Restriction Map of NDC80/YIL144W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NDC80/YIL144W on chromosome IX from coordinates 78074 to 80149.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19672

TatI |Csp6I ||RsaI ||ScaI ||| MboI ||| BclI ||| | DpnI FatI ||| | |BstKTI |CviAII ||| | || FatI || AsuI* ||| | || AflIII || AvaII CviRI* ||| | || BspLU11I* || NlaIII | AluI ||| | || |CviAII || |BmgT120I | CviJI ||| | || || NspI || ||NlaIV MnlI | | SetI ||| | || || NlaIII || |||BslFI Hpy166II \ \ \ \\\ \ \\ \\ \ \\ \\\\ \ ATGCAAAGCTCAACAAGTACTGATCAACATGTGCTACATCACATGGACCCTCATCGGTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTCGAGTTGTTCATGACTAGTTGTACACGATGTAGTGTACCTGGGAGTAGCCAAA / / / /// // / / // / // // / /// | | CviJI ||| || | | |BspLU11I* | || || BslFI ||TaiI | | AluI ||| || | | |AflIII | || |AvaII ||SetI | SetI ||| || | | |FatI | || |AsuI* |Hpy166II CviRI* ||| || | | CviAII | || BmgT120I MnlI ||| || | NlaIII | || NlaIV ||| || | NspI | |FatI ||| || BclI | CviAII ||| || MboI NlaIII ||| |DpnI ||| BstKTI ||TatI |Csp6I ScaI RsaI M Q S S T S T D Q H V L H H M D P H R F C K A Q Q V L I N M C Y I T W T L I G L A K L N K Y * S T C A T S H G P S S V Y ----:----|----:----|----:----|----:----|----:----|----:----| X C L E V L V S * C T S C * M S G * R N X A F S L L Y Q D V H A V D C P G E D T H L A * C T S I L M H * M V H V R M P K MaeIII Tsp45I BseRI MaeII | MnlI | MboII | SetI | | MfeI | |TfiI | TaiI CviRI* | | TspEI | |HinfI \ \ \ \ \ \ \ \\ ACGTCCCAAATACCAACTGCAACATCGTCACAATTGAGGAGAAGAAACAGCACGAATCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGGGTTTATGGTTGACGTTGTAGCAGTGTTAACTCCTCTTCTTTGTCGTGCTTAGTT / / / / / / / / / MaeII CviRI* | | TspEI | | | SetI | | MfeI | | HinfI | Tsp45I | | TfiI | MaeIII | MboII MnlI BseRI T S Q I P T A T S S Q L R R R N S T N Q R P K Y Q L Q H R H N * G E E T A R I K V P N T N C N I V T I E E K K Q H E S R ----:----|----:----|----:----|----:----|----:----|----:----| V D W I G V A V D D C N L L L F L V F * * T G F V L Q L M T V I S S F F C C S D R G L Y W S C C R * L Q P S S V A R I L FatI |CviAII || MboI || BclI BssKI || |NlaIII EcoRII MwoI || ||DpnI | ScrFI | BsmI SetI || |||BstKTI | BseBI FauI AciI | |BsrI \ \\ \\\\ \ \ \ \ \ \\ GGTCTAACCGACATGATCAATAAGAGTATTGCCAGGAATACAATAAGCGGGACTGGCATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGATTGGCTGTACTAGTTATTCTCATAACGGTCCTTATGTTATTCGCCCTGACCGTAA / /// / / / / // // / | ||| BclI | | FauI || |BsrI MnlI | ||| MboI | EcoRII || BsmI | ||DpnI | BssKI |MwoI | |BstKTI BseBI AciI | |FatI ScrFI | CviAII NlaIII G L T D M I N K S I A R N T I S G T G I V * P T * S I R V L P G I Q * A G L A F S N R H D Q * E Y C Q E Y N K R D W H S ----:----|----:----|----:----|----:----|----:----|----:----| P R V S M I L L L I A L F V I L P V P M L D L R C S * Y S Y Q W S Y L L R S Q C T * G V H D I L T N G P I C Y A P S A N MnlI Tsp4CI* Csp6I | BslFI |MnlI |RsaI | | BsiYI* MnlI || CviRI* |SetI \ \ \ \ \\ \ \\ CCCACAGGAGGCATAAATAAAAATAAGAGGACAAGAAGCACGGTTGCAGGAGGTACAAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGTCCTCCGTATTTATTTTTATTCTCCTGTTCTTCGTGCCAACGTCCTCCATGTTTA / / / // / / // | BslFI MnlI || | | |Csp6I BsiYI* || | | RsaI || | SetI || CviRI* |MnlI Tsp4CI* P T G G I N K N K R T R S T V A G G T N P Q E A * I K I R G Q E A R L Q E V Q M H R R H K * K * E D K K H G C R R Y K W ----:----|----:----|----:----|----:----|----:----|----:----| G V P P M F L F L L V L L V T A P P V F E W L L C L Y F Y S S L F C P Q L L Y L G C S A Y I F I L P C S A R N C S T C I Csp6I HgaI |RsaI CviJI |Tsp4CI* MmeI \\ \ \\ \ GGTACAGCATTGGCTCTAAATGACAAATCCAACAGTAGAAACAGCGTCAGCAGATTATCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTCGTAACCGAGATTTACTGTTTAGGTTGTCATCTTTGTCGCAGTCGTCTAATAGT // / / / / |Csp6I CviJI | HgaI MmeI RsaI Tsp4CI* G T A L A L N D K S N S R N S V S R L S V Q H W L * M T N P T V E T A S A D Y Q Y S I G S K * Q I Q Q * K Q R Q Q I I N ----:----|----:----|----:----|----:----|----:----|----:----| P V A N A R F S L D L L L F L T L L N D H Y L M P E L H C I W C Y F C R * C I I T C C Q S * I V F G V T S V A D A S * * TseI |BisI DdeI ||BlsI |Hpy188I |||CviJI ||BbvI ||||EcoP15I ||| BinI* |||||SfeI* ||| | MboI |||||Cac8I ||| | XhoII |||||| TseI ||| | | DpnI |||||| CviRI* ||| | | |BstKTI |||||| |BisI ||| | | ||StyI |||||| |BseMII ||| | | ||SecI* |||||| ||BlsI ||| | | ||| CviJI |||||| ||PstI ||| | | ||| HaeIII |||||| ||BspCNI ||| | | ||| | BsmAI |||||| ||| BbvI ||| | | ||| | | DdeI \\\\\\ \\\ \ \\\ \ \ \\\ \ \ \ ATAAATCAACTTGGCAGCCTGCAGCAACATCTGAGCAATAGAGATCCAAGGCCACTAAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTAGTTGAACCGTCGGACGTCGTTGTAGACTCGTTATCTCTAGGTTCCGGTGATTCT /// ////// // / // // / // // / ||| |||||TseI || | || || | || || AjuI ||| ||||SfeI* || | || || | || |DdeI ||| ||||BisI || | || || | || BsmAI ||| |||BlsI || | || || | |HaeIII ||| ||CviRI* || | || || | |CviJI ||| ||BspCNI || | || || | SecI* ||| |EcoP15I || | || || | StyI ||| |BseMII || | || || XhoII ||| Cac8I || | || || MboI ||| PstI || | || |DpnI ||CviJI || | || BstKTI ||TseI || | |BinI* |BisI || | BbvI BlsI || DdeI |Hpy188I BbvI I N Q L G S L Q Q H L S N R D P R P L R * I N L A A C S N I * A I E I Q G H * E K S T W Q P A A T S E Q * R S K A T K R ----:----|----:----|----:----|----:----|----:----|----:----| I F * S P L R C C C R L L L S G L G S L L L D V Q C G A A V D S C Y L D L A V L Y I L K A A Q L L M Q A I S I W P W * S Hin6I |GlaI |Eco47III ||HhaI BdaI |||HaeII BdaI ||||MnlI ApoI AjuI ||||| Hpy178III* AjuI BseRI TspEI \ \\\\\ \ \ \ \ GACAAAAACTTCCAAAGCGCTATTCAAGAGGAGATTTATGACTATTTGAAAAAGAATAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTTTGAAGGTTTCGCGATAAGTTCTCCTCTAAATACTGATAAACTTTTTCTTATTT ///// / / / / ||||MnlI | AjuI BseRI BdaI |||Hin6I Hpy178III* BdaI ||Eco47III ||GlaI |HhaI HaeII D K N F Q S A I Q E E I Y D Y L K K N K T K T S K A L F K R R F M T I * K R I N Q K L P K R Y S R G D L * L F E K E * I ----:----|----:----|----:----|----:----|----:----|----:----| S L F K W L A I * S S I * S * K F F F L L C F S G F R * E L P S K H S N S F S Y V F V E L A S N L L L N I V I Q F L I F BdaI BdaI | ApoI FokI BseGI | TspEI \ \ \ \ TTTGATATTGAAACAAATCATCCCATTTCAATAAAATTTCTAAAACAACCCACTCAAAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTATAACTTTGTTTAGTAGGGTAAAGTTATTTTAAAGATTTTGTTGGGTGAGTTTTC / / / / / TspEI FokI BseGI BdaI TspEI ApoI BdaI ApoI F D I E T N H P I S I K F L K Q P T Q K L I L K Q I I P F Q * N F * N N P L K R * Y * N K S S H F N K I S K T T H S K G ----:----|----:----|----:----|----:----|----:----|----:----| N S I S V F * G M E I F N R F C G V * F I Q Y Q F L D D W K L L I E L V V W E F K I N F C I M G N * Y F K * F L G S L L MlyI PleI | MseI | | BinI* | | |HinfI | | || TaqI | | || |MboI | | || || DpnI | | || || |BssKI | | || || |EcoRII | | || || |BstKTI | | || || || ScrFI | | || || || BseBI | | || || || | MaeIII | | || || || | | SetI | | || || || | | |BsiYI* TsoI | | || || || | | || CviJI DdeI \ \ \ \\ \\ \\ \ \ \\ \ \ GGGTTTATTATCATTTTCAAGTGGTTATATTTAAGACTCGATCCAGGTTACGGCTTTACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAAATAATAGTAAAAGTTCACCAATATAAATTCTGAGCTAGGTCCAATGCCGAAATGA / // / / / // ///// / / TsoI || | | | || ||||| | CviJI || | | | || ||||| MaeIII || | | | || ||||EcoRII || | | | || ||||BssKI || | | | || |||BsiYI* || | | | || ||BseBI || | | | || ||ScrFI || | | | || |SetI || | | | || MboI || | | | |DpnI || | | | BstKTI || | | | TaqI || | | HinfI || | BinI* || MseI |PleI MlyI G F I I I F K W L Y L R L D P G Y G F T G L L S F S S G Y I * D S I Q V T A L L V Y Y H F Q V V I F K T R S R L R L Y * ----:----|----:----|----:----|----:----|----:----|----:----| P N I I M K L H N Y K L S S G P * P K V P T * * * K * T T I N L V R D L N R S * P K N D N E L P * I * S E I W T V A K S BdaI BdaI | BceAI | | TaqI | | |Hpy178III* | | || MboI | | || BglII | | || XhoII | | || | DpnI | | || | |BstKTI | | || | || ApoI | | || | || TspEI | | || | || | MseI | | || | || | |AhaIII* | | || | || | || BdaI | | || | || | || BdaI | | || | || | || TspGWI HinfI \ \ \\ \ \\ \ \\ \ \ AAGTCTATCGAGAATGAGATCTATCAAATTTTAAAAAATCTGCGTTATCCGTTTTTAGAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGATAGCTCTTACTCTAGATAGTTTAAAATTTTTTAGACGCAATAGGCAAAAATCTC / / // // / / // / DdeI | || || XhoII | || TspGWI BdaI | || || BglII | || BdaI BdaI | || || MboI | || BdaI | || |DpnI | |MseI | || BstKTI | AhaIII* | |Hpy178III* TspEI | TaqI ApoI BceAI K S I E N E I Y Q I L K N L R Y P F L E S L S R M R S I K F * K I C V I R F * S V Y R E * D L S N F K K S A L S V F R V ----:----|----:----|----:----|----:----|----:----|----:----| L D I S F S I * * I K F F R R * G N K S * T * R S H S R D F K L F D A N D T K L L R D L I L D I L N * F I Q T I R K * L SetI PleI ApoI CviJI | CviJI ApoI FatI |MlyI TspEI |SfeI* | | TspEI TspEI |CviAII \\ \ \\ \ \ \ \ \\ TCAATAAATAAATCACAAATTTCGGCTGTAGGTGGCTCTAATTGGCACAAATTTCTTGGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTATTTATTTAGTGTTTAAAGCCGACATCCACCGAGATTAACCGTGTTTAAAGAACCG / / / / // / / / / HinfI PleI | | || CviJI TspEI TspEI NlaIII MlyI | | |SfeI* ApoI NspI | | SetI | CviJI TspEI ApoI S I N K S Q I S A V G G S N W H K F L G Q * I N H K F R L * V A L I G T N F L A N K * I T N F G C R W L * L A Q I S W H ----:----|----:----|----:----|----:----|----:----|----:----| D I F L D C I E A T P P E L Q C L N R P T L L Y I V F K P Q L H S * N A C I E Q * Y I F * L N R S Y T A R I P V F K K A NspI TspDTI NlaIII Csp6I FokI | MboI | BccI |RsaI | SspI | | DpnI | CviRI* |BseGI | | MseI BsrI | | |BstKTI \ \ \\ \ \ \ \ \ \ \\ ATGTTGCATTGGATGGTACGAACAAATATTAAACTGGATATGTGCTTGAATAAAGTAGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACGTAACCTACCATGCTTGTTTATAATTTGACCTATACACGAACTTATTTCATCTA // // / // // / / / // || |BccI | |Csp6I || MseI BsrI TspDTI |DpnI || CviRI* | RsaI |FokI BstKTI |FatI BseGI SspI CviAII M L H W M V R T N I K L D M C L N K V D C C I G W Y E Q I L N W I C A * I K * I V A L D G T N K Y * T G Y V L E * S R S ----:----|----:----|----:----|----:----|----:----|----:----| M N C Q I T R V F I L S S I H K F L T S C T A N S P V F L Y * V P Y T S S Y L L H Q M P H Y S C I N F Q I H A Q I F Y I BseMII |BspCNI || TspEI || | DdeI MseI || | |Hpy188I VspI || | || CviJI |TspEI || | || | Cac8I || MseI || | || | | CviJI || VspI || | || | | | MseI || PacI || | || | | | |AhaIII* \\ \ \\ \ \\ \ \ \ \\ CGTTCATTAATTAATCAAAATACACAAGAAATAACAATTCTGAGCCAGCCTTTAAAGACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAGTAATTAATTAGTTTTATGTGTTCTTTATTGTTAAGACTCGGTCGGAAATTTCTGA / / // // // // / / // MboI | |VspI |BspCNI || || | | |MseI | |MseI BseMII || || | | AhaIII* | TspEI || || | CviJI VspI || || Cac8I PacI || |CviJI MseI || DdeI |Hpy188I TspEI R S L I N Q N T Q E I T I L S Q P L K T V H * L I K I H K K * Q F * A S L * R L F I N * S K Y T R N N N S E P A F K D F ----:----|----:----|----:----|----:----|----:----|----:----| R E N I L * F V C S I V I R L W G K F V D N M L * D F Y V L F L L E S G A K L S T * * N I L I C L F Y C N Q A L R * L S AluI AsuI* CviJI Tsp4CI* AvaII |BsaXI | MseI |BmgT120I ||SetI | |TspEI \\ \\\ \ \\ TTGGACGAACAGGACCAAAGACAAGAAAGATATGAGCTAATGGTGGAGAAACTGTTAATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGCTTGTCCTGGTTTCTGTTCTTTCTATACTCGATTACCACCTCTTTGACAATTAA // / / / / / |AvaII | CviJI | | TspEI |AsuI* | AluI | MseI BmgT120I BsaXI Tsp4CI* SetI L D E Q D Q R Q E R Y E L M V E K L L I W T N R T K D K K D M S * W W R N C * L G R T G P K T R K I * A N G G E T V N * ----:----|----:----|----:----|----:----|----:----|----:----| K S S C S W L C S L Y S S I T S F S N I K P R V P G F V L F I H A L P P S V T L Q V F L V L S L F S I L * H H L F Q * N PleI TspEI |MlyI | SfaNI || HindIII | | CviJI || | AluI | | | TaqI || | CviJI MnlI | | | Bce83I* BsaXI HinfI || | | SetI | SmlI | | | | MwoI \ \ \\ \ \ \ \ \ \ \ \ \ \ GATTATTTTACAGAGTCTTACAAAAGCTTTTTGAAACTTGAGGATAATTATGAGCCTTCG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATAAAATGTCTCAGAATGTTTTCGAAAAACTTTGAACTCCTATTAATACTCGGAAGC / / / / / / / / / / // / BsaXI HinfI | | | | MnlI SmlI | | || TaqI | | | HindIII | | |MwoI | | CviJI | | Bce83I* | | AluI | CviJI | SetI | SfaNI PleI TspEI MlyI D Y F T E S Y K S F L K L E D N Y E P S I I L Q S L T K A F * N L R I I M S L R L F Y R V L Q K L F E T * G * L * A F D ----:----|----:----|----:----|----:----|----:----|----:----| S * K V S D * L L K K F S S S L * S G E Q N N * L T K C F S K S V Q P Y N H A K I I K C L R V F A K Q F K L I I I L R R Hpy166II | TspEI AluI CviRI* ApoI | | MseI CviJI | Hin4II* SetI TspEI | | VspI | SetI \ \ \ \ \ \ \ \ \ ATGCAAGAACTAAAGTTAGGTTTTGAAAAATTCGTTCACATAATTAATACTGATATAGCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTCTTGATTTCAATCCAAAACTTTTTAAGCAAGTGTATTAATTATGACTATATCGA // / / / // / / |Hin4II* SetI | Hpy166II |VspI | CviJI CviRI* TspEI |MseI | AluI ApoI TspEI SetI M Q E L K L G F E K F V H I I N T D I A C K N * S * V L K N S F T * L I L I * L A R T K V R F * K I R S H N * Y * Y S * ----:----|----:----|----:----|----:----|----:----|----:----| I C S S F N P K S F N T * M I L V S I A S A L V L T L N Q F I R E C L * Y Q Y L H L F * L * T K F F E N V Y N I S I Y S BdaI BdaI BdaI Hpy178III* BdaI CviJI \ \ \ \ AATCTACAAACCCAAAATGACAATCTTTATGAGAAATATCAAGAAGTAATGAAAATAAGC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGATGTTTGGGTTTTACTGTTAGAAATACTCTTTATAGTTCTTCATTACTTTTATTCG / / / / BdaI | BdaI CviJI BdaI | BdaI Hpy178III* N L Q T Q N D N L Y E K Y Q E V M K I S I Y K P K M T I F M R N I K K * * K * A S T N P K * Q S L * E I S R S N E N K P ----:----|----:----|----:----|----:----|----:----|----:----| L R C V W F S L R * S F Y * S T I F I L * D V F G F H C D K H S I D L L L S F L I * L G L I V I K I L F I L F Y H F Y A BssKI TspDTI EcoRII |MboI |SecI* || DpnI ||ScrFI TfiI || |BstKTI ||BseBI Hin4II* CviJI HinfI \\ \\ \\\ \ \ \ CAAAAGATCAAAACCACCAGGGAAAAATGGAAGGCTTTGAAAAGCGATTCTAATAAGTAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCTAGTTTTGGTGGTCCCTTTTTACCTTCCGAAACTTTTCGCTAAGATTATTCATA / // / / / / / / | || MboI | | Hin4II* CviJI HinfI | |DpnI | EcoRII TfiI | BstKTI | BssKI TspDTI | SecI* BseBI ScrFI Q K I K T T R E K W K A L K S D S N K Y K R S K P P G K N G R L * K A I L I S M K D Q N H Q G K M E G F E K R F * * V * ----:----|----:----|----:----|----:----|----:----|----:----| W F I L V V L S F H F A K F L S E L L Y G F S * F W W P F I S P K S F R N * Y T L L D F G G P F F P L S Q F A I R I L I HinfI |BtgZI || TspDTI || Hpy178III* || | PleI || | |MlyI || | ||CfrI || | ||| BalI || | ||| BssKI || | ||| CviJI || | ||| EcoRII || | ||| HaeIII || | ||| | ScrFI HindII || | ||| | BseBI Hpy166II || | ||| | | SetI | TspDTI || | ||| | | |Hpy166II TspEI | | FnuDII* || | ||| | | || BsrI \ \ \ \ \\ \ \\\ \ \ \\ \ GAAAATTATGTCAACGCGATGAAGCAAAAGAGTCAAGAATGGCCAGGTAAACTGGAAAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAATACAGTTGCGCTACTTCGTTTTCTCAGTTCTTACCGGTCCATTTGACCTTTTC / / / // // / / // / / / | | FnuDII* || || | | || | | BsrI | Hpy166II || || | | || | Hpy166II | TspDTI || || | | || EcoRII | HindII || || | | || BssKI TspEI || || | | |BseBI || || | | |ScrFI || || | | CfrI || || | | SetI || || | HaeIII || || | CviJI || || | BalI || || PleI || || MlyI || |Hpy178III* || BtgZI |HinfI TspDTI E N Y V N A M K Q K S Q E W P G K L E K K I M S T R * S K R V K N G Q V N W K R K L C Q R D E A K E S R M A R * T G K D ----:----|----:----|----:----|----:----|----:----|----:----| S F * T L A I F C F L * S H G P L S S F H F N H * R S S A F S D L I A L Y V P F F I I D V R H L L L T L F P W T F Q F L TspEI | MseI Hpy188I | | MboII | TspDTI | | | CviJI | Hpy166II | | | MboII SspI Hpy188I \ \ \ \ \ \ \ \ ATGAAATCCGAGTGTGAACTGAAAGAAGAAGAAATTAAAGCCTTACAAAGTAATATTTCC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTAGGCTCACACTTGACTTTCTTCTTCTTTAATTTCGGAATGTTTCATTATAAAGG / / / // // / / | | Hpy166II || |CviJI SspI Hpy188I | TspDTI || MboII Hpy188I |MseI MboII TspEI M K S E C E L K E E E I K A L Q S N I S * N P S V N * K K K K L K P Y K V I F P E I R V * T E R R R N * S L T K * Y F R ----:----|----:----|----:----|----:----|----:----|----:----| I F D S H S S F S S S I L A K C L L I E S S I R T H V S L L L F * L R V F Y Y K H F G L T F Q F F F F N F G * L T I N G TspEI | CviRI* ApoI | | ApoI TspEI TaqI | | TspEI BseMII AsuII | | | MseI |BspCNI DdeI | TspEI \ \ \ \ \\ \ \ \ GAATTGCACAAAATTTTAAGAAAAAAGGGAATTTCAACTGAGCAGTTCGAATTACAAAAC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACGTGTTTTAAAATTCTTTTTTCCCTTAAAGTTGACTCGTCAAGCTTAATGTTTTG // / / // / / / / |CviRI* | MseI || TspEI DdeI | TspEI TspEI TspEI || ApoI AsuII ApoI |BspCNI TaqI BseMII E L H K I L R K K G I S T E Q F E L Q N N C T K F * E K R E F Q L S S S N Y K T I A Q N F K K K G N F N * A V R I T K P ----:----|----:----|----:----|----:----|----:----|----:----| S N C L I K L F F P I E V S C N S N C F R I A C F K L F F P F K L Q A T R I V F F Q V F N * S F L S N * S L L E F * L V AluI CviJI | SetI Hpy188I | | MaeI BsrI | TspEI \ \ \ \ \ \ CAAGAAAGAGAAAAGCTGACTAGGGAACTTGATAAAATAAATATCCAGTCTGATAAATTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTCTCTTTTCGACTGATCCCTTGAACTATTTTATTTATAGGTCAGACTATTTAAC / / / / / / | CviJI MaeI BsrI Hpy188I TspEI | AluI SetI Q E R E K L T R E L D K I N I Q S D K L K K E K S * L G N L I K * I S S L I N * R K R K A D * G T * * N K Y P V * * I D ----:----|----:----|----:----|----:----|----:----|----:----| W S L S F S V L S S S L I F I W D S L N G L F L F A S * P V Q Y F L Y G T Q Y I L F S F L Q S P F K I F Y I D L R I F Q Hpy178III* | AluI | CviJI AluI | BstXI HindIII CviJI | | SetI | AluI | SetI | | |MnlI | CviJI NmeAIII | |TspEI | | || CviJI | |BciVI | MnlI | || MseI | | || |SecI* SspI | ||SetI | BsrI \ \\ \ \ \ \\ \\ \ \ \\\ \ \ ACAAGCTCAATTAAATCCAGAAAGCTGGAAGCCGAGGGAATATTCAAAAGCTTACTGGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCGAGTTAATTTAGGTCTTTCGACCTTCGGCTCCCTTATAAGTTTTCGAATGACCTA / / // // / / / / / / / / / / // / | CviJI |MseI || | | MnlI | | SspI | | | | || TaiI | AluI TspEI || | CviJI | SecI* | | | | || SetI SetI || | AluI CviJI | | | | |MnlI || SetI | | | | BsrI |BstXI | | | NmeAIII Hpy178III* | | HindIII | CviJI | BciVI | AluI SetI T S S I K S R K L E A E G I F K S L L D Q A Q L N P E S W K P R E Y S K A Y W I K L N * I Q K A G S R G N I Q K L T G Y ----:----|----:----|----:----|----:----|----:----|----:----| V L E I L D L F S S A S P I N L L K S S S L S L * I W F A P L R P F I * F S V P C A * N F G S L Q F G L S Y E F A * Q I MboI | DpnI TaqI | |BstKTI | Hpy99I | || FnuDII* MaeII | | ApoI | || | TsoI | SetI TfiI | | TspEI | || | |MfeI | TaiI HinfI | | | MseI | || | |TspEI \ \ \ \ \ \ \ \ \\ \ \\ ACGTTGAGGCAATACGATTCGTCGATACAAAATTTAACCAGATCGCGTAGTCAATTGGGT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAACTCCGTTATGCTAAGCAGCTATGTTTTAAATTGGTCTAGCGCATCAGTTAACCCA / / / / / // // / / MaeII | TaqI | MseI || || TsoI TspEI Hpy99I TspEI || |FnuDII* MfeI HinfI ApoI || MboI TfiI |DpnI BstKTI T L R Q Y D S S I Q N L T R S R S Q L G R * G N T I R R Y K I * P D R V V N W V V E A I R F V D T K F N Q I A * S I G S ----:----|----:----|----:----|----:----|----:----|----:----| V N L C Y S E D I C F K V L D R L * N P Y T S A I R N T S V F N L W I A Y D I P R Q P L V I R R Y L I * G S R T T L Q T TspDTI TfiI TspEI | MseI HinfI | MseI Hpy188I TspDTI \ \ \ \ \ \ \ CATAATGTTAATGATTCATCTCTAAAAATTAACATTTCAGAGAACTTATTAGACAGAGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTACAATTACTAAGTAGAGATTTTTAATTGTAAAGTCTCTTGAATAATCTGTCTCTA / / / // / / / TspDTI MseI HinfI |MseI Hpy188I TspDTI Hin4II* TfiI TspEI H N V N D S S L K I N I S E N L L D R D I M L M I H L * K L T F Q R T Y * T E I * C * * F I S K N * H F R E L I R Q R F ----:----|----:----|----:----|----:----|----:----|----:----| * L T L S E D R F I L M E S F K N S L S D Y H * H N M E L F * C K L S S I L C L M I N I I * R * F N V N * L V * * V S I MboI Hin4II* XhoII | FatI | DpnI | BspHI | |BstKTI | |CviAII | ||Hpy178III* | |Hpy178III* TspDTI | ||| TspEI | || NlaIII | MfeI | ||| |BinI* | || | SetI | TspEI | ||| || MseI HinfI \ \\ \ \ \ \ \ \\\ \\ \ \ TTTCATGAAGGTATCTCCTACGAGCAATTGTTTCCAAAGGGATCTGGAATTAACGAGTCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTACTTCCATAGAGGATGCTCGTTAACAAAGGTTTCCCTAGACCTTAATTGCTCAGA / /// / / // / / / // / | ||SetI TspDTI TspEI || | | | |MseI HinfI | |BspHI MfeI || | | | TspEI | |FatI || | | BinI* | Hpy178III* || | Hpy178III* | CviAII || XhoII NlaIII || MboI |DpnI BstKTI F H E G I S Y E Q L F P K G S G I N E S F M K V S P T S N C F Q R D L E L T S L S * R Y L L R A I V S K G I W N * R V Y ----:----|----:----|----:----|----:----|----:----|----:----| K * S P I E * S C N N G F P D P I L S D N E H L Y R R R A I T E L P I Q F * R T K M F T D G V L L Q K W L S R S N V L R ApoI MseI MseI TspEI |PleI | TspEI | Hpy178III* ||MlyI | | MseI | | TspDTI \\\ \ \ \ \ \ \ ATTAAAAAATCTATCTTAAAATTAAACGATGAAATTCAAGAAAGAATAAAAACCATTGAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTTTTTAGATAGAATTTTAATTTGCTACTTTAAGTTCTTTCTTATTTTTGGTAACTC / / // / / / PleI MseI |MseI | | TspDTI MlyI TspEI | Hpy178III* MseI TspEI ApoI I K K S I L K L N D E I Q E R I K T I E L K N L S * N * T M K F K K E * K P L R * K I Y L K I K R * N S R K N K N H * E ----:----|----:----|----:----|----:----|----:----|----:----| I L F D I K F N F S S I * S L I F V M S * * F I * R L I L R H F E L F F L F W Q N F F R D * F * V I F N L F S Y F G N L FatI |BdaI |BdaI |CviAII EcoRV MseI || NlaIII \ \ \\ \ AAAGACAACATAACATTAGAAAAAGATATCAAAAACTTAAAGCATGACATAAATGAGAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTGTTGTATTGTAATCTTTTTCTATAGTTTTTGAATTTCGTACTGTATTTACTCTTT / / // // EcoRV | || |FatI | || CviAII | |NlaIII | BdaI | BdaI MseI K D N I T L E K D I K N L K H D I N E K K T T * H * K K I S K T * S M T * M R K R Q H N I R K R Y Q K L K A * H K * E N ----:----|----:----|----:----|----:----|----:----|----:----| F S L M V N S F S I L F K F C S M F S F S L C C L M L F L Y * F S L A H C L H S F V V Y C * F F I D F V * L M V Y I L F AluI CviJI Ecl136II | SetI Hpy188I | SduI TspEI TspEI | ApoI | SacI | MseI BdaI | TspDTI | TspEI ApoI | HgiAI* | VspI BdaI | | TspEI | EcoRI TspEI | HgiJII* \ \ \ \ \ \ \ \ \ \ \ ACTCAAATTAATGAAAAACTTGAATTGGAATTGTCCGAAGCGAATTCCAAATTTGAGCTC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTTAATTACTTTTTGAACTTAACCTTAACAGGCTTCGCTTAAGGTTTAAACTCGAG // / / / / / / / / / / |VspI BdaI | TspEI | Hpy188I EcoRI | | | MwoI |MseI BdaI TspDTI TspEI TspEI | | Ecl136II TspEI ApoI | | CviJI | | AluI | HgiJII* | HgiAI* | SacI | SduI | SetI TspEI ApoI T Q I N E K L E L E L S E A N S K F E L L K L M K N L N W N C P K R I P N L S S S N * * K T * I G I V R S E F Q I * A L ----:----|----:----|----:----|----:----|----:----|----:----| V * I L S F S S N S N D S A F E L N S S F E F * H F V Q I P I T R L S N W I Q A S L N I F F K F Q F Q G F R I G F K L E Hin6I DdeI |GlaI |MwoI ||HhaI TspEI \\ \\\ \ TCTAAGCAGGAGAACGAACGATTATTAGTAGCGCAAAGAATTGAGATTGAAAAAATGGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTCGTCCTCTTGCTTGCTAATAATCATCGCGTTTCTTAACTCTAACTTTTTTACCTT / /// / DdeI ||Hin6I TspEI |GlaI HhaI S K Q E N E R L L V A Q R I E I E K M E L S R R T N D Y * * R K E L R L K K W K * A G E R T I I S S A K N * D * K N G K ----:----|----:----|----:----|----:----|----:----|----:----| E L C S F S R N N T A C L I S I S F I S R * A P S R V I I L L A F F Q S Q F F P R L L L V F S * * Y R L S N L N F F H F SfaNI | ApoI | TspEI | | BseMII | | |BspCNI | | ||TspDTI | | ||| MnlI | | ||| Hpy188I | | ||| | AlwNI | | ||| | |DdeI | | ||| | |BbvCI TspEI TfiI | | ||| | |Bpu10I | MseI HinfI | | ||| | || TspEI | VspI | BsaBI Hpy178III* | | ||| | || | MaeIII \ \ \ \ \ \ \ \\\ \ \\ \ \ AAAAAAATTAATGATTCAAATCTCTTGATGAAAACTAAAATTTCAGATGCTGAGGAATTG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTAATTACTAAGTTTAGAGAACTACTTTTGATTTTAAAGTCTACGACTCCTTAAC // // / //// / / / / |VspI |BsaBI Hpy178III* |||| | AlwNI | TspEI |MseI HinfI |||| Hpy188I Bpu10I TspEI TfiI |||| MnlI BbvCI |||TspEI DdeI |||ApoI ||TspDTI |BspCNI |SfaNI BseMII K K I N D S N L L M K T K I S D A E E L K K L M I Q I S * * K L K F Q M L R N W K N * * F K S L D E N * N F R C * G I G ----:----|----:----|----:----|----:----|----:----|----:----| F F I L S E F R K I F V L I E S A S S N F F F * H N L D R S S F * F K L H Q P I F F N I I * I E Q H F S F N * I S L F Q MboII | HindII TspGWI | Hpy166II TspEI | TspEI | | MseI \ \ \ \ \ \ GTAACTTCAACGGAACTAAAATTGGAAGAATTGAAAGTTGACTTAAACAGGAAACGATAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGAAGTTGCCTTGATTTTAACCTTCTTAACTTTCAACTGAATTTGTCCTTTGCTATG / / / / / / MaeIII TspGWI | | | MseI TspEI | | Hpy166II | | HindII | MboII TspEI V T S T E L K L E E L K V D L N R K R Y * L Q R N * N W K N * K L T * T G N D T N F N G T K I G R I E S * L K Q E T I Q ----:----|----:----|----:----|----:----|----:----|----:----| T V E V S S F N S S N F T S K F L F R Y P L K L P V L I P L I S L Q S L C S V I Y S * R F * F Q F F Q F N V * V P F S V ApoI TspEI FatI | MseI AflIII | |AhaIII* BspLU11I* | || TspEI |CviAII | || | MseI || NspI | || | VspI || NlaIII | || | | SspI \\ \ \ \\ \ \ \ AAACTACACCAACAAGTGATACATGTTATTGATATAACAAGTAAATTTAAAATTAATATT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATGTGGTTGTTCACTATGTACAATAACTATATTGTTCATTTAAATTTTAATTATAA / // /// // / | |BspLU11I* ||MseI || SspI | |AflIII || |VspI | |FatI || |MseI | CviAII || TspEI NlaIII |AhaIII* NspI TspEI ApoI K L H Q Q V I H V I D I T S K F K I N I N Y T N K * Y M L L I * Q V N L K L I F T T P T S D T C Y * Y N K * I * N * Y S ----:----|----:----|----:----|----:----|----:----|----:----| L S C W C T I C T I S I V L L N L I L I C V V G V L S V H * Q Y L L Y I * F * Y F * V L L H Y M N N I Y C T F K F N I N MaeII | SetI ApoI Hpy188I | TaiI TspEI | TspEI | Ksp632I* MaeIII |MboII \ \ \ \ \ \\ CAATCGTCATTGGAAAACTCTGAAAACGAATTAGGAAACGTCATTGAAGAGTTACGAAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGCAGTAACCTTTTGAGACTTTTGCTTAATCCTTTGCAGTAACTTCTCAATGCTTTA / / / / / / / Hpy188I | | | Ksp632I* | MboII | | MaeII MaeIII | TaiI | SetI TspEI Q S S L E N S E N E L G N V I E E L R N N R H W K T L K T N * E T S L K S Y E I I V I G K L * K R I R K R H * R V T K F ----:----|----:----|----:----|----:----|----:----|----:----| * D D N S F E S F S N P F T M S S N R F E I T M P F S Q F R I L F R * Q L T V F L R * Q F V R F V F * S V D N F L * S I MaeII |MaeIII || SetI || TaiI || | TspEI || | | MseI \\ \ \ \ TTGGAGTTTGAAACTGAACATAACGTAACAAATTAA 2050 2060 2070 ----:----|----:----|----:----|----:- AACCTCAAACTTTGACTTGTATTGCATTGTTTAATT / / / / // TspEI | | | |MseI ApoI | | | TspEI | | MaeIII | MaeII TaiI SetI L E F E T E H N V T N * W S L K L N I T * Q I X G V * N * T * R N K L X ----:----|----:----|----:----|----:- K S N S V S C L T V F * N P T Q F Q V Y R L L N Q L K F S F M V Y C I L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AflIII 2 AhaIII* 3 DraI AjuI 1 AluI 9 AluBI AlwNI 1 CaiI ApoI 15 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 Bce83I* 1 BpuEI BceAI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 8 BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 Bpu10I 1 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 4 BseRI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspLU11I* 2 PscI,PciI BsrI 5 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstKTI 9 BstXI 1 BtgZI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 7 CviJI 23 CviKI-1 CviRI* 7 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 9 MalI Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI EcoP15I 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 7 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 10 Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 9 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 5 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 3 MunI MlyI 5 SchI MmeI 1 MnlI 10 MseI 25 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NmeAIII 1 NspI 3 BstNSI,XceI PacI 1 PleI 5 PpsI PstI 1 RsaI 4 AfaI SacI 1 Psp124BI,SstI ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 20 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 4 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 5 TatI 1 TfiI 5 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 44 TasI,Tsp509I,Sse9I TspGWI 2 VspI 6 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvII* BcgI BetI* BfiI BglI BmeT110I BmtI BplI BsaAI BsePI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco57I Eco57MI EcoNI EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI GsuI HgiCI* Hin4I HpaI HpaII HphI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NotI NruI NsiI NspBII* OliI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI TspRI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769