAATACCTGAAGCTACTTCAACCGTCACGCAACTAGTGCTTCTCCAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TATTAGTGGAGATTTTATGGACTTCGATGAAGTTGGCAGTGCGTTGATCACGAAGAGGTT / / / / / / / / // SetI MnlI | CviJI | | | | |SpeI SetI | AluI | | | | MaeI SetI | | | BstAPI | | | MwoI | | Tsp45I | | MaeIII | Eco57MI | Eco57I Tsp4CI* I I T S K I P E A T S T V T Q L V L L Q * S P L K Y L K L L Q P S R N * C F S K N H L * N T * S Y F N R H A T S A S P K ----:----|----:----|----:----|----:----|----:----|----:----| I I V E L I G S A V E V T V C S T S R W S L * R * F V Q L * K L R * A V L A E G Y D G R F Y R F S S * G D R L * H K E L BseMII |BspCNI |MaeIII |Tsp45I |Tsp4CI* DdeI || MnlI |Hpy188I SetI \\ \ \\ \ AGTCATACACTACTGTCACTTCTGAGGGTTCTAAAGCAACCTCATTGA 2950 2960 2970 2980 ----:----|----:----|----:----|----:----|----:--- TCAGTATGTGATGACAGTGAAGACTCCCAAGATTTCGTTGGAGTAACT /// / / / / / ||| | | | DdeI SetI ||| | | Hpy188I ||| | Tsp45I ||| | MaeIII ||| MnlI ||Tsp4CI* |BspCNI BseMII S H T L L S L L R V L K Q P H * V I H Y C H F * G F * S N L I X S Y T T V T S E G S K A T S L X ----:----|----:----|----:----|----:----|----:--- L * V S S D S R L T R F C G * Q F D Y V V T V E S P E L A V E N T M C * Q * K Q P N * L L R M S # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 2 Asp718I AccI 2 FblI,XmiI AciI 10 BspACI,SsiI AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 7 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 38 AluBI AlwNI 7 CaiI ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvCI 3 BbvI 5 BseXI,BstV1I,Lsp1109I BccI 3 Bce83I* 11 BpuEI BceAI 1 BcgI 1 BetI* 12 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmeT110I 1 BmgT120I 3 BplI 2 Bpu10I 3 BsaXI 5 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 14 BstF5I,BtsCI BseMII 9 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 15 Alw26I,BstMAI BspCNI 9 BspMI 1 BfuAI,Acc36I,BveI BsrI 7 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 5 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 3 BstXI 1 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 3 Cac8I 1 BstC8I Cfr10I 7 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 9 CviQI,RsaNI CspCI 1 CviAII 1 CviJI 49 CviKI-1 CviRI* 7 HpyCH4V DdeI 11 BstDEI,HpyF3I DpnI 3 MalI DraII 1 EcoO109I DrdI 3 AasI,DseDI Ecl136II 1 EcoICRI Eco57I 19 AcuI Eco57MI 20 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 2 BsmBI FalI 2 FatI 1 FokI 14 GlaI 1 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 7 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 5 HpaII 12 HapII,BsiSI,MspI HphI 14 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 22 KpnI 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 39 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 22 MlyI 2 SchI MmeI 1 MnlI 23 MseI 4 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 16 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 4 MspA1I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PmeI 1 MssI PvuII 2 RsaI 9 AfaI SacI 1 Psp124BI,SstI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 65 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 14 SmoI SpeI 2 BcuI,AhlI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 5 TaqII 2 TatI 2 TauI 1 TfiI 3 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 19 NmuCI Tsp4CI* 34 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 17 TscAI TstI 3 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflIII AjuI AlfI AloI ApaI ApaLI AscI AsuII AvrII BaeI BarI BbvII* BciVI BclI BdaI BfiI BglI BglII BmtI BsaAI BsaBI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstZ17I CauII* Cfr9I ClaI DinI DraIII DsaI* Eam1105I EciI Eco31I Eco47III EcoNI EcoP15I EcoT22I EgeI EheI EspI* FaqI FauI FnuDII* FseI FspAI GsaI HaeII Hin4I HindIII HpaI Hpy99I KasI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PfoI PmaCI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I VspI XbaI XcmI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769