Restriction Map of BNR1/YIL159W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BNR1/YIL159W on chromosome IX from coordinates 41825 to 45952.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.23052

MaeII | Csp6I | |RsaI | |SetI MboI | |TaiI | DpnI | |BbvII* | |BstKTI | || AciI | ||MnlI | || | MboII | ||| MaeIII HinfI Ksp632I* | || | | MwoI | ||| Tsp45I \ \ \ \\ \ \ \ \ \\\ \ ATGGACTCTTCCCCGAACAAGAAGACGTACCGCTACCCTCGCAGATCGCTGTCACTTCAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGAGAAGGGGCTTGTTCTTCTGCATGGCGATGGGAGCGTCTAGCGACAGTGAAGTG / / / /// / / //// / HinfI Ksp632I* | ||| | MwoI |||MboI Tsp45I | ||| BbvII* ||MnlI MaeIII | ||| MboII |DpnI | ||| AciI BstKTI | ||Csp6I | |RsaI | MaeII TaiI SetI M D S S P N K K T Y R Y P R R S L S L H W T L P R T R R R T A T L A D R C H F T G L F P E Q E D V P L P S Q I A V T S R ----:----|----:----|----:----|----:----|----:----|----:----| X S E E G F L F V Y R * G R L D S D S * X P S K G S C S S T G S G E C I A T V E H V R G R V L L R V A V R A S R Q * K V Hin6I FnuDII* |GlaI TspEI |OliI | ApoI |MslI | TspEI ||HhaI TspEI | | BccI ||FnuDII* CviJI | BsiYI* | | MboII CviJI \\\ \ \ \ \ \ \ \ GCGCGTGATAGGGTCAGCGAAGCCCGTAAATTGGAAGAATTGAATTTGAACGATGGGCTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGCACTATCCCAGTCGCTTCGGGCATTTAACCTTCTTAACTTAAACTTGCTACCCGAC /// / / / / /// / ||FnuDII* | | TspEI | ||BccI CviJI ||Hin6I | BsiYI* | |TspEI |MslI CviJI | |ApoI |OliI | MboII |GlaI TspEI FnuDII* HhaI A R D R V S E A R K L E E L N L N D G L R V I G S A K P V N W K N * I * T M G W A * * G Q R S P * I G R I E F E R W A G ----:----|----:----|----:----|----:----|----:----|----:----| A R S L T L S A R L N S S N F K F S P S R A H Y P * R L G Y I P L I S N S R H A R T I P D A F G T F Q F F Q I Q V I P Q AciI BisI |BlsI Csp6I ||TauI |RsaI ||NspBII* |SetI ||| Cac8I || MboI ||| | CviJI || | DpnI ||| | | Cac8I || | |BstKTI ||| | | | CviRI* || | || BinI* \\\ \ \ \ \ \\ \ \\ \ GTTGCCGCTGGCTTGCAGTTGGTCGGTGTAGCGTTAGAGAAACAAGGTACAGGATCACAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGGCGACCGAACGTCAACCAGCCACATCGCAATCTCTTTGTTCCATGTCCTAGTGTA //// / / / / / // // / |||| | | | CviRI* | || || MboI |||| | | Cac8I | || |DpnI |||| | CviJI | || BstKTI |||| Cac8I | |Csp6I |||NspBII* | RsaI |||AciI SetI ||BisI |BlsI TauI V A A G L Q L V G V A L E K Q G T G S H L P L A C S W S V * R * R N K V Q D H I C R W L A V G R C S V R E T R Y R I T Y ----:----|----:----|----:----|----:----|----:----|----:----| T A A P K C N T P T A N S F C P V P D C P Q R Q S A T P R H L T L S V L Y L I V N G S A Q L Q D T Y R * L F L T C S * M ApoI TspEI |XmnI || TspDTI || | DdeI || | | MboII || | | |AluI || | | |CviJI || | | || SetI || | | || | MboII || | | || | | MaeII || | | || | | | BspCNI || | | || | | | |HphI || | | || | | | |SetI || | | || | | | |TaiI FatI || | | || | | | |BseMII |CviAII || | | || | | | || MaeIII || NlaIII || | | || | | | || Tsp45I Hpy188I \\ \ \\ \ \ \\ \ \ \ \\ \ \ ATATACATGAAACAGAAGAATTTCTCAGCTAATGACGTTTCTTCGTCACCAATGGTTTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGTACTTTGTCTTCTTAAAGAGTCGATTACTGCAAAGAAGCAGTGGTTACCAAAGG / / // // / /// / //// / / | | |FatI || | ||| | |||MaeII Tsp45I Hpy188I | | CviAII || | ||| | |||HphI MaeIII | NlaIII || | ||| | ||BseMII BinI* || | ||| | |BspCNI || | ||| | TaiI || | ||| | SetI || | ||| MboII || | ||CviJI || | ||AluI || | |DdeI || | MboII || | SetI || TspEI || ApoI |TspDTI XmnI I Y M K Q K N F S A N D V S S S P M V S Y T * N R R I S Q L M T F L R H Q W F P I H E T E E F L S * * R F F V T N G F R ----:----|----:----|----:----|----:----|----:----|----:----| I Y M F C F F K E A L S T E E D G I T E Y I C S V S S N R L * H R K K T V L P K Y V H F L L I E * S I V N R R * W H N G Hpy188I | FatI | CviRI* Hpy166II | |CviAII | MboI | ||Cac8I | MboII | ||| SphI | | DpnI | ||| NspI | | |BstKTI | ||| NlaIII | | || Hpy188I | ||| | DdeI | | || | BinI* | ||| | SauI* | | || | | BcgI | ||| | | Hpy178III* | | || | | | TspGWI | ||| | | | MnlI | | || | | | | MseI | ||| | | | | BcgI | | || | | | | BsaBI | ||| | | | | | BspCNI \ \ \\ \ \ \ \ \ \ \\\ \ \ \ \ \ \ GAAGAAGTGAACGGATCGGAAATGGATTTTAATCCGAAGTGCATGCCTCAGGACGCATCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCACTTGCCTAGCCTTTACCTAAAATTAGGCTTCACGTACGGAGTCCTGCGTAGT / / // / / / / / / / /// // // // | | || | | | | | | | ||FatI || || |BseMII | | || | | | | | | | || || || BspCNI | | || | | | | | | | || || |BcgI | | || | | | | | | | || || MnlI | | || | | | | | | | || |Hpy178III* | | || | | | | | | | || SauI* | | || | | | | | | | || DdeI | | || | | | | | | | |CviAII | | || | | | | | | | Cac8I | | || | | | | | | CviRI* | | || | | | | | | NlaIII | | || | | | | | | NspI | | || | | | | | | SphI | | || | | | | | Hpy188I | | || | | | | MseI | | || | | | BsaBI | | || | | TspGWI | | || | BinI* | | || | BcgI | | || Hpy188I | | || MboI | | |DpnI | | BstKTI | MboII Hpy166II E E V N G S E M D F N P K C M P Q D A S K K * T D R K W I L I R S A C L R T H H R S E R I G N G F * S E V H A S G R I T ----:----|----:----|----:----|----:----|----:----|----:----| S S T F P D S I S K L G F H M G * S A D R L L S R I P F P N * D S T C A E P R M F F H V S R F H I K I R L A H R L V C * AluI CviJI HgaI | SetI BseMII | | BccI TseI | SfaNI | | MseI CviJI | |TaqI | | |AhaIII* |BisI | || Hpy99I | | ||AjuI BbvI ||BlsI \ \\ \ \ \ \\\ \ \\\ CTCGTCGAAAGAATGTTTGATGAGCTTTTAAAAGATGGAACTTTTTTTTGGGGGGCTGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCAGCTTTCTTACAAACTACTCGAAAATTTTCTACCTTGAAAAAAAACCCCCCGACGA / /// / // // / //// | ||SfaNI | || |MseI BbvI |||TseI | |TaqI | || AhaIII* ||AjuI | HgaI | || BccI ||BisI Hpy99I | |AjuI |BlsI | CviJI CviJI | AluI SetI L V E R M F D E L L K D G T F F W G A A S S K E C L M S F * K M E L F F G G L L R R K N V * * A F K R W N F F L G G C L ----:----|----:----|----:----|----:----|----:----|----:----| S T S L I N S S S K F S P V K K Q P A A V R R F F T Q H A K L L H F K K K P P Q E D F S H K I L K * F I S S K K P P S S PsiI AjuI | ApoI Hin4II* | TspEI | TsoI TspGWI \ \ \ \ \ TATAAGAATTTACAAAACATCTCTCTACGAAGGAAATGGTTATTGATATGTAAAATCCGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTCTTAAATGTTTTGTAGAGAGATGCTTCCTTTACCAATAACTATACATTTTAGGCA / / / / / PsiI TspEI | TsoI TspGWI ApoI Hin4II* Y K N L Q N I S L R R K W L L I C K I R I R I Y K T S L Y E G N G Y * Y V K S V * E F T K H L S T K E M V I D M * N P * ----:----|----:----|----:----|----:----|----:----|----:----| * L F K C F M E R R L F H N N I H L I R K Y S N V F C R E V F S I T I S I Y F G I L I * L V D R * S P F P * Q Y T F D T PflMI MaeIII SduI BsiYI* Tsp45I TaqI HgiAI* CfrI \ \ \ \ \ AGTTCCAATCATTGGGGGAAAAAGAAAGTGACTTCGAGCACGACATACTCTACACATTTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGGTTAGTAACCCCCTTTTTCTTTCACTGAAGCTCGTGCTGTATGAGATGTGTAAAC / / / BsiYI* | HgiAI* PflMI | TaqI | SduI Tsp45I MaeIII S S N H W G K K K V T S S T T Y S T H L V P I I G G K R K * L R A R H T L H I W F Q S L G E K E S D F E H D I L Y T F G ----:----|----:----|----:----|----:----|----:----|----:----| L E L * Q P F F F T V E L V V Y E V C K Y N W D N P S F S L S K S C S M S * V N T G I M P P F L F H S R A R C V R C M Q MaeI | AluI | CviJI CviJI BalI | | SetI HaeIII CviJI | | | MwoI |BseGI XmnI HaeIII | | | |TspDTI BccI ||MaeI FokI | SetI \ \ \ \ \\ \ \\\ \ \ \ GCCACTAATGAACTAGCTGAAAACGCACACTTTTTGGATGGCCTAGTTAGAAACCTTTCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGATTACTTGATCGACTTTTGCGTGTGAAAAACCTACCGGATCAATCTTTGGAAAGT / / /// / / / // / /// | CfrI ||| | TspDTI BccI || MaeI ||XmnI HaeIII ||| MwoI |HaeIII |FokI CviJI ||CviJI |CviJI SetI BalI ||AluI BseGI |MaeI SetI A T N E L A E N A H F L D G L V R N L S P L M N * L K T H T F W M A * L E T F Q H * * T S * K R T L F G W P S * K P F N ----:----|----:----|----:----|----:----|----:----|----:----| A V L S S A S F A C K K S P R T L F R E P W * H V L Q F R V S K P H G L * F G K G S I F * S F V C V K Q I A * N S V K * SetI | FatI | |CviAII ApoI | || NlaIII TspEI | || | Hin4II* CviJI | FalI | || | | TaqI TspDTI MaeI | FalI HindIII \ \\ \ \ \ \ \ \ \ \ ACAGGTGGCATGAAGTTATCGAAGGCTCTATATAAACTAGAAAAATTCCTGCGAAAGCAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCACCGTACTTCAATAGCTTCCGAGATATATTTGATCTTTTTAAGGACGCTTTCGTT / / // / / / / / / / / SetI | || | | | CviJI | FalI TspEI SetI | || | | TspDTI | FalI ApoI | || | TaqI MaeI | || Hin4II* | |FatI | CviAII NlaIII T G G M K L S K A L Y K L E K F L R K Q Q V A * S Y R R L Y I N * K N S C E S K R W H E V I E G S I * T R K I P A K A K ----:----|----:----|----:----|----:----|----:----|----:----| V P P M F N D F A R Y L S S F N R R F C L L H C S T I S P E I Y V L F I G A F A C T A H L * R L S * I F * F F E Q S L L FokI AluI | TspDTI CviJI | | MboI | SetI FalI ApoI | | | DpnI | Bce83I* FalI TspEI | | | |TaqI | | CviRI* |SmlI |BseGI | | | |BstKTI \ \ \ \\ \\ \ \ \ \\ AGCTTTTTGCAACTTTTTCTCAAGGATGAAATTTACTTGACGACATTGATCGAAAAGACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAAAAACGTTGAAAAAGAGTTCCTACTTTAAATGAACTGCTGTAACTAGCTTTTCTGA / / / / / / / / / // // | | | FalI SmlI | TspEI | FokI || |TaqI | | | FalI | ApoI TspDTI || MboI | | CviRI* BseGI |DpnI | HindIII BstKTI Bce83I* CviJI AluI S F L Q L F L K D E I Y L T T L I E K T A F C N F F S R M K F T * R H * S K R L L F A T F S Q G * N L L D D I D R K D F ----:----|----:----|----:----|----:----|----:----|----:----| L K K C S K R L S S I * K V V N I S F V F S K A V K E * P H F K S S S M S R F S A K Q L K K E L I F N V Q R C Q D F L S StyI SecI* TspEI MseI | TspEI | MboII |AhaIII* \ \ \ \ \\ TTGCCACTCATATCCAAGGAATTACAATTTGTTTATCTTCGGTGCTTTAAAATACTGATG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTGAGTATAGGTTCCTTAATGTTAAACAAATAGAAGCCACGAAATTTTATGACTAC / / / / // | | | TspEI |MseI | | MboII AhaIII* | TspEI SecI* StyI L P L I S K E L Q F V Y L R C F K I L M C H S Y P R N Y N L F I F G A L K Y * * A T H I Q G I T I C L S S V L * N T D E ----:----|----:----|----:----|----:----|----:----|----:----| K G S M D L S N C N T * R R H K L I S I K A V * I W P I V I Q K D E T S * F V S Q W E Y G L F * L K N I K P A K F Y Q H DdeI |Hpy188I BseMII || CviJI TspDTI |SduI || | MseI |BsrI |BspCNI || | |TspEI |TspRI |HgiAI* || | || HphI Hpy166II \\ \\ \\ \ \\ \ \ AACAACCCACTGGCGAGAATAAGAGCACTACATTCTGAGCCTTTAATTCGCTGGTTCACC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGGGTGACCGCTCTTATTCTCGTGATGTAAGACTCGGAAATTAAGCGACCAAGTGG / // /// / // / // / TspRI |BsrI ||BspCNI | |CviJI | |TspEI Hpy166II TspDTI |BseMII | DdeI | HphI HgiAI* Hpy188I MseI SduI N N P L A R I R A L H S E P L I R W F T T T H W R E * E H Y I L S L * F A G S P Q P T G E N K S T T F * A F N S L V H R ----:----|----:----|----:----|----:----|----:----|----:----| F L G S A L I L A S C E S G K I R Q N V S C G V P S F L L V V N Q A K L E S T * V V W Q R S Y S C * M R L R * N A P E G AluI CviJI | SetI | | Hpy188I | | | MboI | | | | DpnI | | | | |BstKTI | | | | || ApoI | | | | || TspEI | | | | || | BinI* | | | | || | | TspEI | | | | || | | |TspGWI MaeIII MaeIII \ \ \ \ \\ \ \ \\ \ \ GAGCTTCTGACGGATCAAAATTCTAATTTGAAATGTCAGTTACTTTCTATGGAGTTACTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAAGACTGCCTAGTTTTAAGATTAAACTTTACAGTCAATGAAAGATACCTCAATGAA / / / // / /// / / / | | | || MboI ||| TspEI MaeIII MaeIII | | | |DpnI ||TspGWI | | | BstKTI |TspEI | | Hpy188I |ApoI | CviJI BinI* | AluI SetI E L L T D Q N S N L K C Q L L S M E L L S F * R I K I L I * N V S Y F L W S Y F A S D G S K F * F E M S V T F Y G V T F ----:----|----:----|----:----|----:----|----:----|----:----| S S R V S * F E L K F H * N S E I S N S R A E S P D F N * N S I D T V K * P T V L K Q R I L I R I Q F T L * K R H L * K AsuI* AvaII |NlaIV MseI |BmgT120I | MaeII || AluI | | MnlI NlaIV || CviJI | | |SetI | SecI* || | SetI | | |TaiI | DsaI* || | | HphI \ \ \\ \ \ \\ \ \ \ TTATTATTAACGTATGTTGAGGGTTCCACGGGTTGTGAGTTGATATGGGACCAGCTTTCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATAATTGCATACAACTCCCAAGGTGCCCAACACTCAACTATACCCTGGTCGAAAGG / // / / //// / / | |MaeII NlaIV DsaI* |||| | HphI | MnlI SecI* |||| CviJI MseI |||| AluI TaiI |||SetI SetI ||AvaII ||AsuI* |BmgT120I NlaIV L L L T Y V E G S T G C E L I W D Q L S Y Y * R M L R V P R V V S * Y G T S F P I I N V C * G F H G L * V D M G P A F H ----:----|----:----|----:----|----:----|----:----|----:----| K N N V Y T S P E V P Q S N I H S W S E K I I L T H Q P N W P N H T S I P G A K * * * R I N L T G R T T L Q Y P V L K G TspDTI | FokI | BseGI | | TspDTI | | | CviRI* BslFI CviJI | | | |TspEI | TsoI |MaeI AciI | | | || FokI \ \ \\ \ \ \ \ \\ \ ATATTATTCACCGATTGGCTAGAATGGTTTGACAAAATCCTTGCGGATGATATTGCAATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATAAGTGGCTAACCGATCTTACCAAACTGTTTTAGGAACGCCTACTATAACGTTAA // / / / / / / / / |BslFI | MaeI | | | | | TspEI TsoI CviJI | | | | CviRI* | | | | FokI | | | TspDTI | | BseGI | TspDTI AciI I L F T D W L E W F D K I L A D D I A I Y Y S P I G * N G L T K S L R M I L Q F I I H R L A R M V * Q N P C G * Y C N S ----:----|----:----|----:----|----:----|----:----|----:----| M N N V S Q S S H N S L I R A S S I A I W I I * R N A L I T Q C F G Q P H Y Q L Y * E G I P * F P K V F D K R I I N C N BsrI NlaIV | TspEI BseGI | | MseI TaqI \ \ \ \ \ CATTCATCCCTTTATTTGAACTGGAACCAATTAAAAATAGACTATTCGACAACTTTCCTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGTAGGGAAATAAACTTGACCTTGGTTAATTTTTATCTGATAAGCTGTTGAAAGGAT / / / // / BseGI | NlaIV |MseI TaqI FokI BsrI TspEI H S S L Y L N W N Q L K I D Y S T T F L I H P F I * T G T N * K * T I R Q L S Y F I P L F E L E P I K N R L F D N F P T ----:----|----:----|----:----|----:----|----:----|----:----| * E D R * K F Q F W N F I S * E V V K R E N M G K N S S S G I L F L S N S L K G M * G K I Q V P V L * F Y V I R C S E * CviRI* CviRI* | MaeI | BsgI | | ApoI ApoI | |SetI | | TspEI TspEI \ \\ \ \ \ \ CTGCTAATAAACTCCATACTGCAAGGTTTCAACAACAAGACTGCACTAGAAATTTTGAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GACGATTATTTGAGGTATGACGTTCCAAAGTTGTTGTTCTGACGTGATCTTTAAAACTTA / // / / / | |BsgI | MaeI TspEI | SetI CviRI* ApoI CviRI* L L I N S I L Q G F N N K T A L E I L N C * * T P Y C K V S T T R L H * K F * I A N K L H T A R F Q Q Q D C T R N F E F ----:----|----:----|----:----|----:----|----:----|----:----| S S I F E M S C P K L L L V A S S I K F V A L L S W V A L N * C C S Q V L F K S Q * Y V G Y Q L T E V V L S C * F N Q I CviJI HaeIII | BinI* |BsrI | MboI \\ \ \ TTTTTGAAAAAGAATAATATACATAACACTATCACATTTTTAGAACTGGCCTATAAAGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACTTTTTCTTATTATATGTATTGTGATAGTGTAAAAATCTTGACCGGATATTTCTA / // / TspEI |HaeIII BinI* ApoI |CviJI BsrI F L K K N N I H N T I T F L E L A Y K D F * K R I I Y I T L S H F * N W P I K M F E K E * Y T * H Y H I F R T G L * R * ----:----|----:----|----:----|----:----|----:----|----:----| K K F F F L I C L V I V N K S S A * L S N K S F S Y Y V Y C * * M K L V P R Y L K Q F L I I Y M V S D C K * F Q G I F I Hpy178III* | MboI | BclI | | DpnI | | |FatI | | |BstKTI DpnI | | ||CviAII TfiI |BstKTI | | ||| NlaIII TspEI HinfI \\ \ \ \\\ \ \ \ GATCCTAATAGTGTCGTGATCATGGAACAAATAAAACAATTCAAATCCAAAGAATCTGCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGATTATCACAGCACTAGTACCTTGTTTATTTTGTTAAGTTTAGGTTTCTTAGACGC // / ///// // / / || MboI ||||| |FatI TspEI HinfI |DpnI ||||| CviAII TfiI BstKTI ||||BclI ||||MboI |||NlaIII ||DpnI |BstKTI Hpy178III* D P N S V V I M E Q I K Q F K S K E S A I L I V S * S W N K * N N S N P K N L R S * * C R D H G T N K T I Q I Q R I C D ----:----|----:----|----:----|----:----|----:----|----:----| S G L L T T I M S C I F C N L D L S D A H D * Y H R S * P V F L V I * I W L I Q I R I T D H D H F L Y F L E F G F F R R ApoI TspEI MlyI HinfI EcoRI PleI | TaqI |HphI EcoRV \ \ \ \\ \ ATATTTGACTCGATGATAAAAACTACCAACGATACGAATTCGCTTCACCCAACAAAAGAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAACTGAGCTACTATTTTTGATGGTTGCTATGCTTAAGCGAAGTGGGTTGTTTTCTA // / / / / / |PleI | TaqI | EcoRI TaqII MlyI HinfI | TspEI EcoRV | ApoI HphI I F D S M I K T T N D T N S L H P T K D Y L T R * * K L P T I R I R F T Q Q K I I * L D D K N Y Q R Y E F A S P N K R Y ----:----|----:----|----:----|----:----|----:----|----:----| I N S E I I F V V L S V F E S * G V F S S I Q S S S L F * W R Y S N A E G L L L Y K V R H Y F S G V I R I R K V W C F I Hpy178III* Cac8I |MnlI Hin4II* TaqII | CviJI || TspEI | BslFI \ \ \ \\ \ \ \ ATCGCAAGAATAGAAAGCGAGCCTCTATGTCTTGAAAATTGCCTGTTATTGAAGGCAAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCGTTCTTATCTTTCGCTCGGAGATACAGAACTTTTAACGGACAATAACTTCCGTTTT / / / / / / / | CviJI | | | Hin4II* BslFI Cac8I | | TspEI | Hpy178III* MnlI I A R I E S E P L C L E N C L L L K A K S Q E * K A S L Y V L K I A C Y * R Q K R K N R K R A S M S * K L P V I E G K R ----:----|----:----|----:----|----:----|----:----|----:----| I A L I S L S G R H R S F Q R N N F A F Y R L F L F R A E I D Q F N G T I S P L D C S Y F A L R * T K F I A Q * Q L C F MlyI PleI | DdeI HgiCI* | | HinfI MnlI | NlaIV CspCI | | | CspCI \ \ \ \ \ \ \ \ GATAGTCCCGTAGAGGCACCAATAAACGAGATTATTCAATCGCTGTGGAAAATCTTAGAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCAGGGCATCTCCGTGGTTATTTGCTCTAATAAGTTAGCGACACCTTTTAGAATCTG / / / / // // MnlI | | CspCI || |CspCI | HgiCI* || DdeI NlaIV |PleI MlyI D S P V E A P I N E I I Q S L W K I L D I V P * R H Q * T R L F N R C G K S * T * S R R G T N K R D Y S I A V E N L R L ----:----|----:----|----:----|----:----|----:----|----:----| S L G T S A G I F S I I * D S H F I K S L Y D R L P V L L R S * E I A T S F R L I T G Y L C W Y V L N N L R Q P F D * V MseI DdeI | BspCNI | Hpy188I | |BseMII | |TfiI | || MseI ApoI | |HinfI | || | TspEI TspEI \ \\ \ \\ \ \ \ TCTCAAAAACCATACTCAGAATCTATTAAACTATTAAAATTGATAAATTCTTTGCTGTTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTTTTTGGTATGAGTCTTAGATAATTTGATAATTTTAACTATTTAAGAAACGACAAA / // / /// / / / HinfI || | ||MseI MseI TspEI TspEI || | |BseMII ApoI || | BspCNI || HinfI || TfiI |DdeI Hpy188I S Q K P Y S E S I K L L K L I N S L L F L K N H T Q N L L N Y * N * * I L C C F S K T I L R I Y * T I K I D K F F A V L ----:----|----:----|----:----|----:----|----:----|----:----| E * F G Y E S D I L S N F N I F E K S N S E F V M S L I * * V I L I S L N K A T R L F W V * F R N F * * F Q Y I R Q Q K Hin4II* | StyI | SecI* HindII | | SetI Hpy166II | | | HinfI TfiI | TfiI | | | | AciI HinfI | HinfI | | | | TspDTI \ \ \ \ \ \ \ \ TATCTCATAGATTCCTTTCAAGTGTCAACGAATCCTTCTTTTGATGAAACCTTGGAGTCC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGAGTATCTAAGGAAAGTTCACAGTTGCTTAGGAAGAAAACTACTTTGGAACCTCAGG / / / / / / // HinfI | HinfI | SetI | |HinfI TfiI | TfiI Hin4II* | TspDTI Hpy166II SecI* HindII StyI Y L I D S F Q V S T N P S F D E T L E S I S * I P F K C Q R I L L L M K P W S P S H R F L S S V N E S F F * * N L G V R ----:----|----:----|----:----|----:----|----:----|----:----| * R M S E K * T D V F G E K S S V K S D K D * L N R E L T L S D K K Q H F R P T I E Y I G K L H * R I R R K I F G Q L G Hpy178III* |MmeI PleI || TfiI TfiI |MlyI || HinfI MseI TspEI HinfI \\ \\ \ \ \ \ GCAGAAAATGTGGATTATGTTTTTCAAGATTCTGTTAATAAATTGTTGGATTCTCTACAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTTTACACCTAATACAAAAAGTTCTAAGACAATTATTTAACAACCTAAGAGATGTT / / / / / / / / | PleI | | HinfI MseI TspEI HinfI | MlyI | | TfiI TfiI AciI | Hpy178III* MmeI A E N V D Y V F Q D S V N K L L D S L Q Q K M W I M F F K I L L I N C W I L Y N R K C G L C F S R F C * * I V G F S T I ----:----|----:----|----:----|----:----|----:----|----:----| A S F T S * T K * S E T L L N N S E R C R L F H P N H K E L N Q * Y I T P N E V C F I H I I N K L I R N I F Q Q I R * L Hpy188I | TspEI | | SapI | | Ksp632I* | | | MwoI | | | |TspDTI | | | || AciI | | | || BsrBI | | | || | MaeIII MboI | | | || | Tsp45I | DpnI | | | || | | MboII | |BstKTI | | | MaeI || | | | TspEI | || MseI DdeI \ \ \ \ \\ \ \ \ \ \ \\ \ \ TCTGATGAAATTGCTAGAAGAGCGGTCACAGAAATTGATGATCTTAATGCTAAGATTTCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTACTTTAACGATCTTCTCGCCAGTGTCTTTAACTACTAGAATTACGATTCTAAAGA / / // / / / // / // / / / Hpy188I | || | | | |Tsp45I | || | MseI DdeI | || | | | |MaeIII | || MboI | || | | | MboII | |DpnI | || | | AciI | BstKTI | || | BsrBI TspEI | || TspDTI | |MwoI | |MaeI | Ksp632I* | SapI TspEI S D E I A R R A V T E I D D L N A K I S L M K L L E E R S Q K L M I L M L R F L * * N C * K S G H R N * * S * C * D F S ----:----|----:----|----:----|----:----|----:----|----:----| D S S I A L L A T V S I S S R L A L I E I Q H F Q * F L P * L F Q H D * H * S K R I F N S S S R D C F N I I K I S L N R FatI BspHI |CviAII TspEI |Hpy178III* | MseI || NlaIII | | ApoI || | BsaBI | | TspEI || | |MboI BdaI | | | TspDTI || | || DpnI BdaI | | | | BdaI || | || |BstKTI |FalI MslI | | | | BdaI || | || || MseI |FalI \ \ \ \ \ \ \\ \ \\ \\ \ \\ CATTTGAATGAAAAATTAAATTTAGTAGAAAATCATGATAAAGATCATTTAATAGCAAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAACTTACTTTTTAATTTAAATCATCTTTTAGTACTATTTCTAGTAAATTATCGTTTT / // /// / // / // / / / / MslI || ||BdaI | || | || MboI | | BdaI || ||BdaI | || | |DpnI | | BdaI || |TspEI | || | BstKTI | FalI || |ApoI | || BsaBI | FalI || TspDTI | |BspHI MseI |MseI | |FatI TspEI | Hpy178III* | CviAII NlaIII H L N E K L N L V E N H D K D H L I A K I * M K N * I * * K I M I K I I * * Q N F E * K I K F S R K S * * R S F N S K T ----:----|----:----|----:----|----:----|----:----|----:----| * K F S F N F K T S F * S L S * K I A F E N S H F I L N L L F D H Y L D N L L L M Q I F F * I * Y F I M I F I M * Y C F Hpy188I | FalI Hpy188I | FalI | SfeI* TfiI TspDTI | | StyI | | CviRI* MaeI HinfI | EcoRV | | SecI* TspEI | | Hin4II* \ \ \ \ \ \ \ \ \ \ \ CTAGATGAAAGTGAATCTTTGATATCTCTGAAAACCAAGGAAATTGAAAATCTGAAACTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTACTTTCACTTAGAAACTATAGAGACTTTTGGTTCCTTTAACTTTTAGACTTTGAC / / / / // / / / /// MaeI | | | |Hpy188I SecI* TspEI | ||CviRI* | | | FalI StyI | |Hin4II* | | | FalI | PstI | | EcoRV Hpy188I | TspDTI HinfI TfiI L D E S E S L I S L K T K E I E N L K L * M K V N L * Y L * K P R K L K I * N C R * K * I F D I S E N Q G N * K S E T A ----:----|----:----|----:----|----:----|----:----|----:----| S S S L S D K I D R F V L S I S F R F S V L H F H I K S I E S F W P F Q F D S V * I F T F R Q Y R Q F G L F N F I Q F Q SfaNI |SetI PstI MaeI TspEI ||CspCI TspDTI \ \ \ \\\ \ CAGTTGAAGGCAACCAAGAAAAGACTAGACCAAATTACCACGCATCAAAGGTTATATGAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAACTTCCGTTGGTTCTTTTCTGATCTGGTTTAATGGTGCGTAGTTTCCAATATACTG / / / / / / / SfeI* MaeI TspEI | | | TspDTI | | SfaNI | CspCI SetI Q L K A T K K R L D Q I T T H Q R L Y D S * R Q P R K D * T K L P R I K G Y M T V E G N Q E K T R P N Y H A S K V I * P ----:----|----:----|----:----|----:----|----:----|----:----| C N F A V L F L S S W I V V C * L N Y S A T S P L W S F V L G F * W A D F T I H L Q L C G L F S * V L N G R M L P * I V MroNI Cfr10I |HpaII ||NaeI ||Cac8I SmlI ||| CviJI CviJI SetI Hin4II* |CspCI ||| | TaqI Bce83I* \ \ \ \\ \\\ \ \ \ CAGCCACCTTCATTGGCAAGTAGCAACTTGAGTATTGCCGGCTCGATAATAAAAAATAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGGTGGAAGTAACCGTTCATCGTTGAACTCATAACGGCCGAGCTATTATTTTTTATTA / / / / / /// // | SetI Hin4II* | SmlI ||| |Bce83I* CviJI CspCI ||| TaqI ||Cfr10I ||MroNI ||CviJI |HpaII Cac8I NaeI Q P P S L A S S N L S I A G S I I K N N S H L H W Q V A T * V L P A R * * K I I A T F I G K * Q L E Y C R L D N K K * * ----:----|----:----|----:----|----:----|----:----|----:----| W G G E N A L L L K L I A P E I I F F L G A V K M P L Y C S S Y Q R S S L L F Y L W R * Q C T A V Q T N G A R Y Y F I I TseI MwoI |BisI ||BlsI ApoI FatI |||TseI TspEI |CviAII ApoI ||||BisI |BbvI || NlaIII TspEI |||||BlsI || BbvI \\ \ \ \\\\\\ \\ \ AGTCATGGAAATATCATTTTCCAAAATTTAGCAAAAAAGCAACAGCAGCAGCAAAAAATT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGTACCTTTATAGTAAAAGGTTTTAAATCGTTTTTTCGTTGTCGTCGTCGTTTTTTAA / // / / ////// / | |FatI TspEI | |||||TseI TspEI | CviAII ApoI | ||||BisI ApoI NlaIII | |||BlsI | ||TseI | |BisI | BlsI MwoI S H G N I I F Q N L A K K Q Q Q Q Q K I V M E I S F S K I * Q K S N S S S K K F S W K Y H F P K F S K K A T A A A K N F ----:----|----:----|----:----|----:----|----:----|----:----| L * P F I M K W F K A F F C C C C C F I Y D H F Y * K G F N L L F A V A A A F F T M S I D N E L I * C F L L L L L L F N EcoP15I | EcoP15I | | SpeI MaeIII | | |MaeI | TspDTI | | || AccI | | MaeII | | || |Hpy166II | | | SetI | | || || BslFI | | | TaiI SfaNI \ \ \\ \\ \ \ \ \ \ \ TCTCTGCCCAAGCGTTCAACTAGTCTACTAAAAAGTAAAAGAGTTACGTCCCTTTCATCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGACGGGTTCGCAAGTTGATCAGATGATTTTTCATTTTCTCAATGCAGGGAAAGTAGT / / / / // // / / / // | BbvI | | || |AccI | | | |MaeII BbvI | | || Hpy166II | | | MaeIII | | |SpeI | | TaiI | | MaeI | | SetI | EcoP15I | TspDTI EcoP15I BslFI S L P K R S T S L L K S K R V T S L S S L C P S V Q L V Y * K V K E L R P F H H S A Q A F N * S T K K * K S Y V P F I I ----:----|----:----|----:----|----:----|----:----|----:----| E R G L R E V L R S F L L L T V D R E D K E A W A N L * D V L F Y F L * T G K M R Q G L T * S T * * F T F S N R G K * * PleI |MlyI TspDTI || TfiI | MlyI CviRI* || HinfI | PleI MseI | BslFI HinfI || | Hpy188I | | MboII \ \ \ \ \\ \ \ \ \ \ TATTTAACTGATGCAAATAACGAAAATGAGTCCCAAAATGAATCCGAAGATAAATCAAAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAATTGACTACGTTTATTGCTTTTACTCAGGGTTTTACTTAGGCTTCTATTTAGTTTT / / / / / / // / /// | MseI | BslFI HinfI PleI || | ||MboII SfaNI CviRI* MlyI || | |PleI || | MlyI || TspDTI |Hpy188I HinfI TfiI Y L T D A N N E N E S Q N E S E D K S K I * L M Q I T K M S P K M N P K I N Q K F N * C K * R K * V P K * I R R * I K R ----:----|----:----|----:----|----:----|----:----|----:----| Y K V S A F L S F S D W F S D S S L D F M N L Q H L Y R F H T G F H I R L Y I L I * S I C I V F I L G L I F G F I F * F MboI BglII XhoII | DpnI | |BstKTI | || MaeII | || | SetI | || | TaiI | || | |HindII | || | |Hpy166II | || | || MseI | || | || VspI | || | || |TspEI Hin4II* HinfI | || | || || MseI | SspI \ \ \\ \ \\ \\ \ \ \ GACTCATTATTTCAAAGATCTACGTCAACCATTAATTTTAATATCCCTTCTATGAAAAAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTAATAAAGTTTCTAGATGCAGTTGGTAATTAAAATTATAGGGAAGATACTTTTTA / // // / / / / / / / HinfI || || | | | | MseI | SspI || || | | | TspEI Hin4II* || || | | VspI || || | | MseI || || | Hpy166II || || | HindII || || MaeII || |TaiI || |SetI || XhoII || BglII || MboI |DpnI BstKTI D S L F Q R S T S T I N F N I P S M K N T H Y F K D L R Q P L I L I S L L * K I L I I S K I Y V N H * F * Y P F Y E K Y ----:----|----:----|----:----|----:----|----:----|----:----| S E N N * L D V D V M L K L I G E I F F L S M I E F I * T L W * N * Y G K * S F V * * K L S R R * G N I K I D R R H F I BsmAI | MmeI | |ApoI Hpy188I TspDTI | |TspEI | ApoI | CviRI* | || TaqI | TspEI \ \ \ \\ \ \ \ ATTACTAATATGCAAAATGTCTCTCTAAATTCGATACTTTCAGAGTTGGAATTTTCAAAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGATTATACGTTTTACAGAGAGATTTAAGCTATGAAAGTCTCAACCTTAAAAGTTTA / / / / / / / / TspDTI CviRI* | | | TaqI Hpy188I TspEI | | TspEI ApoI | | ApoI | BsmAI MmeI I T N M Q N V S L N S I L S E L E F S N L L I C K M S L * I R Y F Q S W N F Q I Y * Y A K C L S K F D T F R V G I F K * ----:----|----:----|----:----|----:----|----:----|----:----| I V L I C F T E R F E I S E S N S N E F Y * * Y A F H R E L N S V K L T P I K L N S I H L I D R * I R Y K * L Q F K * I CviJI |StyI MboII |AvrII BsmAI MboII |SecI* SetI Esp3I | MboII ||MaeI TspEI BbvII* | | HphI \\\ \ \ \ \ \ AGCCTAGGAACACAACCTAATTACCAATCGTCTCCCGTGTTGTCTTCGGTTTCTTCTTCA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGATCCTTGTGTTGGATTAATGGTTAGCAGAGGGCACAACAGAAGCCAAAGAAGAAGT / // / / / / / / / | |SecI* SetI TspEI | | | | HphI | |AvrII | | | MboII | |StyI | | MboII | MaeI | BbvII* CviJI | Esp3I | BsmAI MboII S L G T Q P N Y Q S S P V L S S V S S S A * E H N L I T N R L P C C L R F L L H P R N T T * L P I V S R V V F G F F F T ----:----|----:----|----:----|----:----|----:----|----:----| L R P V C G L * W D D G T N D E T E E E Y G L F V V * N G I T E R T T K P K K K A * S C L R I V L R R G H Q R R N R R * MnlI |DdeI || Hpy188I || | MnlI || | |Hpy178III* SpeI || | || BspCNI |MaeI || | || |BseMII || Csp6I || | || || TfiI || |RsaI TaqI || | || || HinfI || || SetI \ \\ \ \\ \\ \ \\ \\ \ CCAAAACTTTTCCCTCGACTTTCCTCAGATAGTCTTGATAATGGAATCCAACTAGTACCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTGAAAAGGGAGCTGAAAGGAGTCTATCAGAACTATTACCTTAGGTTGATCATGGA / / // / // / //// TaqI | |DdeI | |Hpy178III* HinfI |||Csp6I | | | |BseMII TfiI ||RsaI | | | BspCNI ||SetI | | MnlI |SpeI | Hpy188I MaeI MnlI P K L F P R L S S D S L D N G I Q L V P Q N F S L D F P Q I V L I M E S N * Y L K T F P S T F L R * S * * W N P T S T * ----:----|----:----|----:----|----:----|----:----|----:----| G F S K G R S E E S L R S L P I W S T G V L V K G E V K R L Y D Q Y H F G V L V W F K E R S K G * I T K I I S D L * Y R SetI | Eco57I | Eco57MI BseRI | | MnlI | MnlI MseI | | BseRI | |SetI | MmeI | | | AciI | || MnlI MnlI MnlI \ \ \ \ \ \ \ \\ \ \ \ GAAGTTGTTAAACTACCTCAACTTCCACCGCCCCCTCCTCCACCTCCCCCTCCTCCACTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAACAATTTGATGGAGTTGAAGGTGGCGGGGGAGGAGGTGGAGGGGGAGGAGGTGAA / / / // / / / / / / / | | | |MnlI AciI | | | MnlI MnlI MnlI | | | BseRI | | MnlI | | Eco57MI | SetI | | Eco57I BseRI | SetI MmeI MseI E V V K L P Q L P P P P P P P P P P P L K L L N Y L N F H R P L L H L P L L H F S C * T T S T S T A P S S T S P S S T S ----:----|----:----|----:----|----:----|----:----|----:----| S T T L S G * S G G G G G G G G G G G S Q L Q * V V E V E V A G E E V E G E E V F N N F * R L K W R G R R W R G R R W K AluI CviJI | SetI | |BccI | || BetI* | || |HpaII | || || Eco57I | || || Eco57MI TseI MnlI | || || | BseGI CviRI* | Tsp4CI* | || || | | BsgI |BisI | | BsmAI | || || | | | FokI ||BlsI \ \ \ \ \\ \\ \ \ \ \ \\\ CCACAGTCTCTTTTGACTGAAGCAGAAGCTAAACCGGATGGTGTTTCCTGTATTGCAGCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTCAGAGAAAACTGACTTCGTCTTCGATTTGGCCTACCACAAAGGACATAACGTCGT / / / / / / // / / / ///// | Tsp4CI* BsmAI | | | || | BsgI | ||||SetI MnlI | | | || BseGI | |||BstAPI | | | |BetI* | |||AlwNI | | | Eco57MI | |||MwoI | | | Eco57I | |||TseI | | | HpaII | ||BisI | | BccI | |BlsI | CviJI | CviRI* | AluI FokI SetI P Q S L L T E A E A K P D G V S C I A A H S L F * L K Q K L N R M V F P V L Q H T V S F D * S R S * T G W C F L Y C S T ----:----|----:----|----:----|----:----|----:----|----:----| G C D R K V S A S A L G S P T E Q I A A E V T E K S Q L L L * V P H H K R Y Q L W L R K Q S F C F S F R I T N G T N C C Hpy178III* KasI MwoI | MboI HgiCI* AlwNI | BglII |AcyI BstAPI | XhoII |NarI | SetI | | DpnI |Hin6I | |CviRI* | | |BstKTI ||GlaI | || AciI | | ||Hin4II* ||DinI | || BbvI | | ||| MseI ||NlaIV | || | AarI | | ||| |AhaIII* |||HhaI | || | BspMI | | ||| || BceAI ||||HaeII \ \\ \ \ \ \ \\\ \\ \ \\\\\ CCTGCACCGCCACCCCTTCCAGATCTATTTAAAACTAAAACTTGTGGCGCCGTTCCACCA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGTGGCGGTGGGGAAGGTCTAGATAAATTTTGATTTTGAACACCGCGGCAAGGTGGT / / / / ///// // / ///// | | | BspMI ||||| |MseI BceAI ||||HgiCI* | | | AarI ||||| AhaIII* ||||KasI | | BbvI ||||XhoII |||Hin6I | AciI ||||BglII |||NarI CviRI* ||||MboI |||AcyI |||Hin4II* ||NlaIV ||DpnI ||DinI |BstKTI ||GlaI Hpy178III* |HhaI HaeII P A P P P L P D L F K T K T C G A V P P L H R H P F Q I Y L K L K L V A P F H H C T A T P S R S I * N * N L W R R S T T ----:----|----:----|----:----|----:----|----:----|----:----| G A G G G R G S R N L V L V Q P A T G G V Q V A V G E L D I * F * F K H R R E V R C R W G K W I * K F S F S T A G N W W AsuI* DraII |CviJI |HaeIII |BmgT120I ||NlaIV ||Hin4I ||| TspDTI ||| | Hpy178III* AvaI PleI ||| | |GsuI AciI |BmeT110I |TaqI ||| | |Eco57MI AciI | Hin4I || HinfI |MlyI ||| | ||MnlI \ \ \ \\ \ \\ \\\ \ \\\ CCACCACCGCCACCGCCTTTACCCGAGTCCTTGTCGATGAACAAAGGCCCCTCCAATCAC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGTGGCGGTGGCGGAAATGGGCTCAGGAACAGCTACTTGTTTCCGGGGAGGTTAGTG / / / // / / / / //// / // | | AciI || HinfI | TaqI | |||TspDTI | |Hpy178III* | Hin4I |AvaI PleI | ||DraII | |BseRI AciI BmeT110I MlyI | ||AsuI* | MnlI | |BmgT120I Eco57MI | |NlaIV GsuI | HaeIII | CviJI Hin4I P P P P P P L P E S L S M N K G P S N H H H R H R L Y P S P C R * T K A P P I T T T A T A F T R V L V D E Q R P L Q S R ----:----|----:----|----:----|----:----|----:----|----:----| G G G G G G K G S D K D I F L P G E L * V V V A V A K V R T R T S S C L G R W D W W R W R R * G L G Q R H V F A G G I V AluI CviJI | SetI | | MnlI | | | SetI BseRI | | | | MboII MboII | MaeIII | | | | BbvII* | BseRI DdeI MnlI \ \ \ \ \ \ \ \ \ \ \ GATTTAGTTACTCCTCCAGCTCCACCTTTACCAAATGGTCTTCTTTCTTCCTCCTCAGTG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATCAATGAGGAGGTCGAGGTGGAAATGGTTTACCAGAAGAAAGAAGGAGGAGTCAC / / / // / / / / / / / | | | |SetI | | | BseRI | | MnlI | | | MnlI | | MboII | DdeI | | CviJI | BbvII* TspRI | | AluI MboII | SetI MaeIII D L V T P P A P P L P N G L L S S S S V I * L L L Q L H L Y Q M V F F L P P Q C F S Y S S S S T F T K W S S F F L L S V ----:----|----:----|----:----|----:----|----:----|----:----| S K T V G G A G G K G F P R R E E E E T R N L * E E L E V K V L H D E K K R R L I * N S R W S W R * W I T K K R G G * H TspRI |MnlI || BspCNI MseI MmeI || |BseMII |AhaIII* | SetI MnlI MwoI \\ \\ \\ \ \ \ \ TCTATCAATCCAACGACAACCGATTTAAAACCACCTCCAACTGAAAAGCGATTGAAGCAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AGATAGTTAGGTTGCTGTTGGCTAAATTTTGGTGGAGGTTGACTTTTCGCTAACTTCGTT / // // / / / / | |BseMII |MseI MmeI MnlI MwoI MmeI | BspCNI | SetI MnlI AhaIII* S I N P T T T D L K P P P T E K R L K Q L S I Q R Q P I * N H L Q L K S D * S K Y Q S N D N R F K T T S N * K A I E A N ----:----|----:----|----:----|----:----|----:----|----:----| D I L G V V V S K F G G G V S F R N F C T * * D L S L R N L V V E L Q F A I S A R D I W R C G I * F W R W S F L S Q L L BsrI AflIII TspRI | MaeII | MnlI | |BbvII* | | BfiI | || SetI | | | SetI | || TaiI | | | | FalI | || FalI | | | | FalI | || FalI MmeI | | | | | EcoRV | || | MboII \ \ \ \ \ \ \ \ \\ \ \ ATCCACTGGGATAAGGTGGAGGATATCAAAGACACACTTTGGGAAGACACGTTTCAACGC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTGACCCTATTCCACCTCCTATAGTTTCTGTGTGAAACCCTTCTGTGCAAAGTTGCG / / / /// / // / / TspRI | | ||FalI EcoRV || | BbvII* | | ||FalI || | MboII | | |BfiI || AflIII | | SetI || MaeII | MnlI |TaiI BsrI |SetI FalI FalI I H W D K V E D I K D T L W E D T F Q R S T G I R W R I S K T H F G K T R F N A P L G * G G G Y Q R H T L G R H V S T P ----:----|----:----|----:----|----:----|----:----|----:----| I W Q S L T S S I L S V S Q S S V N * R F G S P Y P P P Y * L C V K P L C T E V D V P I L H L I D F V C K P F V R K L A Hin4I Hin4I BspCNI DdeI |BseMII TspEI BccI | Hpy188I || MseI \ \ \ \ \\ \ CAAGAAACAATCAAAGAATTACAAACTGATGGTATATTCTCTCAGATTGAAGATATTTTT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTGTTAGTTTCTTAATGTTTGACTACCATATAAGAGAGTCTAACTTCTATAAAAA / / // / // / | BccI |DdeI | |BseMII MboII TspEI | | BspCNI | Hin4I | Hin4I Hpy188I Q E T I K E L Q T D G I F S Q I E D I F K K Q S K N Y K L M V Y S L R L K I F L R N N Q R I T N * W Y I L S D * R Y F * ----:----|----:----|----:----|----:----|----:----|----:----| W S V I L S N C V S P I N E * I S S I K G L F L * L I V F Q H Y I R E S Q L Y K L F C D F F * L S I T Y E R L N F I N K Hpy188I | DdeI MfeI | | TspDTI TspEI | | | CviRI* | MboII | | | |Hin4I | BbvII* | | | |Hin4I TfiI | | MnlI MboII | | | || AloI MmeI HinfI | | | AloI \ \ \ \ \\ \ \ \ \ \ \ \ AAGATGAAAAGTCCGACTAAGATTGCAAATAAAAGGAACGCAGAATCCTCAATTGCCTTG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACTTTTCAGGCTGATTCTAACGTTTATTTTCCTTGCGTCTTAGGAGTTAACGGAAC / / / // / / / / / //// MseI | | || | CviRI* MmeI HinfI | |||BbvII* | | || AloI TfiI | ||MnlI | | |Hin4I | |AloI | | |Hin4I | TspEI | | DdeI | MfeI | TspDTI MboII Hpy188I K M K S P T K I A N K R N A E S S I A L R * K V R L R L Q I K G T Q N P Q L P C D E K S D * D C K * K E R R I L N C L V ----:----|----:----|----:----|----:----|----:----|----:----| L I F L G V L I A F L L F A S D E I A K * S S F D S * S Q L Y F S R L I R L Q R L H F T R S L N C I F P V C F G * N G Q AluI CviJI | SetI | TspDTI Eco57I MboII | | ApoI Eco57MI BbvII* | | TspEI MboII |Hpy178III* \ \ \ \ \ \\ TCTTCAAACAATGGCAAGTCTTCCAATGAGCTGAAGAAAATTTCATTCTTATCAAGAGAT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTTGTTACCGTTCAGAAGGTTACTCGACTTCTTTTAAAGTAAGAATAGTTCTCTA / / / / / / / / | BbvII* | TspDTI | MboII | Hpy178III* MboII | CviJI TspEI Eco57MI | AluI ApoI Eco57I SetI S S N N G K S S N E L K K I S F L S R D L Q T M A S L P M S * R K F H S Y Q E I F K Q W Q V F Q * A E E N F I L I K R F ----:----|----:----|----:----|----:----|----:----|----:----| D E F L P L D E L S S F F I E N K D L S T K L C H C T K W H A S S F K M R I L L R * V I A L R G I L Q L F N * E * * S I BspCNI FatI |TstI AflIII CviJI |BseMII BspLU11I* Hpy188I |DdeI ||MseI |CviAII | TstI |EspI* ||VspI || NspI | | ApoI || TspEI |||TspEI || NlaIII TspEI | | TspEI \\ \ \\\\ \\ \ \ \ \ \ TTGGCTCAGCAATTTGGTATTAATTTACACATGTTTTCCCAATTATCTGATATGGAATTT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGAGTCGTTAAACCATAATTAAATGTGTACAAAAGGGTTAATAGACTATACCTTAAA / / / // / / / // / // / | EspI* | || | | | |BspLU11I* | |Hpy188I TspEI | DdeI | || | | | |AflIII | TstI ApoI CviJI | || | | | |FatI TspEI | || | | | CviAII | || | | NlaIII | || | | NspI | || | TspEI | || VspI | || MseI | |BseMII | BspCNI TspEI TstI L A Q Q F G I N L H M F S Q L S D M E F W L S N L V L I Y T C F P N Y L I W N L G S A I W Y * F T H V F P I I * Y G I C ----:----|----:----|----:----|----:----|----:----|----:----| K A * C N P I L K C M N E W N D S I S N N P E A I Q Y * N V C T K G I I Q Y P I Q S L L K T N I * V H K G L * R I H F K MseI |HpaI TspDTI |HindII ApoI Tsp4CI* Tth111I |Hpy166II TspEI \ \ \\ \ GTTATGAAAGTATTGAACTGTGATAACGACATTGTCCAAAATGTTAACATACTGAAATTT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACTTTCATAACTTGACACTATTGCTGTAACAGGTTTTACAATTGTATGACTTTAAA // / // / |Tsp4CI* Tth111I |MseI TspEI TspDTI Hpy166II ApoI HindII HpaI V M K V L N C D N D I V Q N V N I L K F L * K Y * T V I T T L S K M L T Y * N F Y E S I E L * * R H C P K C * H T E I F ----:----|----:----|----:----|----:----|----:----|----:----| T I F T N F Q S L S M T W F T L M S F N Q * S L I S S H Y R C Q G F H * C V S I N H F Y Q V T I V V N D L I N V Y Q F K Csp6I Ksp632I* MboII MseI |RsaI CviJI \ \ \ \\ \ TTTTGTAAAGAAGAGTTAGTAAATATACCAAAAAGTATGCTTAATAAGTACGAGCCATAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AAAACATTTCTTCTCAATCATTTATATGGTTTTTCATACGAATTATTCATGCTCGGTATA / / / // / Ksp632I* MboII MseI || CviJI |Csp6I RsaI F C K E E L V N I P K S M L N K Y E P Y F V K K S * * I Y Q K V C L I S T S H I L * R R V S K Y T K K Y A * * V R A I F ----:----|----:----|----:----|----:----|----:----|----:----| K Q L S S N T F I G F L I S L L Y S G Y K K Y L L T L L Y V L F Y A * Y T R A M K T F F L * Y I Y W F T H K I L V L W I FokI AluI | MaeIII CviJI BccI BseGI | Tsp45I | SetI SspI \ \ \ \ \ \ \ TCACAGGGTAAGGATGGTAAAGCAGTAAGTGACTTACAAAGAGCTGACAGAATATTTTTG 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTCCCATTCCTACCATTTCGTCATTCACTGAATGTTTCTCGACTGTCTTATAAAAAC / / / / / / / BccI BseGI | Tsp45I | CviJI SspI | MaeIII | AluI FokI SetI S Q G K D G K A V S D L Q R A D R I F L H R V R M V K Q * V T Y K E L T E Y F W T G * G W * S S K * L T K S * Q N I F G ----:----|----:----|----:----|----:----|----:----|----:----| E C P L S P L A T L S K C L A S L I N K N V P Y P H Y L L L H S V F L Q C F I K * L T L I T F C Y T V * L S S V S Y K Q CviRI* | BsmI | |MboI | || DpnI PleI TspEI | || |BstKTI |MlyI | MseI EcoP15I | || || HinfI || Tth111I \ \ \ \ \\ \\ \ \\ \ GAGTTGTGTATCAATTTAAGATTTTATTGGAATGCAAGATCAAAGAGTCTGCTGACATTG 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAACACATAGTTAAATTCTAAAATAACCTTACGTTCTAGTTTCTCAGACGACTGTAAC / / / / // / / / / | MseI EcoP15I | || MboI HinfI | Tth111I TspEI | |DpnI PleI | BstKTI MlyI CviRI* BsmI E L C I N L R F Y W N A R S K S L L T L S C V S I * D F I G M Q D Q R V C * H C V V Y Q F K I L L E C K I K E S A D I V ----:----|----:----|----:----|----:----|----:----|----:----| S N H I L K L N * Q F A L D F L R S V N P T T Y * N L I K N S H L I L S D A S M L Q T D I * S K I P I C S * L T Q Q C Q HindII SfaNI CviRI* Hpy166II MaeIII | TspEI |TspEI \ \ \ \ \\ TCAACATACGAGAGAGATTATTACGATTTGATTTTCAAGTTACAAAAAATTGATGATGCA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGTATGCTCTCTCTAATAATGCTAAACTAAAAGTTCAATGTTTTTTAACTACTACGT / / / / / Hpy166II | | TspEI CviRI* HindII | SfaNI MaeIII S T Y E R D Y Y D L I F K L Q K I D D A Q H T R E I I T I * F S S Y K K L M M Q N I R E R L L R F D F Q V T K N * * C N ----:----|----:----|----:----|----:----|----:----|----:----| D V Y S L S * * S K I K L N C F I S S A T L M R S L N N R N S K * T V F F Q H H * C V L S I I V I Q N E L * L F N I I C Hpy166II | SetI | |ApoI | |TspEI MseI | || MseI |HphI | || |AhaIII* \\ \ \\ \\ ATTTCACACTTAAATCGTTCACCTAAATTTAAAAGTTTGATGTTTATTATCACGGAAATA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGTGTGAATTTAGCAAGTGGATTTAAATTTTCAAACTACAAATAATAGTGCCTTTAT / / / // /// TspEI | MseI |SetI ||MseI HphI Hpy166II |AhaIII* TspEI ApoI I S H L N R S P K F K S L M F I I T E I F H T * I V H L N L K V * C L L S R K * F T L K S F T * I * K F D V Y Y H G N R ----:----|----:----|----:----|----:----|----:----|----:----| I E C K F R E G L N L L K I N I I V S I L K V S L D N V * I * F N S T * * * P F N * V * I T * R F K F T Q H K N D R F Y TspEI TspGWI | TspDTI |NdeI | |MseI TspEI \\ \ \\ \ GGCAATCATATGAATAAAAGAATTGTTAAGGGTATCAAATTGAAGTCATTGACTAAACTT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTAGTATACTTATTTTCTTAACAATTCCCATAGTTTAACTTCAGTAACTGATTTGAA / / // / / | NdeI || MseI TspEI TspGWI |TspEI TspDTI G N H M N K R I V K G I K L K S L T K L A I I * I K E L L R V S N * S H * L N L Q S Y E * K N C * G Y Q I E V I D * T C ----:----|----:----|----:----|----:----|----:----|----:----| P L * I F L L I T L P I L N F D N V L S L C D Y S Y F F Q * P Y * I S T M S * V A I M H I F S N N L T D F Q L * Q S F K BinI* | MboI | XhoII | Hpy188I MboI | | DpnI BclI | | |BstKTI | DpnI | | ||BsrI | |BstKTI CviRI* \ \ \\\ \ \\ \ GCCTTTGTCAGATCCAGTATTGATCAAAATGTATCATTTTTGCATTTTATTGAAAAAGTC 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAACAGTCTAGGTCATAACTAGTTTTACATAGTAAAAACGTAAAATAACTTTTTCAG / / // / // / / | | || XhoII || BclI CviRI* | | || MboI || MboI | | |DpnI |DpnI | | |BsrI BstKTI | | BstKTI | Hpy188I BinI* A F V R S S I D Q N V S F L H F I E K V P L S D P V L I K M Y H F C I L L K K S L C Q I Q Y * S K C I I F A F Y * K S H ----:----|----:----|----:----|----:----|----:----|----:----| A K T L D L I S * F T D N K C K I S F T Q R Q * I W Y Q D F H I M K A N * Q F L G K D S G T N I L I Y * K Q M K N F F D Hpy178III* Tsp4CI* BseGI FokI MboII \ \ \ \ \ ATAAGAATAAAATATCCTGATATATACGGTTTTGTGGATGATTTGAAGAACATTGAAGAT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCTTATTTTATAGGACTATATATGCCAAAACACCTACTAAACTTCTTGTAACTTCTA / / / / / | Tsp4CI* BseGI | MboII Hpy178III* FokI I R I K Y P D I Y G F V D D L K N I E D * E * N I L I Y T V L W M I * R T L K I K N K I S * Y I R F C G * F E E H * R F ----:----|----:----|----:----|----:----|----:----|----:----| M L I F Y G S I Y P K T S S K F F M S S * L F L I D Q Y I R N Q P H N S S C Q L Y S Y F I R I Y V T K H I I Q L V N F I AflIII | MaeII | | SetI | | TaiI | | | TfiI | | | HinfI | | | | Hpy188I | | | | | TspDTI | | | | | | FatI | | | | | | BspHI | | | | | | |CviAII | | | | | | |Hpy178III* | | | | | | || ApoI MnlI SetI | | | | | | || TspEI | TspEI |MboII MaeI | | | | | | || NlaIII | TspDTI \\ \ \ \ \ \ \ \ \\ \ \ \ TTAGGTAAAATCTCACTAGAACACGTTGAATCAGAGTGTCATGAATTTCATAAAAAAATT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCATTTTAGAGTGATCTTGTGCAACTTAGTCTCACAGTACTTAAAGTATTTTTTTAA / / / / / // / / // / // / | MboII | | | || | | || TspEI || TspEI SetI | | | || | | || ApoI |TspDTI | | | || | | |BspHI MnlI | | | || | | |FatI | | | || | | Hpy178III* | | | || | | CviAII | | | || | NlaIII | | | || TspDTI | | | |Hpy188I | | | HinfI | | | TfiI | | AflIII | | MaeII | TaiI | SetI MaeI L G K I S L E H V E S E C H E F H K K I * V K S H * N T L N Q S V M N F I K K L R * N L T R T R * I R V S * I S * K N * ----:----|----:----|----:----|----:----|----:----|----:----| K P L I E S S C T S D S H * S N * L F I N L Y F R V L V R Q I L T D H I E Y F F * T F D * * F V N F * L T M F K M F F N BspCNI |BseMII || AluI || CviJI MaeIII || | SetI | DdeI || | |MnlI DdeI BseRI \ \ \\ \ \\ \ \ GAGGATTTAGTTACTCAGTTTCAAGTAGGAAAGCTATCCAAAGAGGAGAACTTAGACCCC 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTAAATCAATGAGTCAAAGTTCATCCTTTCGATAGGTTTCTCCTCTTGAATCTGGGG / / // / / / / / | DdeI || | | MnlI | BseRI MaeIII || | CviJI DdeI || | AluI || SetI |BseMII BspCNI E D L V T Q F Q V G K L S K E E N L D P R I * L L S F K * E S Y P K R R T * T P G F S Y S V S S R K A I Q R G E L R P Q ----:----|----:----|----:----|----:----|----:----|----:----| S S K T V * N * T P F S D L S S F K S G Q P N L * E T E L L F A I W L P S S L G L I * N S L K L Y S L * G F L L V * V G MboI AsuI* | DpnI |BmgT120I | |BstKTI MseI ||CviJI | || TspEI MseI SetI MseI VspI ||HaeIII AjuI TspEI \ \\ \ \ \ \ \ \\\ \ \ AGAGATCAAATTATTAAAAAGGTCAAGTTTAAGATTAATCGGGCCAAAACAAAAAGTGAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTAGTTTAATAATTTTTCCAGTTCAAATTCTAATTAGCCCGGTTTTGTTTTTCACTT // / / / / / / /// || MboI | | SetI MseI VspI ||AjuI |DpnI | MseI MseI |AsuI* BstKTI TspEI BmgT120I HaeIII CviJI R D Q I I K K V K F K I N R A K T K S E E I K L L K R S S L R L I G P K Q K V N R S N Y * K G Q V * D * S G Q N K K * I ----:----|----:----|----:----|----:----|----:----|----:----| L S * I I L F T L N L I L R A L V F L S W L D F * * F P * T * S * D P W F L F H S I L N N F L D L K L N I P G F C F T F TspEI | MseI | AjuI MseI SspI \ \ \ \ TTATTGATTGGTCAATGTAAATTAACTTTAATAGATTTGAATAAACTGATGAAATATTAC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTAACCAGTTACATTTAATTGAAATTATCTAAACTTATTTGACTACTTTATAATG / / // / / / TspEI AjuI |MseI MseI SspI Tsp4CI* TspEI L L I G Q C K L T L I D L N K L M K Y Y Y * L V N V N * L * * I * I N * * N I T I D W S M * I N F N R F E * T D E I L R ----:----|----:----|----:----|----:----|----:----|----:----| N N I P * H L N V K I S K F L S I F Y * I I S Q D I Y I L K L L N S Y V S S I N * Q N T L T F * S * Y I Q I F Q H F I V BinI* Tsp4CI* | TspDTI | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | || HphI ApoI ApoI | | | || | MboII TspEI TspEI \ \ \ \\ \ \ \ \ GGTGAAGATCCCAAAGATAAAGAGAGTAAAAACGAATTTTTCCAACCCTTTATTGAATTT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTCTAGGGTTTCTATTTCTCTCATTTTTGCTTAAAAAGGTTGGGAAATAACTTAAA / // / / / / / | || | | MboII TspEI TspEI | || | HphI ApoI ApoI | || XhoII | || MboI | |DpnI | BstKTI TspDTI BinI* G E D P K D K E S K N E F F Q P F I E F V K I P K I K R V K T N F S N P L L N F * R S Q R * R E * K R I F P T L Y * I F ----:----|----:----|----:----|----:----|----:----|----:----| P S S G L S L S L L F S N K W G K I S N R H L D W L Y L S Y F R I K G V R * Q I T F I G F I F L T F V F K E L G K N F K CviJI |FatI ||MmeI ||CviAII ||| NlaIII StyI Csp6I ||| | MseI TsoI SecI* MnlI Hpy166II \\\ \ \ \ \ \ \ TTAGCCATGTTTAAGAAATGTGCCAAGGAAAACATTGAAAAGGAGGAAATGGAAAGAGTG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGGTACAAATTCTTTACACGGTTCCTTTTGTAACTTTTCCTCCTTTACCTTTCTCAC // // / / / / / || || | TsoI SecI* MnlI Hpy166II || || MseI StyI || |FatI || CviAII |NlaIII CviJI MmeI L A M F K K C A K E N I E K E E M E R V * P C L R N V P R K T L K R R K W K E C S H V * E M C Q G K H * K G G N G K S V ----:----|----:----|----:----|----:----|----:----|----:----| K A M N L F H A L S F M S F S S I S L T K L W T * S I H W P F C Q F P P F P F L * G H K L F T G L F V N F L L F H F S H AluI CviJI | SetI SapI | | MnlI RsaI Ksp632I* | | |MboII BsrDI \ \ \ \ \\ \ TACGAACAAAGGAAGAGCTTGTTAGATATGAGGACAAGCAGTAATAAGAAAAGCAATGGA 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTGTTTCCTTCTCGAACAATCTATACTCCTGTTCGTCATTATTCTTTTCGTTACCT // / / / // / |Csp6I | | | |MboII BsrDI RsaI | | | MnlI | | CviJI | | AluI | SetI Ksp632I* SapI Y E Q R K S L L D M R T S S N K K S N G T N K G R A C * I * G Q A V I R K A M E R T K E E L V R Y E D K Q * * E K Q W K ----:----|----:----|----:----|----:----|----:----|----:----| Y S C L F L K N S I L V L L L L F L L P T R V F S S S T L Y S S L C Y Y S F C H V F L P L A Q * I H P C A T I L F A I S BseGI TspDTI | MboI | SfaNI | | DpnI | | Hpy166II | | |BstKTI BccI | | |HphI | | ||FokI TspEI \ \ \ \\ \ \ \\\ \ AGTGATGAAAACGATGGTGAAAAAGTAAACAGGGATGCTGTTGATCTACTCATATCTAAA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTACTTTTGCTACCACTTTTTCATTTGTCCCTACGACAACTAGATGAGTATAGATTT / / // / // / / BccI TspDTI |SfaNI BseGI || | FokI Hpy166II || MboI HphI |DpnI BstKTI S D E N D G E K V N R D A V D L L I S K V M K T M V K K * T G M L L I Y S Y L N * * K R W * K S K Q G C C * S T H I * I ----:----|----:----|----:----|----:----|----:----|----:----| L S S F S P S F T F L S A T S R S M D L F H H F R H H F L L C P H Q Q D V * I * T I F V I T F F Y V P I S N I * E Y R F FnuDII* | Hin4II* | | BinI* | | | MboI | | | BamHI | | | XhoII | | | | DpnI | | | | NlaIV | | | | |BstKTI | | | | ||Hpy178III* TatI | | | | ||| BinI* |Csp6I | | | | ||| | BarI |MboII | | | | ||| | SetI ||RsaI | | | | ||| | |DdeI MnlI ||| MboII \ \ \ \ \\\ \ \\ \ \\\ \ TTACGCGAAGTAAAGAAGGATCCAGAACCTCTAAGAAGAAGAAAGAGTACAAAACTCAAT 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCGCTTCATTTCTTCCTAGGTCTTGGAGATTCTTCTTCTTTCTCATGTTTTGAGTTA / / / / // / //// / / / /// / | | | | || | |||BinI* | MnlI | ||TatI BarI | | | | || | ||SetI DdeI | |MboII | | | | || | |BarI | |Csp6I | | | | || | Hpy178III* | RsaI | | | | || XhoII MboII | | | | || BamHI | | | | || MboI | | | | |NlaIV | | | | |DpnI | | | | BstKTI | | | BinI* | | Hin4II* | FnuDII* TspEI L R E V K K D P E P L R R R K S T K L N Y A K * R R I Q N L * E E E R V Q N S M T R S K E G S R T S K K K K E Y K T Q * ----:----|----:----|----:----|----:----|----:----|----:----| N R S T F F S G S G R L L L F L V F S L I V R L L S P D L V E L F F F S Y L V * * A F Y L L I W F R * S S S L T C F E I CviJI | MseI | | MaeII | | TspDTI | | | Csp6I BsaBI | | | Hin4II* |MboI | | | |RsaI |BseGI | | | |SetI || DpnI | | | |TaiI || |BstKTI | | | ||FatI || || MaeII | | | |||CviAII || || | FokI | | | |||| TsoI || || | |SetI BarI | | | |||| |NlaIII TspDTI || || | |TaiI \ \ \ \ \\\\ \\ \ \\ \\ \ \\ GAAATAGCCATTAACGTACATGAAGGAGATGTAAAAACGAGAAAGGATGAAGATCACGTT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTATCGGTAATTGCATGTACTTCCTCTACATTTTTGCTCTTTCCTACTTCTAGTGCAA / // ///// // / // // / / / | || ||||| |FatI TspDTI || || | | TspDTI | || ||||| CviAII || || | | MboII | || ||||TsoI || || | MaeII | || |||NlaIII || || MboI | || |||Csp6I || || TaiI | || ||RsaI || || SetI | || |MaeII || |DpnI | || Hin4II* || BstKTI | |MseI |BsaBI | |TaiI BseGI | |SetI | TspDTI CviJI E I A I N V H E G D V K T R K D E D H V K * P L T Y M K E M * K R E R M K I T F N S H * R T * R R C K N E K G * R S R F ----:----|----:----|----:----|----:----|----:----|----:----| S I A M L T C S P S T F V L F S S S * T H F L W * R V H L L H L F S F P H L D R F Y G N V Y M F S I Y F R S L I F I V N FatI |CviAII ||Cac8I ||| SphI ||| NspI MboII ||| NlaIII |TspDTI ||| | MwoI || MaeI ||| | BstAPI \\ \ \\\ \ \ TTACTAGAGAGAACGCATGCTATGCTGAACGATATTCAAAATATATAG 4090 4100 4110 4120 ----:----|----:----|----:----|----:----|----:--- AATGATCTCTCTTGCGTACGATACGACTTGCTATAAGTTTTATATATC / / / /// | MaeI | ||FatI FokI | |BstAPI | |CviAII | |MwoI | Cac8I NlaIII NspI SphI L L E R T H A M L N D I Q N I * Y * R E R M L C * T I F K I Y X T R E N A C Y A E R Y S K Y I X ----:----|----:----|----:----|----:----|----:--- K S S L V C A I S F S I * F I Y K V L S F A H * A S R Y E F Y I * * L S R M S H Q V I N L I Y L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 9 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 3 AhaIII* 5 DraI AjuI 2 AloI 1 AluI 12 AluBI AlwNI 1 CaiI ApoI 22 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 6 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 2 BpuEI BceAI 1 BcgI 1 BclI 2 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 8 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 1 BmgT120I 3 BsaBI 3 Bse8I,BseJI BseGI 9 BstF5I,BtsCI BseMII 9 BseRI 5 BsgI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 9 BspHI 2 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BstAPI 2 BstKTI 19 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 7 CviQI,RsaNI CspCI 2 CviAII 11 CviJI 32 CviKI-1 CviRI* 15 HpyCH4V DdeI 14 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 19 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 3 AcuI Eco57MI 4 EcoP15I 3 EcoRI 1 EcoRV 3 Eco32I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 6 FatI 11 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 GlaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 10 HpyAV Hin6I 2 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 19 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 17 Hpy99I 1 KasI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 13 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 11 MboI 19 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 26 MfeI 1 MunI MlyI 7 SchI MmeI 7 MnlI 25 MroNI 1 NgoMIV MseI 33 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NarI 1 Mly113I NdeI 1 FauNDI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 3 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 7 PpsI PsiI 1 AanI PstI 1 RsaI 7 AfaI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI SduI 2 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 40 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 2 BcuI,AhlI SphI 2 PaeI,BbuI SspI 3 StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 10 TaqII 1 TatI 1 TauI 1 TfiI 11 PfeI TseI 4 ApeKI TsoI 4 Tsp45I 5 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 27 TspEI 56 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 3 TscAI TstI 1 Tth111I 2 PflFI,PsyI,AspI VspI 3 PshBI,AseI XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AflII AgeI AlfI ApaI ApaLI AscI Asp718I AsuII BaeI BbvCI BciVI BglI BmtI BplI Bpu10I BsaAI BsaXI BseBI BsePI BseSI BseYI BsiI* Bsp120I Bsp1407I BspMII* BspOI BssKI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I ClaI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoT22I FauI FseI FspAI GsaI HgiJII* KpnI MauBI McrI* MluI Mph1103I MstI* MvaI NcoI NheI NmeAIII NotI NruI NsiI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI ScaI ScrFI SexAI SfiI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TspMI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769