Restriction Map of SSL2/YIL143C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SSL2/YIL143C on chromosome IX from coordinates 83041 to 80510.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Hin4II* |MaeII TaqII || SetI CviJI DdeI | Hpy178III* || TaiI | TspGWI |SetI | | BsiYI* \\ \ \ \ \\ \ \ \ ATGACGGACGTTGAAGGCTACCAACCTAAGAGCAAGGGGAAAATCTTTCCAGATATGGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGCCTGCAACTTCCGATGGTTGGATTCTCGTTCCCCTTTTAGAAAGGTCTATACCCA // / / / / / // || MaeII | SetI DdeI TaqII |BsiYI* |TaiI TspGWI Hpy178III* |SetI CviJI Hin4II* M T D V E G Y Q P K S K G K I F P D M G * R T L K A T N L R A R G K S F Q I W V D G R * R L P T * E Q G E N L S R Y G * ----:----|----:----|----:----|----:----|----:----|----:----| X V S T S P * W G L L L P F I K G S I P X S P R Q L S G V * S C P S F R E L Y P H R V N F A V L R L A L P F D K W I H T MnlI | Hpy188I | | TfiI | | HinfI | | | SfaNI | | | | AluI | | | | CviJI | | | | | SetI | | | | | |AlwNI | | | | | || MwoI | | | | | || | CviRI* | | | | | || | | MboI | | | | | || | | | DpnI PleI | | | | | || | | | |TaqI |MlyI | | | | | || | | | |ClaI HinfI |HphI | | HphI | | | || | | | |BstKTI \ \\ \ \ \ \ \ \ \\ \ \ \ \\ GAGTCCTTTTTCTCATCAGATGAGGATTCACCAGCTACTGATGCAGAGATCGATGAGAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAGGAAAAAGAGTAGTCTACTCCTAAGTGGTCGATGACTACGTCTCTAGCTACTCTTG / // / / / / / / / / // // | || | | HphI | | | MwoI | || |ClaI | || | Hpy188I | | AlwNI | || |TaqI | || MnlI | | CviJI | || MboI | |PleI | | SfaNI | |DpnI | |MlyI | | AluI | BstKTI | HphI | SetI CviRI* HinfI HinfI TfiI E S F F S S D E D S P A T D A E I D E N S P F S H Q M R I H Q L L M Q R S M R T V L F L I R * G F T S Y * C R D R * E L ----:----|----:----|----:----|----:----|----:----|----:----| S D K K E D S S S E G A V S A S I S S F H T R K R M L H P N V L * Q H L S R H S L G K E * * I L I * W S S I C L D I L V Cfr10I |HpaII || KasI || HgiCI* || |AcyI || |NarI || |Hin6I || ||GlaI || ||DinI || ||NlaIV MaeII || |||HhaI Hin4II* || ||||FatI | SetI || ||||NcoI | TaiI || ||||StyI | | Hpy188I || ||||SecI* | | | MaeII || ||||DsaI* | | | |BtrI || ||||HaeII | | | || SetI || |||||CviAII | | | || TaiI || |||||| MaeIII | | | || | BciVI || |||||| NlaIII \ \ \ \\ \ \ \\ \\\\\\ \ TATGATGATAACAGGGAAACGTCAGAAGGACGTGGAGAAAGGGATACCGGCGCCATGGTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTACTATTGTCCCTTTGCAGTCTTCCTGCACCTCTTTCCCTATGGCCGCGGTACCAT / / / / // / ///// // | | | | || BciVI ||||| |DsaI* | | | | |MaeII ||||| |SecI* | | | | BtrI ||||| |StyI | | | TaiI ||||| |NcoI | | | SetI ||||| |FatI | | Hpy188I ||||| CviAII | MaeII ||||HgiCI* Hin4II* ||||NlaIII TaiI ||||KasI SetI |||Hin6I |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |Cfr10I |HhaI HpaII HaeII Y D D N R E T S E G R G E R D T G A M V M M I T G K R Q K D V E K G I P A P W * * * * Q G N V R R T W R K G Y R R H G N ----:----|----:----|----:----|----:----|----:----|----:----| * S S L L S V D S P R P S L S V P A M T S H H Y C P F T L L V H L F P Y R R W P I I I V P F R * F S T S F P I G A G H Y AciI NspBII* |BisI CviJI ||BlsI |SecI* |||AciI || Hpy188I |||TauI || |MboII |||| TfiI || || MnlI Cac8I |||| HinfI \\ \\ \ \ \\\\ \ ACAGGGTTGAAGAAGCCTCGGAAAAAGACCAAGAGTAGCAGGCATACAGCGGCGGATTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCCAACTTCTTCGGAGCCTTTTTCTGGTTCTCATCGTCCGTATGTCGCCGCCTAAGG / / // / / /// / / MaeIII | || MnlI Cac8I ||| | HinfI | |MboII ||| | TfiI | |SecI* ||| AciI | Hpy188I ||BisI CviJI ||AciI |BlsI NspBII* TauI T G L K K P R K K T K S S R H T A A D S Q G * R S L G K R P R V A G I Q R R I P R V E E A S E K D Q E * Q A Y S G G F L ----:----|----:----|----:----|----:----|----:----|----:----| V P N F F G R F F V L L L L C V A A S E L L T S S A E S F S W S Y C A Y L P P N C P Q L L R P F L G L T A P M C R R I G Hin6I |GlaI TfiI TspDTI |Eco47III HinfI |DdeI ||HhaI |EciI |Bpu10I |||HaeII || MnlI || HgaI |||| CviRI* \\ \ \\ \ \\\\ \ TCTATGAATCAAATGGACGCTAAGGATAAAGCGCTTTTGCAGGACACTAATAGCGATATA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGATACTTAGTTTACCTGCGATTCCTATTTCGCGAAAACGTCCTGTGATTATCGCTATAT / // / / //// / | |HinfI | Bpu10I |||Hin6I CviRI* | |TfiI | DdeI ||Eco47III | MnlI TspDTI ||GlaI EciI |HhaI HaeII HgaI S M N Q M D A K D K A L L Q D T N S D I L * I K W T L R I K R F C R T L I A I Y Y E S N G R * G * S A F A G H * * R Y T ----:----|----:----|----:----|----:----|----:----|----:----| E I F * I S A L S L A S K C S V L L S I R * S D F P R * P Y L A K A P C * Y R Y R H I L H V S L I F R K Q L V S I A I Y Hpy188I Hin4I | Hin4I | TspGWI Hpy178III* | | CviJI | | Hpy178III* |BsmAI | | |FatI | | | TfiI |Esp3I | | ||CviAII | | | HinfI || EcoP15I | | ||| NlaIII \ \ \ \ \\ \ \ \ \\\ \ CCAGCAGATTTCGTTCCAGATTCCGTCTCTGGAATGTTCAGAAGCCATGACTTTAGTTAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTCTAAAGCAAGGTCTAAGGCAGAGACCTTACAAGTCTTCGGTACTGAAATCAATA / / / / / / / / // // | TspGWI | HinfI | | | | || |FatI Hin4I | TfiI | | | | || CviAII Hpy178III* | | | | |NlaIII | | | | CviJI | | | Hpy188I | | Hin4I | EcoP15I | Esp3I | BsmAI Hpy178III* P A D F V P D S V S G M F R S H D F S Y Q Q I S F Q I P S L E C S E A M T L V I S R F R S R F R L W N V Q K P * L * L F ----:----|----:----|----:----|----:----|----:----|----:----| G A S K T G S E T E P I N L L W S K L * V L L N R E L N R R Q F T * F G H S * N W C I E N W I G D R S H E S A M V K T I FatI |CviAII || NlaIII || | BssKI || | EcoRII || | | ScrFI || | | BseBI || | | | AsuI* || | | | DraII || | | | |CviJI || | | | |HaeIII || | | | |BmgT120I || | | | || MboI || | | | || XhoII || | | | || | DpnI || | | | || | |BstKTI || | | | || | || BinI* || | | | || | || | MaeIII || | | | || | || | Tsp45I || | | | || | || | | BsiYI* AciI || | | | || | || | | | Tsp4CI* | MseI || | | | ||NlaIV | || | | | | MboI \ \ \\ \ \ \ \\\ \ \\ \ \ \ \ \ TTGCGGTTAAGACCAGACCATGCTTCCAGGCCCCTTTGGATCTCGCCAAGTGACGGTAGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACGCCAATTCTGGTCTGGTACGAAGGTCCGGGGAAACCTAGAGCGGTTCACTGCCATCC / / / // / /// // / / / / / / / | MseI | |FatI | ||DraII || | | | | | | BstKTI AciI | CviAII | ||AsuI* || | | | | | BplI NlaIII | || || | | | | | BplI | || || | | | | BplI | || || | | | | BplI | || || | | | Tsp4CI* | || || | | | Tsp45I | || || | | | MaeIII | || || | | BsiYI* | || || | BinI* | || || XhoII | || || MboI | || |DpnI | || BstKTI | |BmgT120I | |NlaIV | EcoRII | HaeIII | BssKI | CviJI BseBI ScrFI L R L R P D H A S R P L W I S P S D G R C G * D Q T M L P G P F G S R Q V T V G A V K T R P C F Q A P L D L A K * R * D ----:----|----:----|----:----|----:----|----:----|----:----| K R N L G S W A E L G R Q I E G L S P L N A T L V L G H K W A G K S R A L H R Y Q P * S W V M S G P G K P D R W T V T P GsuI Eco57MI | BplI | BplI | |MwoI | ||BplI | ||BplI | ||| CviJI | ||| |DdeI | ||| |Bpu10I | ||| || Hpy178III* BplI | ||| || | HphI BplI | ||| || | | DrdI DpnI | ||| || | | | MaeIII |BstKTI | ||| || | | | Tsp45I ||BplI | ||| || | | | BstEII ||BplI | ||| || | | | BspCNI ||| BinI* | ||| || | | | |BseMII ||| Hpy178III* | ||| || | | | || BsrDI \\\ \ \ \\\ \\ \ \ \ \\ \ ATCATTCTGGAGAGTTTCTCTCCATTAGCAGAACAGGCTCAGGACTTTCTGGTCACCATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAAGACCTCTCAAAGAGAGGTAATCGTCTTGTCCGAGTCCTGAAAGACCAGTGGTAA / / // / / // / // / / // / / | MboI |Hpy178III* | | |MwoI | || | | || | BstEII DpnI BinI* | | BplI | || | | || | Tsp45I | | BplI | || | | || | MaeIII | BplI | || | | || BsrDI | BplI | || | | |BseMII Eco57MI | || | | BspCNI GsuI | || | DrdI | || HphI | |Hpy178III* | Bpu10I | DdeI CviJI I I L E S F S P L A E Q A Q D F L V T I S F W R V S L H * Q N R L R T F W S P L H S G E F L S I S R T G S G L S G H H C ----:----|----:----|----:----|----:----|----:----|----:----| I M R S L K E G N A S C A * S K R T V M S * E P S N R E M L L V P E P S E P * W D N Q L T E R W * C F L S L V K Q D G N MslI |FatI |MnlI |BspHI ||CviAII ||Hpy178III* ||| MboI AccI ||| | DpnI CviRI* |Hpy166II ||| | |BstKTI | CviJI || TspDTI ||| NlaIII | || TspDTI \ \ \\ \ \\\ \ \ \\ \ GCAGAGCCTATAAGTAGACCCTCCCATATTCATGAATACAAGATCACAGCATACTCTTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTCGGATATTCATCTGGGAGGGTATAAGTACTTATGTTCTAGTGTCGTATGAGAAAC / / // // // // / / | CviJI |TspDTI || |BspHI || TspDTI MmeI CviRI* |AccI || |FatI || MboI Hpy166II || | |DpnI || | BstKTI || Hpy178III* || CviAII |NlaIII MnlI MslI A E P I S R P S H I H E Y K I T A Y S L Q S L * V D P P I F M N T R S Q H T L C R A Y K * T L P Y S * I Q D H S I L F V ----:----|----:----|----:----|----:----|----:----|----:----| A S G I L L G E W I * S Y L I V A Y E K Q L A * L Y V R G Y E H I C S * L M S K C L R Y T S G G M N M F V L D C C V R Q MmeI | TseI | CviRI* | |BisI | ||BlsI | |||AluI | |||CviJI | |||PvuII | |||NspBII* FokI | |||| SfeI* Hin4I | |||| | BbvI Hin4I | |||| | | Esp3I EcoRV TspGWI | |||| SetI | | BsmAI BseGI | Hpy178III* \ \\\\ \ \ \ \ \ \ \ TATGCAGCTGTTTCTGTAGGGTTGGAGACGGATGATATCATTTCAGTTCTGGATAGATTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGTCGACAAAGACATCCCAACCTCTGCCTACTATAGTAAAGTCAAGACCTATCTAAT //// / / / / / / / / / |||NspBII* | | BsmAI | | | | | Hpy178III* |||PvuII | | Esp3I | | | | FokI |||CviJI | BbvI | | | TspGWI |||TseI SfeI* | | Hin4I |||AluI | | Hin4I ||BisI | EcoRV |BlsI BseGI |SetI CviRI* Y A A V S V G L E T D D I I S V L D R L M Q L F L * G W R R M I S F Q F W I D Y C S C F C R V G D G * Y H F S S G * I I ----:----|----:----|----:----|----:----|----:----|----:----| Y A A T E T P N S V S S I M E T R S L N T H L Q K Q L T P S P H Y * K L E P Y I I C S N R Y P Q L R I I D N * N Q I S * Hin4I Hin4I | TfiI | HinfI | | TaqI Csp6I | | ClaI TspDTI |RsaI | | | TspDTI MseI | CviJI \\ \ \ \ \ \ \ \ TCCAAAGTACCCGTTGCTGAATCGATAATCAACTTCATTAAAGGGGCTACCATTTCATAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTTCATGGGCAACGACTTAGCTATTAGTTGAAGTAATTTCCCCGATGGTAAAGTATG /// / / / / / / ||Hin4I | ClaI | | CviJI Tsp4CI* ||Hin4I | TaqI | TspDTI |Csp6I TspDTI MseI RsaI HinfI TfiI S K V P V A E S I I N F I K G A T I S Y P K Y P L L N R * S T S L K G L P F H T Q S T R C * I D N Q L H * R G Y H F I R ----:----|----:----|----:----|----:----|----:----|----:----| D L T G T A S D I I L K M L P A V M E Y I W L V R Q Q I S L * S * * L P * W K M G F Y G N S F R Y D V E N F P S G N * V SpeI Tsp4CI* |MaeI MseI BsmAI \ \\ \ \ GGTAAAGTGAAACTAGTTATTAAGCATAATAGATATTTCGTGGAGACTACACAAGCAGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTTCACTTTGATCAATAATTCGTATTATCTATAAAGCACCTCTGATGTGTTCGTCTA // / / |SpeI MseI BsmAI MaeI G K V K L V I K H N R Y F V E T T Q A D V K * N * L L S I I D I S W R L H K Q I * S E T S Y * A * * I F R G D Y T S R Y ----:----|----:----|----:----|----:----|----:----|----:----| P L T F S T I L C L L Y K T S V V C A S R Y L S V L * * A Y Y I N R P S * V L L T F H F * N N L M I S I E H L S C L C I BsiYI* | AsuI* | Bsp120I | |AsuI* | |DraII | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | |||NlaIV | ||||ApaI CviRI* | ||||SduI BsaBI | MwoI | ||||BseSI |MboI | BstAPI TfiI | ||||HgiJII* || DpnI | | TspGWI HinfI | ||||| DdeI || |BstKTI \ \ \ \ \ \\\\\ \ \\ \\ ATTCTGCAAATGTTGCTGAATGATTCCGTCATCGGGCCCCTAAGAATAGATAGCGATCAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGACGTTTACAACGACTTACTAAGGCAGTAGCCCGGGGATTCTTATCTATCGCTAGTA / / / / / / /// / / // / | | TspGWI | | | ||| DdeI | || MboI | BstAPI | | | ||Bsp120I | |DpnI | MwoI | | | ||DraII | BstKTI CviRI* | | | ||AsuI* BsaBI | | | |BmgT120I | | | |AsuI* | | | |NlaIV | | | BmgT120I | | | HaeIII | | | NlaIV | | | CviJI | | HgiJII* | | BseSI | | SduI | | ApaI | BsiYI* HinfI TfiI I L Q M L L N D S V I G P L R I D S D H F C K C C * M I P S S G P * E * I A I I S A N V A E * F R H R A P K N R * R S S ----:----|----:----|----:----|----:----|----:----|----:----| I R C I N S F S E T M P G R L I S L S * Y E A F T A S H N R * R A G L F L Y R D N Q L H Q Q I I G D D P G * S Y I A I M TatI |Csp6I TatI |Eco57I |Csp6I |Eco57MI ||RsaI ||RsaI ||| MnlI |||BseGI AciI ||| CviJI ||||SfeI* FokI | NspBII* AciI \\\ \ \\\\\ \ \ \ \ CAAGTACAGCCACCAGAGGATGTACTACAGCAACAACTTCAGCAAACCGCTGGAAAACCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCATGTCGGTGGTCTCCTACATGATGTCGTTGTTGAAGTCGTTTGGCGACCTTTTGGG ///// / //// / / / ||||CviJI | |||| SfeI* FokI NspBII* |||MnlI | |||TatI AciI ||TatI | ||Csp6I |Csp6I | |RsaI RsaI | BseGI Eco57MI Eco57I Q V Q P P E D V L Q Q Q L Q Q T A G K P K Y S H Q R M Y Y S N N F S K P L E N P S T A T R G C T T A T T S A N R W K T R ----:----|----:----|----:----|----:----|----:----|----:----| * T C G G S S T S C C C S * C V A P F G D L V A V L P H V V A V V E A F R Q F V L Y L W W L I Y * L L L K L L G S S F G BceAI FauI MseI |Hpy188I CviJI CviRI* SetI FauI \ \ \\ \ \ \ \ GCTACTAATGTTAATCCGAACGATGTGGAAGCCGTGTTTAGTGCAGTTATAGGTGGTGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGATTACAATTAGGCTTGCTACACCTTCGGCACAAATCACGTCAATATCCACCACTA / / / / / / / / / AciI FauI | | BceAI CviJI CviRI* SetI BsgI | Hpy188I MseI A T N V N P N D V E A V F S A V I G G D L L M L I R T M W K P C L V Q L * V V I Y * C * S E R C G S R V * C S Y R W * * ----:----|----:----|----:----|----:----|----:----|----:----| A V L T L G F S T S A T N L A T I P P S R * * H * D S R H P L R T * H L * L H H S S I N I R V I H F G H K T C N Y T T I BdaI BdaI BceAI BsgI | SfaNI | AciI | |MboII TspEI | BsrBI | || MboII | BdaI | |HphI | || | MboII Hpy166II | BdaI \ \\ \ \\ \ \ \ \ \ AATGAGCGGGAAGAAGAAGATGATGATATTGATGCCGTTCACTCCTTTGAAATTGCCAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCGCCCTTCTTCTTCTACTACTATAACTACGGCAAGTGAGGAAACTTTAACGGTTA / / / / / // / / / / FauI | AciI | | || MboII Hpy166II | TspEI BsrBI | | |SfaNI BdaI HphI | | MboII BdaI | MboII | BceAI BdaI BdaI N E R E E E D D D I D A V H S F E I A N M S G K K K M M I L M P F T P L K L P M * A G R R R * * Y * C R S L L * N C Q * ----:----|----:----|----:----|----:----|----:----|----:----| L S R S S S S S S I S A T * E K S I A L Y H A P L L L H H Y Q H R E S R Q F Q W I L P F F F I I I N I G N V G K F N G I Hpy178III* PleI | TaqI HinfI |MlyI |MmeI ClaI \ \\ \\ \ GAGTCTGTTGAAGTCGTAAAGAAAAGATGTCAAGAAATCGATTATCCCGTGTTGGAAGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAGACAACTTCAGCATTTCTTTTCTACAGTTCTTTAGCTAATAGGGCACAACCTTCTT / / / / / HinfI PleI | | ClaI MlyI | | TaqI | Hpy178III* MmeI E S V E V V K K R C Q E I D Y P V L E E S L L K S * R K D V K K S I I P C W K N V C * S R K E K M S R N R L S R V G R I ----:----|----:----|----:----|----:----|----:----|----:----| S D T S T T F F L H * S I S * G T N S S H T Q Q L R L S F I D L F R N D R T P L L R N F D Y L F S T L F D I I G H Q F F BssKI | HpaII | ScrFI MboII | CauII* SetI \ \ \ \ TACGACTTTAGAAACGACCATAGAAACCCGGATTTAGATATTGATTTGAAACCTTCCACT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTGAAATCTTTGCTGGTATCTTTGGGCCTAAATCTATAACTAAACTTTGGAAGGTGA / /// / MboII ||BssKI SetI |HpaII CauII* ScrFI Y D F R N D H R N P D L D I D L K P S T T T L E T T I E T R I * I L I * N L P L R L * K R P * K P G F R Y * F E T F H S ----:----|----:----|----:----|----:----|----:----|----:----| Y S K L F S W L F G S K S I S K F G E V I R S * F R G Y F G P N L Y Q N S V K W V V K S V V M S V R I * I N I Q F R G S Hpy178III* Cac8I Hin4II* | BseMII | SduI | Hpy188I | |BspCNI DdeI | HgiAI* \ \ \ \\ \ \ \ CAAATCAGACCCTATCAAGAAAAATCGCTGAGTAAAATGTTTGGTAATGGGCGTGCTCGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGTCTGGGATAGTTCTTTTTAGCGACTCATTTTACAAACCATTACCCGCACGAGCA / / // / / | Hpy188I |Hpy178III* DdeI HgiAI* Hin4II* |BspCNI Cac8I BseMII SduI Q I R P Y Q E K S L S K M F G N G R A R K S D P I K K N R * V K C L V M G V L V N Q T L S R K I A E * N V W * W A C S F ----:----|----:----|----:----|----:----|----:----|----:----| * I L G * * S F D S L L I N P L P R A R E F * V R D L F I A S Y F T Q Y H A H E L D S G I L F F R Q T F H K T I P T S T FatI BspMI AciI |CviAII | TseI || NlaIII | |BisI || | Hin6I | ||BlsI || | |GlaI | |||FatI || | ||HhaI SetI | ||||CviAII \\ \ \\\ \ \ \\\\\ TCAGGGATTATTGTTTTGCCATGTGGCGCAGGTAAAACTTTGGTCGGTATTACCGCAGCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCCTAATAACAAAACGGTACACCGCGTCCATTTTGAAACCAGCCATAATGGCGTCGT / // //// //// | || |||SetI |||NlaIII | || ||Hin6I |||TseI | || |GlaI |||NspI | || HhaI ||BisI | |BspMI |BlsI | |FatI AciI | CviAII NlaIII S G I I V L P C G A G K T L V G I T A A Q G L L F C H V A Q V K L W S V L P Q H R D Y C F A M W R R * N F G R Y Y R S M ----:----|----:----|----:----|----:----|----:----|----:----| E P I I T K G H P A P L V K T P I V A A N L S * Q K A M H R L Y F K P R Y * R L * P N N N Q W T A C T F S Q D T N G C C TatI BsmAI |NspI | FatI |Csp6I TspDTI | |CviAII |NlaIII | TatI | || MnlI ||RsaI | |Csp6I | || |CviRI* ||| TspGWI | ||RsaI | || |NlaIII ||| |BbvI TspEI | ||| TspGWI | || || MwoI \\\ \\ \ \ \\\ \ \ \\ \\ \ TGTACTATAAAAAAATCCGTAATTGTTTTATGTACTTCATCAGTCTCCGTCATGCAATGG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ACATGATATTTTTTTAGGCATTAACAAAATACATGAAGTAGTCAGAGGCAGTACGTTACC ///// / / /// / /// / / ||||TatI BbvI TspDTI ||TatI | ||| | BsrDI |||TspGWI TspEI |TspGWI | ||| MwoI |||Csp6I |Csp6I | ||CviRI* ||RsaI RsaI | ||FatI |FatI | |CviAII CviAII | BsmAI | MnlI NlaIII C T I K K S V I V L C T S S V S V M Q W V L * K N P * L F Y V L H Q S P S C N G Y Y K K I R N C F M Y F I S L R H A M E ----:----|----:----|----:----|----:----|----:----|----:----| H V I F F D T I T K H V E D T E T M C H M Y * L F I R L Q K I Y K M L R R * A I T S Y F F G Y N N * T S * * D G D H L P BsrDI | TseI Csp6I | |BisI Hpy166II | ||BlsI |RsaI SetI SetI | ||| TspEI BbvI || SetI | TspEI HphI | Hpy188I \ \\\ \ \ \\ \ \ \ \ \ \ AGGCAGCAATTTTTACAATGGTGTACCTTACAACCTGAAAATTGTGCTGTTTTCACCTCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTCGTTAAAAATGTTACCACATGGAATGTTGGACTTTTAACACGACAAAAGTGGAGA /// / / /// / // / / ||TseI TspEI | ||Csp6I SetI |HphI SetI Hpy188I |BisI | |RsaI TspEI BlsI | |SetI | Hpy166II BbvI R Q Q F L Q W C T L Q P E N C A V F T S G S N F Y N G V P Y N L K I V L F S P L A A I F T M V Y L T T * K L C C F H L * ----:----|----:----|----:----|----:----|----:----|----:----| L C C N K C H H V K C G S F Q A T K V E S A A I K V I T Y R V V Q F N H Q K * R P L L K * L P T G * L R F I T S N E G R Hpy178III* | TfiI | HinfI | | BetI* MnlI | | |HpaII XcmI \ \ \ \\ \ GATAATAAGGAAATGTTCCAGACAGAATCCGGTTTGGTTGTTTCCACTTATTCAATGGTG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATTCCTTTACAAGGTCTGTCTTAGGCCAAACCAACAAAGGTGAATAAGTTACCAC / / / // / MnlI | | |BetI* XcmI | | HpaII | HinfI | TfiI Hpy178III* D N K E M F Q T E S G L V V S T Y S M V I I R K C S R Q N P V W L F P L I Q W W * * G N V P D R I R F G C F H L F N G G ----:----|----:----|----:----|----:----|----:----|----:----| S L L S I N W V S D P K T T E V * E I T Q Y Y P F T G S L I R N P Q K W K N L P I I L F H E L C F G T Q N N G S I * H H SetI | FatI | BspHI | |CviAII | |Hpy178III* Hpy178III* | ||BsmAI | AloI | ||Eco31I | AgeI | ||| TfiI | BetI* | ||| HinfI | Cfr10I | ||| NlaIII | |HpaII TspDTI \ \\\ \ \ \\ \ GCAAACACAAGAAACAGGTCTCATGATTCACAAAAAGTTATGGATTTCTTGACCGGTAGG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTGTGTTCTTTGTCCAGAGTACTAAGTGTTTTTCAATACCTAAAGAACTGGCCATCC / / // // / / // / SetI | || |HinfI | | || TspDTI | || |TfiI | | |Cfr10I | || Eco31I | | |BetI* | || BsmAI | | |AgeI | |BspHI | | HpaII | |FatI | Hpy178III* | Hpy178III* AloI | CviAII NlaIII A N T R N R S H D S Q K V M D F L T G R Q T Q E T G L M I H K K L W I S * P V G K H K K Q V S * F T K S Y G F L D R * G ----:----|----:----|----:----|----:----|----:----|----:----| A F V L F L D * S E C F T I S K K V P L P L C L F C T E H N V F L * P N R S R Y C V C S V P R M I * L F N H I E Q G T P FatI |CviAII || NlaIII || | HgiCI* || | | NlaIV || | | | AciI || | | | SduI || | | | Cac8I || | | | BseSI || | | | | TspGWI || | | | | |AciI || | | | | |BisI || | | | | |BdaI || | | | | |BdaI TspDTI || | | | | ||BlsI BsrDI BdaI Hpy178III* || | | | | |||TauI | BtgZI BdaI | AloI || | | | | |||| FauI | | BsiYI* \ \ \ \\ \ \ \ \ \\\\ \ \ \ \ GAATGGGGGTTCATTATTCTTGACGAAGTTCATGTGGTGCCCGCCGCAATGTTCCGTAGG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACCCCCAAGTAATAAGAACTGCTTCAAGTACACCACGGGCGGCGTTACAAGGCATCC / / / / / // // /////// // / BdaI | | | | || || ||||||| |BsrDI BsiYI* BdaI | | | | || || ||||||| FauI | | | | || || ||||||AciI | | | | || || |||||BisI | | | | || || ||||BlsI | | | | || || |||AciI | | | | || || |||TauI | | | | || || ||BdaI | | | | || || ||BdaI | | | | || || |TspGWI | | | | || || |Cac8I | | | | || || HgiCI* | | | | || |NlaIV | | | | || BseSI | | | | || SduI | | | | |FatI | | | | CviAII | | | NlaIII | | Hpy178III* | AloI TspDTI E W G F I I L D E V H V V P A A M F R R N G G S L F L T K F M W C P P Q C S V G M G V H Y S * R S S C G A R R N V P * G ----:----|----:----|----:----|----:----|----:----|----:----| S H P N M I R S S T * T T G A A I N R L P I P T * * E Q R L E H P A R R L T G Y F P P E N N K V F N M H H G G C H E T P TseI |BisI ||BlsI BsmAI |||BccI BbvI TsoI Eco31I |||| MwoI TspEI |AciI BslFI \ \\\\ \ \ \\ \ GTGGTCTCCACCATCGCAGCACACGCCAAATTGGGACTGACCGCAACGCTGGTTAGAGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CACCAGAGGTGGTAGCGTCGTGTGCGGTTTAACCCTGACTGGCGTTGCGACCAATCTCTT / / //// / / / / BtgZI | |||BccI TspEI TsoI AciI BslFI | ||MwoI BbvI | ||TseI | |BisI | BlsI Eco31I BsmAI V V S T I A A H A K L G L T A T L V R E W S P P S Q H T P N W D * P Q R W L E K G L H H R S T R Q I G T D R N A G * R R ----:----|----:----|----:----|----:----|----:----|----:----| T T E V M A A C A L N P S V A V S T L S P P R W W R L V R W I P V S R L A P * L H D G G D C C V G F Q S Q G C R Q N S F TspEI | MboII | | MboI | | | DpnI | | | |BstKTI | | | || Hpy188I | | | || |ApoI | | | || |TspEI | | | || || HphI | | | || || | MseI | | | || || | |TspEI | | | || || | || AsuI* | | | || || | || AvaII BccI | | | || || | || |BmgT120I TspEI \ \ \ \\ \\ \ \\ \\ \ GATGATAAAATTGGTGATCTGAATTTTTTAATTGGTCCAAAACTTTATGAAGCAAATTGG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATTTTAACCACTAGACTTAAAAAATTAACCAGGTTTTGAAATACTTCGTTTAACC / / // / // / / // / / / | | || | || | | |AvaII | | TspDTI | | || | || | | |AsuI* | TspEI | | || | || | | BmgT120I BccI | | || | || | TspEI | | || | || MseI | | || | |TspEI | | || | |ApoI | | || | HphI | | || Hpy188I | | || MboI | | |DpnI | | BstKTI | TspEI MboII D D K I G D L N F L I G P K L Y E A N W M I K L V I * I F * L V Q N F M K Q I G * * N W * S E F F N W S K T L * S K L D ----:----|----:----|----:----|----:----|----:----|----:----| S S L I P S R F K K I P G F S * S A F Q L H Y F Q H D S N K L Q D L V K H L L N I I F N T I Q I K * N T W F K I F C I P TspDTI MnlI | TspEI | BslFI FatI | |BseGI FokI CviRI* | | CviRI* SetI |CviAII \ \\ \ \ \ \ \ \ \\ ATGGAATTATCCCAAAAAGGACATATTGCAAATGTCCAATGTGCAGAGGTTTGGTGTCCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAATAGGGTTTTTCCTGTATAACGTTTACAGGTTACACGTCTCCAAACCACAGGG / / / / / / // // | TspEI FokI CviRI* MnlI | |SetI |BsgI BseGI | BslFI NlaIII CviRI* M E L S Q K G H I A N V Q C A E V W C P W N Y P K K D I L Q M S N V Q R F G V P G I I P K R T Y C K C P M C R G L V S H ----:----|----:----|----:----|----:----|----:----|----:----| I S N D W F P C I A F T W H A S T Q H G S P I I G F L V Y Q L H G I H L P K T D H F * G L F S M N C I D L T C L N P T G BsgI ApoI EcoP15I BsmI |NlaIII TspEI MseI | CviRI* | Tsp4CI* \\ \ \ \ \ \ \ ATGACAGCAGAATTTTACCAAGAGTATTTAAGAGAAACTGCAAGGAAAAGAATGCTACTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTCGTCTTAAAATGGTTCTCATAAATTCTCTTTGACGTTCCTTTTCTTACGATGAC // / / / / / / |FatI TspEI MseI | CviRI* | Tsp4CI* CviAII ApoI EcoP15I BsmI M T A E F Y Q E Y L R E T A R K R M L L * Q Q N F T K S I * E K L Q G K E C Y C D S R I L P R V F K R N C K E K N A T V ----:----|----:----|----:----|----:----|----:----|----:----| M V A S N * W S Y K L S V A L F L I S S W S L L I K G L T N L L F Q L S F F A V H C C F K V L L I * S F S C P F S H * Q TspDTI | AjuI | | FatI | | |CviAII | | ||Cac8I FatI | | ||| SphI BspHI | | ||| NspI |CviAII | | ||| NlaIII |Hpy178III* | | ||| | TspEI || TfiI | | ||| | | MmeI || HinfI | | ||| | | | MseI Hpy178III* || NlaIII | | ||| | | | |TspEI |MnlI AjuI \\ \ \ \ \\\ \ \ \ \\ \\ \ TATATCATGAATCCAACAAAGTTTCAGGCATGCCAATTCTTAATTCAATATCACGAAAGG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAGTACTTAGGTTGTTTCAAAGTCCGTACGGTTAAGAATTAAGTTATAGTGCTTTCC / // / // / /// / / / / /// | || HinfI |AjuI | ||| | | | TspEI ||Hpy178III* | || TfiI TspDTI | ||| | | MseI |AjuI | |BspHI | ||| | TspEI MnlI | |FatI | ||| MmeI | Hpy178III* | ||FatI | CviAII | |CviAII NlaIII | Cac8I NlaIII NspI SphI Y I M N P T K F Q A C Q F L I Q Y H E R I S * I Q Q S F R H A N S * F N I T K G Y H E S N K V S G M P I L N S I S R K E ----:----|----:----|----:----|----:----|----:----|----:----| Y I M F G V F N * A H W N K I * Y * S L T Y * S D L L T E P M G I R L E I D R F I D H I W C L K L C A L E * N L I V F P MboI | DpnI | |BstKTI | || HphI Hpy188I Hpy166II \ \\ \ \ \ AGGGGTGATAAGATCATCGTTTTTTCAGATAATGTTTACGCCTTACAAGAATATGCTTTG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCCACTATTCTAGTAGCAAAAAAGTCTATTACAAATGCGGAATGTTCTTATACGAAAC // / / / || HphI Hpy188I Hpy166II || MboI |DpnI BstKTI R G D K I I V F S D N V Y A L Q E Y A L G V I R S S F F Q I M F T P Y K N M L * G * * D H R F F R * C L R L T R I C F E ----:----|----:----|----:----|----:----|----:----|----:----| L P S L I M T K E S L T * A K C S Y A K S P H Y S * R K K L Y H K R R V L I H K P T I L D D N K * I I N V G * L F I S Q NlaIV CviRI* \ \ AAAATGGGAAAACCATTTATTTATGGTTCCACACCACAACAAGAGCGTATGAACATTCTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACCCTTTTGGTAAATAAATACCAAGGTGTGGTGTTGTTCTCGCATACTTGTAAGAC / / NlaIV CviRI* K M G K P F I Y G S T P Q Q E R M N I L K W E N H L F M V P H H N K S V * T F C N G K T I Y L W F H T T T R A Y E H S A ----:----|----:----|----:----|----:----|----:----|----:----| F I P F G N I * P E V G C C S R I F M R S F P F V M * K H N W V V V L A Y S C E F H S F W K N I T G C W L L L T H V N Q ApoI TspEI |TspDTI || BsrI || | TatI || | |Csp6I || | ||RsaI \\ \ \\\ CAAAATTTCCAGTACAATGACCAAATCAATACCATATTTCTATCAAAAGTTGGTGATACT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTAAAGGTCATGTTACTGGTTTAGTTATGGTATAAAGATAGTTTTCAACCACTATGA / / /// | TspEI ||TatI | ApoI |Csp6I | BsrI RsaI TspDTI Q N F Q Y N D Q I N T I F L S K V G D T K I S S T M T K S I P Y F Y Q K L V I L K F P V Q * P N Q Y H I S I K S W * Y F ----:----|----:----|----:----|----:----|----:----|----:----| C F K W Y L S W I L V M N R D F T P S V A F N G T C H G F * Y W I E I L L Q H Y L I E L V I V L D I G Y K * * F N T I S AluI CviJI | SetI | | SetI HphI | | | MseI |TaqI | | | |TspEI BsmAI |ClaI BccI | | | || MboII Eco31I \\ \ \ \ \ \\ \ \ TCCATCGATTTACCAGAAGCTACCTGTTTAATTCAAATATCTTCGCACTATGGGTCTCGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAGCTAAATGGTCTTCGATGGACAAATTAAGTTTATAGAAGCGTGATACCCAGAGCA / / / / / / // / / | | BccI | | SetI || TspEI Hpy99I | ClaI | CviJI |MboII | TaqI | AluI MseI HphI SetI S I D L P E A T C L I Q I S S H Y G S R P S I Y Q K L P V * F K Y L R T M G L V H R F T R S Y L F N S N I F A L W V S S ----:----|----:----|----:----|----:----|----:----|----:----| E M S K G S A V Q K I * I D E C * P D R K W R N V L L * R N L E F I K A S H T E G D I * W F S G T * N L Y R R V I P R T ApoI TspEI | MseI | | MboII MaeII Hpy99I | | | AluI | SetI | Hpy178III* | | | CviJI | TaiI | | CviJI | | | | SetI | |Hin4II* SetI \ \ \ \ \ \ \ \ \ \\ \ CGTCAAGAAGCCCAAAGATTAGGAAGAATTTTAAGAGCTAAAAGACGTAATGACGAAGGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTCTTCGGGTTTCTAATCCTTCTTAAAATTCTCGATTTTCTGCATTACTGCTTCCA / / / / /// / / // / | | CviJI | ||| CviJI | |Hin4II* SetI | Hpy178III* | ||| AluI | MaeII Eco31I | ||SetI TaiI BsmAI | |MboII SetI | MseI TspEI ApoI R Q E A Q R L G R I L R A K R R N D E G V K K P K D * E E F * E L K D V M T K V S R S P K I R K N F K S * K T * * R R F ----:----|----:----|----:----|----:----|----:----|----:----| R * S A W L N P L I K L A L L R L S S P D D L L G F I L F F K L L * F V Y H R L T L F G L S * S S N * S S F S T I V F T TatI BciVI |Csp6I | DdeI ||RsaI BsmAI \ \ \\\ \ TTCAATGCGTTCTTTTATTCTCTGGTTTCTAAGGATACGCAAGAAATGTACTACTCAACA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTACGCAAGAAAATAAGAGACCAAAGATTCCTATGCGTTCTTTACATGATGAGTTGT / / /// BciVI DdeI ||TatI |Csp6I RsaI F N A F F Y S L V S K D T Q E M Y Y S T S M R S F I L W F L R I R K K C T T Q Q Q C V L L F S G F * G Y A R N V L L N K ----:----|----:----|----:----|----:----|----:----|----:----| K L A N K * E R T E L S V C S I Y * E V N * H T R K N E P K * P Y A L F T S S L E I R E K I R Q N R L I R L F H V V * C MboI | DpnI | |BstKTI | || MaeIII | || | SetI | || | | BsmI \ \\ \ \ \ AAGAGACAAGCGTTTTTGGTAGATCAAGGTTACGCATTCAAAGTCATTACACATTTACAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCTGTTCGCAAAAACCATCTAGTTCCAATGCGTAAGTTTCAGTAATGTGTAAATGTG / // // // BsmAI || |SetI |MaeIII || MboI BsmI |DpnI BstKTI K R Q A F L V D Q G Y A F K V I T H L H R D K R F W * I K V T H S K S L H I Y T E T S V F G R S R L R I Q S H Y T F T R ----:----|----:----|----:----|----:----|----:----|----:----| F L C A N K T S * P * A N L T M V C K C L S V L T K P L D L N R M * L * * V N V L S L R K Q Y I L T V C E F D N C M * V MaeII | SetI | TaiI | | TaqII | | | AluI TspGWI | | | CviJI | ApoI HphI | | | | SetI | TspEI |NdeI | | | | | CviRI* \ \ \\ \ \ \ \ \ \ GGAATGGAGAACATTCCAAATTTGGCATATGCTTCACCCAGAGAACGTAGAGAGCTATTG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTACCTCTTGTAAGGTTTAAACCGTATACGAAGTGGGTCTCTTGCATCTCTCGATAAC / / / / / / / / / / TspGWI | | NdeI | | | | CviJI CviRI* | HphI | | | | AluI TspEI | | | SetI ApoI | | TaqII | MaeII TaiI SetI G M E N I P N L A Y A S P R E R R E L L E W R T F Q I W H M L H P E N V E S Y C N G E H S K F G I C F T Q R T * R A I A ----:----|----:----|----:----|----:----|----:----|----:----| P I S F M G F K A Y A E G L S R L S S N R F P S C E L N P M H K V W L V Y L A I S H L V N W I Q C I S * G S F T S L * Q MboII |TseI |AluI |CviJI ||BisI |||BlsI |||SetI |||| MnlI |||| |MboII SetI HphI EcoP15I BcgI BbvI |||| || TaqI BcgI | TspEI \ \ \ \\\\ \\ \ \ \ \ CAAGAAGTATTATTGAAGAACGAAGAAGCTGCTGGTATCGAGGTCGGTGATGACGCTGAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCATAATAACTTCTTGCTTCTTCGACGACCATAGCTCCAGCCACTACTGCGACTG / / / / ////// / / / | BcgI BbvI | |||||MboII | BcgI HphI EcoP15I | ||||MnlI TaqI | |||TseI SetI | ||BisI | |BlsI | CviJI | AluI MboII SetI Q E V L L K N E E A A G I E V G D D A D K K Y Y * R T K K L L V S R S V M T L T R S I I E E R R S C W Y R G R * * R * Q ----:----|----:----|----:----|----:----|----:----|----:----| C S T N N F F S S A A P I S T P S S A S A L L I I S S R L L Q Q Y R P R H H R Q L F Y * Q L V F F S S T D L D T I V S V MnlI BceAI CviJI CfrI | MseI HaeIII | BalI | |SwaI | Hin4II* | CviJI | |BsaBI | |TspDTI HgaI MnlI SetI | HaeIII | |AhaIII* | || SetI \ \ \ \ \ \ \\ \ \\ \ AATTCTGTTGGGAGAGGTTCAAATGGCCACAAAAGATTTAAATCAAAGGCCGTTAGAGGT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGACAACCCTCTCCAAGTTTACCGGTGTTTTCTAAATTTAGTTTCCGGCAATCTCCA / / / / / / // // / / | HgaI SetI | CfrI | |MseI || | SetI | MnlI HaeIII | AhaIII* || Hin4II* TspEI CviJI | BsaBI || TspDTI BalI | SwaI |HaeIII BceAI |CviJI MnlI N S V G R G S N G H K R F K S K A V R G I L L G E V Q M A T K D L N Q R P L E V F C W E R F K W P Q K I * I K G R * R * ----:----|----:----|----:----|----:----|----:----|----:----| L E T P L P E F P W L L N L D F A T L P C N Q Q S L N L H G C F I * I L P R * L I R N P S T * I A V F S K F * L G N S T Tsp4CI* SetI Cac8I HphI |Csp6I | HphI | AciI | MboII ||RsaI \ \ \ \ \ \ \\\ GAAGGTTCATTGTCTGGTCTTGCTGGCGGTGAAGATATGGCATATATGGAATACAGTACC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCAAGTAACAGACCAGAACGACCGCCACTTCTATACCGTATATACCTTATGTCATGG / / / / / / / // SetI HphI | AciI | MboII | |Csp6I Cac8I HphI | RsaI Tsp4CI* E G S L S G L A G G E D M A Y M E Y S T K V H C L V L L A V K I W H I W N T V P R F I V W S C W R * R Y G I Y G I Q Y Q ----:----|----:----|----:----|----:----|----:----|----:----| S P E N D P R A P P S S I A Y I S Y L V H L N M T Q D Q Q R H L Y P M Y P I C Y F T * Q R T K S A T F I H C I H F V T G MseI VspI | Eco57I PsiI Hin4II* | Eco57MI | ApoI | FokI BseGI | | Hpy188I | TspEI \ \ \ \ \ \ \ \ AATAAAAACAAAGAACTGAAGGAACATCATCCATTAATCAGAAAGATGTATTATAAGAAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTTGTTTCTTGACTTCCTTGTAGTAGGTAATTAGTCTTTCTACATAATATTCTTA / / / // / / | FokI BseGI || Hpy188I PsiI Hin4II* |VspI |MseI Eco57MI Eco57I N K N K E L K E H H P L I R K M Y Y K N I K T K N * R N I I H * S E R C I I R I * K Q R T E G T S S I N Q K D V L * E F ----:----|----:----|----:----|----:----|----:----|----:----| L L F L S S F S C * G N I L F I Y * L F W Y F C L V S P V D D M L * F S T N Y S I F V F F Q L F M M W * D S L H I I L I TTGAAGAAGTGA 2530 ----:----|-- AACTTCTTCACT / TspEI ApoI L K K * * R S X E E V X ----:----|-- K F F H N S S T Q L L S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 11 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AloI 1 AluI 6 AluBI AlwNI 1 CaiI ApaI 1 ApoI 6 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BccI 3 BceAI 3 BcgI 1 BciVI 2 BfuI BdaI 4 BetI* 2 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 4 BplI 4 Bpu10I 2 BsaBI 2 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BseSI 2 BaeGI,BstSLI BsgI 2 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI BspCNI 2 BspHI 3 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 4 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CviAII 12 CviJI 19 CviKI-1 CviRI* 12 HpyCH4V DdeI 6 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 8 MalI DraII 2 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 3 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 3 EcoP15I 3 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 2 BsmBI FatI 12 FauI 3 SmuI FokI 4 GlaI 3 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HinfI 11 HpaII 4 HapII,BsiSI,MspI HphI 12 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 16 Hpy188III Hpy188I 10 Hpy99I 1 KasI 1 MaeI 1 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 4 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MlyI 2 SchI MmeI 3 MnlI 12 MseI 11 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 2 BstNSI,XceI PleI 2 PpsI PsiI 1 AanI PvuII 1 RsaI 9 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 27 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 5 TaqI 5 TaqII 2 TatI 6 TauI 2 TfiI 9 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 19 TasI,Tsp509I,Sse9I TspGWI 8 VspI 1 PshBI,AseI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AlfI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BbvII* Bce83I* BclI BfiI BglI BglII BmeT110I BmtI BsaAI BsaXI BsePI BseRI BseYI BsiI* Bsp1407I BspLU11I* BspMII* BspOI BssNAI Bst1107I BstXI BstZ17I BtsI Cfr9I CspCI DraIII Eam1105I Ecl136II EcoICRI EcoNI EcoRI EcoT22I EspI* FalI FnuDII* FseI FspAI GsaI HindII HindIII HpaI KpnI Ksp632I* MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SplI* SrfI Sse232I* Sse8387I SspI StuI TspMI TspRI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769