Restriction Map of OM45/YIL136W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

OM45/YIL136W on chromosome IX from coordinates 93619 to 94800.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.10381

BbvI |TseI |CviRI* ||BisI |||BlsI |||BtsI |||TspRI |||| MwoI |||| | TseI |||| | MwoI |||| | |BisI |||| | ||BlsI |||| | |||TseI |||| | |||AluI |||| | |||BbvI |||| | |||CviJI |||| | |||PvuII |||| | |||NspBII* |||| | |||| BsgI |||| | |||| | MwoI |||| | |||| | BbvI |||| | |||| | | NheI |||| | |||| | | AluI |||| | |||| | | BccI |||| | |||| | | CviJI |||| | |||| | | |MaeI |||| | |||| | | ||SetI |||| | |||| | | ||Cac8I |||| | ||||BisI | | ||| BmtI Hpy178III* |||| | |||||BlsI | | ||| | FatI | TspEI |||| | |||||SetI | | ||| | |CviAII \ \ \\\\ \ \\\\\\ \ \ \\\ \ \\ ATGTCATCAAGAATAATTGTCGGCAGTGCAGCATTGGCAGCTGCCATCACAGCTAGCATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTAGTTCTTATTAACAGCCGTCACGTCGTAACCGTCGACGGTAGTGTCGATCGTAG / / / //// / ///////// / ///// / | | TspRI |||| | ||||||||| | ||||| NlaIII | TspEI |||| | ||||||||| | ||||NheI Hpy178III* |||| | ||||||||| | |||MaeI |||| | ||||||||| | ||Cac8I |||| | ||||||||| | |BbvI |||| | ||||||||| | |BccI |||| | ||||||||| | CviJI |||| | ||||||||| | AluI |||| | ||||||||| | BmtI |||| | ||||||||| SetI |||| | ||||||||MwoI |||| | |||||||BsgI |||| | ||||||BbvI |||| | |||||TseI |||| | ||||BisI |||| | |||BlsI |||| | ||NspBII* |||| | ||PvuII |||| | ||CviJI |||| | ||TseI |||| | ||AluI |||| | |BisI |||| | BlsI |||| | SetI |||| MwoI |||MwoI |||TseI |||BbvI ||BisI |BlsI CviRI* BtsI M S S R I I V G S A A L A A A I T A S I C H Q E * L S A V Q H W Q L P S Q L A S V I K N N C R Q C S I G S C H H S * H H ----:----|----:----|----:----|----:----|----:----|----:----| X D D L I I T P L A A N A A A M V A L M X T M L F L Q R C H L M P L Q W * L * C H * * S Y N D A T C C Q C S G D C S A D MaeII MboII | SetI NlaIII CviJI | TaiI | SfaNI HaeIII Ksp632I* | | AciI | | Hpy188I |StyI | Hpy188I | | |BsmAI | | | Hin4II* |SecI* | |MnlI | | |Esp3I \ \ \ \ \\ \ \\ \ \ \\ ATGGTCAGAGAACAGAAGGCCAAGGGTCAGAGAAGAGAGGGCAACGTCTCCGCTTACTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGTCTCTTGTCTTCCGGTTCCCAGTCTCTTCTCTCCCGTTGCAGAGGCGAATGATG // / // / / /// / / / / || | |SfaNI | | ||Ksp632I* | MaeII | Esp3I || | Hin4II* | | |MnlI MboII | BsmAI || Hpy188I | | Hpy188I TaiI AciI |FatI | SecI* SetI CviAII | StyI HaeIII CviJI M V R E Q K A K G Q R R E G N V S A Y Y W S E N R R P R V R E E R A T S P L T T G Q R T E G Q G S E K R G Q R L R L L Q ----:----|----:----|----:----|----:----|----:----|----:----| M T L S C F A L P * L L S P L T E A * * * P * L V S P W P D S F L P C R R R K S H D S F L L G L T L S S L A V D G S V V CfrI | BssKI | CviJI | EcoRII | HaeIII | | ScrFI BceAI | | BseBI | Tsp4CI* AluI | | | Csp6I | |BsiYI* CviJI | | | |RsaI BceAI | ||BsiYI* | SetI \ \ \ \\ \ \ \\\ \ \ AACGGCCAGGAGTACGGCAGTTCAGCACCCCCACAGTTGGGAAAGCTACATAACATAAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCGGTCCTCATGCCGTCAAGTCGTGGGGGTGTCAACCCTTTCGATGTATTGTATTTC / // / // / /// / / | || | |Csp6I BceAI ||Tsp4CI* | CviJI | || | RsaI ||BsiYI* | AluI | || EcoRII |BsiYI* SetI | || BssKI BceAI | |BseBI | |ScrFI | CfrI HaeIII CviJI N G Q E Y G S S A P P Q L G K L H N I K T A R S T A V Q H P H S W E S Y I T * S R P G V R Q F S T P T V G K A T * H K A ----:----|----:----|----:----|----:----|----:----|----:----| L P W S Y P L E A G G C N P F S C L M F C R G P T R C N L V G V T P F A V Y C L V A L L V A T * C G W L Q S L * M V Y L Hin6I FnuDII* |GlaI FalI ||HhaI SfaNI FalI ||Hin4I |Hin4I | MboII ||Hin4I FalI |Hin4I | | MseI ||| HgaI FalI \\ \ \ \ \\\ \ \ CAAGGCATAAAGGAAGATGCCTTGTCGTTAAAAGACGCGCTTCTGGGCGTATCTCAAAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCGTATTTCCTTCTACGGAACAGCAATTTTCTGCGCGAAGACCCGCATAGAGTTTTC / / / / / / /// / / Hin4I SfaNI FalI MboII | | ||Hin6I | FalI Hin4I FalI | | |GlaI | FalI | | FnuDII* HgaI | | HhaI | Hin4I | Hin4I MseI Q G I K E D A L S L K D A L L G V S Q K K A * R K M P C R * K T R F W A Y L K R R H K G R C L V V K R R A S G R I S K G ----:----|----:----|----:----|----:----|----:----|----:----| C P M F S S A K D N F S A S R P T D * F A L C L P L H R T T L L R A E P R I E F L A Y L F I G Q R * F V R K Q A Y R L L CviJI EcoRV |NlaIV | Ksp632I* CviJI || MboII | |MnlI DdeI |MaeI || | MaeIII | |SfaNI |BseGI |Ksp632I* || | | SetI | |BetI* ||MboII ||MnlI || | | | DdeI HphI | ||HpaII |||Hpy188I \\\ \\ \ \ \ \ \ \ \\\ \\\\ GCTAGGGAAGAGGCTCCAAAGGTAACTAAGCGTGTGATATCACCGGAAGAGGATGCTCAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCCCTTCTCCGAGGTTTCCATTGATTCGCACACTATAGTGGCCTTCTCCTACGAGTC // // // // / / / / / /// / /// || || || |SetI | | HphI | | ||BetI* | ||DdeI || || || MboII | DdeI | | ||SfaNI | |Hpy188I || || |NlaIV MaeIII | | |HpaII | MboII || || CviJI | | Ksp632I* BseGI || |Ksp632I* | MnlI || MaeI EcoRV |MnlI CviJI A R E E A P K V T K R V I S P E E D A Q L G K R L Q R * L S V * Y H R K R M L R * G R G S K G N * A C D I T G R G C S D ----:----|----:----|----:----|----:----|----:----|----:----| A L S S A G F T V L R T I D G S S S A * P * P L P E L P L * A H S I V P L P H E S P F L S W L Y S L T H Y * R F L I S L FokI | Cac8I | | TseI | | BspCNI | | |BisI | | |BseMII | | ||BlsI | | |||AluI | | |||CviJI | | ||||MaeI | | |||||SetI | | |||||| CviJI | | |||||| HaeIII | | |||||| | BbvI | | |||||| | |Hin4I | | |||||| | || CviJI | | |||||| | || |StyI | | |||||| | || |MboII MfeI | | |||||| | || |SecI* TspEI | | |||||| | || || TfiI Hin4I | | |||||| | || || HinfI MboII MnlI | SfaNI \ \ \\\\\\ \ \\ \\ \ \ \ \ \ ACACGCAAGCAGCTAGGCCAAAAAGCCAAGGATTCTTCCTCGCAAAGCATCTTCAATTGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGCGTTCGTCGATCCGGTTTTTCGGTTCCTAAGAAGGAGCGTTTCGTAGAAGTTAACC // /// / / / / / / / / / / || ||| | HaeIII | | HinfI MboII | Hin4I | SfaNI || ||| | CviJI | | TfiI MnlI TspEI || ||| | Hin4I | SecI* MfeI || ||| MaeI | StyI || ||CviJI CviJI || ||TseI MboII || ||AluI BbvI || |BisI || BlsI || SetI |BseMII |FokI BspCNI Cac8I T R K Q L G Q K A K D S S S Q S I F N W H A S S * A K K P R I L P R K A S S I G T Q A A R P K S Q G F F L A K H L Q L G ----:----|----:----|----:----|----:----|----:----|----:----| V R L C S P W F A L S E E E C L M K L Q S V C A A L G F L W P N K R A F C R * N C A L L * A L F G L I R G R L A D E I P ApoI BccI CviJI TspEI MnlI |Hin4II* CviJI CviJI | TsoI DdeI \ \\ \ \ \ \ \ GGGTTTAGTGAGGCTGAAAGAAGGAAAGCCATAGCCATCGGGGAATTTGATACTGCTAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAAATCACTCCGACTTTCTTCCTTTCGGTATCGGTAGCCCCTTAAACTATGACGATTC / / / / / // / MnlI Hin4II* CviJI CviJI | |TspEI DdeI CviJI | |ApoI | TsoI BccI G F S E A E R R K A I A I G E F D T A K G L V R L K E G K P * P S G N L I L L R V * * G * K K E S H S H R G I * Y C * E ----:----|----:----|----:----|----:----|----:----|----:----| P N L S A S L L F A M A M P S N S V A L P T * H P Q F F S L W L W R P I Q Y Q * P K T L S F S P F G Y G D P F K I S S L AluI CviJI Ecl136II | SetI | SduI MboI | SacI |MboII | HgiAI* ||DpnI | HgiJII* ||BtsI | | SecI* ||TspRI | | DsaI* |||BstKTI | | Hpy166II ||||FalI | | | Tsp4CI* XmnI ||||FalI | | | | FalI |Ksp632I* ||||| Hin4II* | | | | FalI ||MnlI ||||| |Hin4I | | | | |BsaXI ||| TaqI ||||| |BsaXI | | | | || Hin4I ||| AsuII ||||| ||BinI* | | | |MslI || Hin4II* \\\ \ \\\\\ \\\ \ \ \ \\ \\ \ AAGCGTTTCGAAGAGGCAGTGGATCGTAATGAGAAGGAGCTCTTGTCCACGGTGATGAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCAAAGCTTCTCCGTCACCTAGCATTACTCTTCCTCGAGAACAGGTGCCACTACTCT // / / / //// // / / / / /// / / || | | TspRI |||| || BinI* | | | ||| | Hin4II* || | AsuII |||| |Hin4II* | | | ||| BsaXI || | TaqI |||| BsaXI | | | ||| Hin4I || Ksp632I* |||| MboI | | | ||FalI |MnlI |||Hin4I | | | ||FalI XmnI |||DpnI | | | ||MslI ||BstKTI | | | |DsaI* |MboII | | | |SecI* |BtsI | | | Tsp4CI* FalI | | Hpy166II FalI | Ecl136II | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI K R F E E A V D R N E K E L L S T V M R S V S K R Q W I V M R R S S C P R * * E A F R R G S G S * * E G A L V H G D E R ----:----|----:----|----:----|----:----|----:----|----:----| F R K S S A T S R L S F S S K D V T I L S A N R L P L P D Y H S P A R T W P S S L T E F L C H I T I L L L E Q G R H H S Hin4I Hin4I CviJI HaeIII |AciI |BisI ||FokI ||BlsI |||TauI Hin4I |||BsrBI Hin4I |||| MboII SfaNI | Csp6I |||| |Hpy178III* | Csp6I | |RsaI BsmAI HphI |||| || BseGI | |RsaI | |SetI | CviJI \ \\\\ \\ \ \ \\ \ \\ \ \ GAGAAGAAGGCCGCTCTGGACAGAGCATCCATTGAGTACGAAAGGTACGGGAGAGCCAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCTTCCGGCGAGACCTGTCTCGTAGGTAACTCATGCTTTCCATGCCCTCTCGGTCT / / ///// / / / // / // / / | | ||||| | | BseGI || | |Csp6I | BsmAI | | ||||| | Hpy178III* || | RsaI CviJI | | ||||| FokI || SetI | | ||||MboII |SfaNI | | |||BsrBI |Csp6I | | |||AciI Hin4I | | ||BisI Hin4I | | |BlsI RsaI | | HaeIII | | CviJI | | TauI | Hin4I | Hin4I HphI E K K A A L D R A S I E Y E R Y G R A R R R R P L W T E H P L S T K G T G E P E E E G R S G Q S I H * V R K V R E S Q R ----:----|----:----|----:----|----:----|----:----|----:----| S F F A A R S L A D M S Y S L Y P L A L L S S P R E P C L M W Q T R F T R S L W L L L G S Q V S C G N L V F P V P S G S AluI CviJI | SetI | | Hpy188I | | | AluI | | | CviJI | | | |MaeI MseI | | | ||SetI Tsp4CI* \ \ \ \ \\\ \ GACTTTAATGAGCTTTCGGACAAGCTAGACCAACAGGAAAGGAACAGTAATCCTTTGAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAATTACTCGAAAGCCTGTTCGATCTGGTTGTCCTTTCCTTGTCATTAGGAAACTTT / / / / / / / / | | | | | | MaeI Tsp4CI* | | | | | CviJI | | | | | AluI | | | | SetI | | | Hpy188I | | CviJI | | AluI | SetI MseI D F N E L S D K L D Q Q E R N S N P L K T L M S F R T S * T N R K G T V I L * N L * * A F G Q A R P T G K E Q * S F E T ----:----|----:----|----:----|----:----|----:----|----:----| S K L S S E S L S S W C S L F L L G K F L S * H A K P C A L G V P F S C Y D K S V K I L K R V L * V L L F P V T I R Q F CviJI |AciI |BisI ||BlsI |||TseI |||TauI |||NspBII* ||||BisI Eco57I MboII BbvI |||||BlsI Eco57MI |MaeIII |HgaI ||||||MboII | StyI |Tsp45I |HphI ||||||CviRI* | SecI* \\ \\ \\\\\\\ \ \ CGCCTGTTGAAGAATAACACGGGTGACGCTAATACTGAAGAAGCCGCTGCAAGAAGTGTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GCGGACAACTTCTTATTGTGCCCACTGCGATTATGACTTCTTCGGCGACGTTCTTCACAG / / / / / /////// / MboII | | | | ||||||| Eco57MI | | | | ||||||| Eco57I | | | | ||||||CviRI* | | | | ||||||TseI | | | | |||||MboII | | | | |||||BisI | | | | ||||BlsI | | | | |||NspBII* | | | | |||AciI | | | | ||BisI | | | | |BlsI | | | | CviJI | | | | TauI | | | HgaI | | BbvI | HphI Tsp45I MaeIII R L L K N N T G D A N T E E A A A R S V A C * R I T R V T L I L K K P L Q E V S P V E E * H G * R * Y * R S R C K K C P ----:----|----:----|----:----|----:----|----:----|----:----| R R N F F L V P S A L V S S A A A L L T V G T S S Y C P H R * Y Q L L R Q L F H A Q Q L I V R T V S I S F F G S C S T D MboII BseYI | CviJI CviJI BceAI | |Eco57I |BsiYI* HphI Ksp632I* | |Eco57MI || GsaI |MmeI | MnlI | || MboII \\ \ \\ \ \ \ \\ \ CAAGGCTGGGGTGATACGGCACAGGAGTTTGGTAGAGAAGAGTTGGAGGAAGCCAAGAGA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCGACCCCACTATGCCGTGTCCTCAAACCATCTCTTCTCAACCTCCTTCGGTTCTCT /// / / // / / // / ||| BseYI HphI || MnlI | |CviJI MboII ||CviJI MmeI |Ksp632I* | Eco57MI ||GsaI BceAI | Eco57I |SecI* MboII |StyI BsiYI* Q G W G D T A Q E F G R E E L E E A K R K A G V I R H R S L V E K S W R K P R E R L G * Y G T G V W * R R V G G S Q E K ----:----|----:----|----:----|----:----|----:----|----:----| W P Q P S V A C S N P L S S N S S A L L G L S P H Y P V P T Q Y L L T P P L W S L A P T I R C L L K T S F L Q L F G L S MaeII | BdaI | BdaI | SetI | TaiI | |Hpy178III* MboI Hpy188I Hin6I | || AluI | DpnI | MnlI |GlaI | || CviJI | |BstKTI XmnI | CviJI ||HhaI | || | SetI | || MboII \ \ \ \\\ \ \\ \ \ \ \\ \ AATGCTTCTTCAGAGCCAAGCGAGGCGCAAAAACGTCTTGACGAGCTGAAGAAGATCAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGAAGAAGTCTCGGTTCGCTCCGCGTTTTTGCAGAACTGCTCGACTTCTTCTAGTTC / / // /// / // / / / // / / XmnI | |CviJI ||| | || | | CviJI || | MboII | MnlI ||| | || | | AluI || MboI Hpy188I ||| | || | SetI |DpnI ||| | || Hpy178III* BstKTI ||| | |MaeII ||| | BdaI ||| | BdaI ||| TaiI ||| SetI ||Hin6I |GlaI HhaI N A S S E P S E A Q K R L D E L K K I K M L L Q S Q A R R K N V L T S * R R S R C F F R A K R G A K T S * R A E E D Q G ----:----|----:----|----:----|----:----|----:----|----:----| F A E E S G L S A C F R R S S S F F I L F H K K L A L R P A F V D Q R A S S S * I S R * L W A L R L F T K V L Q L L D L MboII | TsoI | | Eco57I | | Eco57MI | | |CviJI | | || BdaI AlfI MwoI | | || BdaI MaeIII AlfI |Cac8I \ \ \\ \ \ \ \\ GAAAAGGGCTGGTTTGGTTACAACAAAGGGGAGCAAAGCGAGCAACAGATTGCTGAACGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCCCGACCAAACCAATGTTGTTTCCCCTCGTTTCGCTCGTTGTCTAACGACTTGCC // / / / / / / / || | CviJI MaeIII AlfI | Cac8I MnlI || | BdaI AlfI MwoI || | BdaI || Eco57MI || Eco57I |TsoI MboII E K G W F G Y N K G E Q S E Q Q I A E R K R A G L V T T K G S K A S N R L L N G K G L V W L Q Q R G A K R A T D C * T G ----:----|----:----|----:----|----:----|----:----|----:----| S F P Q N P * L L P S C L S C C I A S R P F P S T Q N C C L P A F R A V S Q Q V F L A P K T V V F P L L A L L L N S F P FokI | CviJI | |AciI | |BisI MnlI Hin4II* | ||BlsI | CviJI | SetI | |||TauI | |AlfI | | BccI | |||HphI StyI | |AlfI | | | TsoI BseGI | |||BsrBI SecI* XcmI \ \\ \ \ \ \ \ \ \\\\ \ \ GTAGCCAGAGGTTTAGAAGGATGGGGTGAAACAGCCGCTCAACTTTCCAAGGACGAAATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CATCGGTCTCCAAATCTTCCTACCCCACTTTGTCGGCGAGTTGAAAGGTTCCTGCTTTAC // // // / //// / / || || |TsoI BseGI |||BsrBI | XcmI || || BccI |||AciI SecI* || |Hin4II* ||FokI StyI || SetI ||HphI |CviJI ||BisI AlfI |BlsI AlfI CviJI TauI V A R G L E G W G E T A A Q L S K D E M * P E V * K D G V K Q P L N F P R T K W S Q R F R R M G * N S R S T F Q G R N G ----:----|----:----|----:----|----:----|----:----|----:----| T A L P K S P H P S V A A * S E L S S I P L W L N L L I P H F L R E V K W P R F Y G S T * F S P T F C G S L K G L V F H BsrI | SfaNI | | MaeII | | AflIII | | | SetI | | | TaiI ApoI | | | | Hpy188I BccI TspEI | | | | |Hin4I | MseI TspEI EcoRI | | | | |Hin4I \ \ \ \ \ \ \ \ \\ GACGATTTAAGATGGAATTATGAGAATTCAAAGAAACAACTGGATAAGAACGTGTCCGAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTAAATTCTACCTTAATACTCTTAAGTTTCTTTGTTGACCTATTCTTGCACAGGCTA / / / / / / /// / | MseI TspEI EcoRI BsrI | ||| Hpy188I BccI TspEI | ||AflIII ApoI | |Hin4I | |Hin4I | MaeII | SfaNI TaiI SetI D D L R W N Y E N S K K Q L D K N V S D T I * D G I M R I Q R N N W I R T C P M R F K M E L * E F K E T T G * E R V R C ----:----|----:----|----:----|----:----|----:----|----:----| S S K L H F * S F E F F C S S L F T D S P R N L I S N H S N L S V V P Y S R T R V I * S P I I L I * L F L Q I L V H G I Tsp4CI* |Csp6I ||RsaI ||| TseI ||| |BisI ||| |FalI MlyI ||| |FalI PleI ||| ||BlsI |FatI ||| |||CviJI |NcoI ||| |||| AlwNI |StyI ||| |||| | BsrI |SecI* FalI ||| |||| | XcmI |DsaI* FalI ||| |||| | TspRI ||CviAII |DdeI ||| |||| | |BccI ||| NlaIII ||Hin4II* Hin4I ||| |||| | |BbvI ||| |HinfI ||| MnlI Hin4I ||| |||| | ||BceAI \\\ \\ \\\ \ \ \\\ \\\\ \ \\\ GCCATGGACTCGTTATCTAAGGCGAAGGAGGACTTGAAACAGTACGGCAGCCACTGGTGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTACCTGAGCAATAGATTCCGCTTCCTCCTGAACTTTGTCATGCCGTCGGTGACCACC // // // / / / / // /// // / || || |FalI | DdeI Hin4I | || ||AlwNI || BccI || || |FalI | MnlI Hin4I | || ||CviJI |XcmI || || HinfI Hin4II* | || ||TseI BsrI || |DsaI* | || |TspRI || |SecI* | || |BisI || |StyI | || BlsI || |NcoI | |Csp6I || |FatI | FalI || CviAII | FalI |NlaIII | RsaI |PleI Tsp4CI* MlyI A M D S L S K A K E D L K Q Y G S H W W P W T R Y L R R R R T * N S T A A T G G H G L V I * G E G G L E T V R Q P L V V ----:----|----:----|----:----|----:----|----:----|----:----| A M S E N D L A F S S K F C Y P L W Q H H W P S T I * P S P P S S V T R C G S T G H V R * R L R L L V Q F L V A A V P P Hpy178III* | BseGI | | StyI | | SecI* | | | FokI | | | | SalI | | | | |TaqI Cac8I | | | | |AccI | CviJI AsuI* | | | | |SetI | | MseI |CviJI | | | | ||HindII | | |AhaIII* |HaeIII | | | | ||Hpy166II | | ||MnlI |BmgT120I \ \ \ \ \\\ \ \ \\\ \\ TCTGGATGGACTTCCAAGGTCGACAATGACAAGCAGGCTTTAAAAGATGAGGCCCAAAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCTACCTGAAGGTTCCAGCTGTTACTGTTCGTCCGAAATTTTCTACTCCGGGTTTTC /// / / / /// / / // /// ||| BseGI | | ||SalI | | |MseI ||AsuI* ||Hpy178III* | | |AccI | | AhaIII* |BmgT120I |BbvI | | |TaqI | | MnlI HaeIII BceAI | | Hpy166II | CviJI CviJI | | HindII Cac8I | | FokI | SecI* | StyI SetI S G W T S K V D N D K Q A L K D E A Q K L D G L P R S T M T S R L * K M R P K R W M D F Q G R Q * Q A G F K R * G P K E ----:----|----:----|----:----|----:----|----:----|----:----| D P H V E L T S L S L C A K F S S A W F T Q I S K W P R C H C A P K L L H P G F R S P S G L D V I V L L S * F I L G L L TspDTI ApoI |Csp6I XmnI Csp6I ||RsaI TspEI |RsaI ||| AjuI CviJI |TspDTI AjuI \\ \\\ \ \ \\ \ AAGTACGATGAAGCGTTGAAAAAGTACGATGAAGCCAAGAACAAATTCAAAGAATGGAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATGCTACTTCGCAACTTTTTCATGCTACTTCGGTTCTTGTTTAAGTTTCTTACCTTA // / / // / // / / |Csp6I | | |Csp6I CviJI || TspEI AjuI RsaI | | RsaI || ApoI | AjuI |XmnI TspDTI TspDTI K Y D E A L K K Y D E A K N K F K E W N S T M K R * K S T M K P R T N S K N G M V R * S V E K V R * S Q E Q I Q R M E * ----:----|----:----|----:----|----:----|----:----|----:----| F Y S S A N F F Y S S A L F L N L S H F S T R H L T S F T R H L W S C I * L I S L V I F R Q F L V I F G L V F E F F P I ApoI TspEI | HphI | | Hpy178III* | | | AluI | | | CviJI | | | Ecl136II | | | | TaqI | | | | SetI | | | | SduI | | | | SacI | | | | HgiAI* BccI | | | | HgiJII* MaeI \ \ \ \ \ \ \ GATAAGGGTGATGGTAAATTCTGGAGCTCGAAAAAGGACTAG 1150 1160 1170 1180 ----:----|----:----|----:----|----:----|-- CTATTCCCACTACCATTTAAGACCTCGAGCTTTTTCCTGATC / / / // / / / BccI | | || | TaqI MaeI | | || Ecl136II | | || CviJI | | || AluI | | |HgiJII* | | |HgiAI* | | |SacI | | |SduI | | |SetI | | Hpy178III* | TspEI | ApoI HphI D K G D G K F W S S K K D * I R V M V N S G A R K R T X * G * W * I L E L E K G L X ----:----|----:----|----:----|----:----|-- S L P S P L N Q L E F F S * H Y P H H Y I R S S S F P S I L T I T F E P A R F L V L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AjuI 1 AlfI 2 AluI 9 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 6 BseXI,BstV1I,Lsp1109I BccI 6 BceAI 4 BdaI 2 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 1 BmtI 1 BspOI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BseYI 1 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BspCNI 1 BsrBI 2 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 BtsI 2 Cac8I 4 BstC8I CfrI 1 AcoI,EaeI Csp6I 6 CviQI,RsaNI CviAII 2 CviJI 31 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 2 MalI DsaI* 2 BtgI,BstDSI Ecl136II 2 EcoICRI Eco57I 3 AcuI Eco57MI 3 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 6 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 2 GsaI 1 HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 6 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 2 HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 14 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 11 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PleI 1 PpsI PvuII 1 RsaI 6 AfaI SacI 2 Psp124BI,SstI SalI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 7 BseDI,BssECI,BsaJI SetI 16 SfaNI 6 LweI StyI 6 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 3 TauI 3 TfiI 1 PfeI TseI 6 ApeKI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 7 TasI,Tsp509I,Sse9I TspRI 3 TscAI XcmI 2 XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AloI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BciVI BclI BfiI BglI BglII BmeT110I BplI Bpu10I BsaAI BsaBI BsePI BseRI BseSI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Eco31I Eco47III EcoNI EcoP15I EcoT22I EgeI EheI EspI* FaqI FauI FseI FspAI GsuI HaeII HgiCI* HindIII HpaI Hpy99I KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacII SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TatI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769