Restriction Map of PRM5/YIL117C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PRM5/YIL117C on chromosome IX from coordinates 141569 to 140613.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BdaI TspEI | StuI | MseI HphI BsrDI | CviJI | Hin4II* TsoI | Tsp4CI* | MnlI | HaeIII | | MboII |TaqI \ \ \ \ \ \ \ \ \ \\ ATGACAGTAATCACCATTGCCAAGAGAGGCCTTCCAAAATTAACCACTTCCACTTCTTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTCATTAGTGGTAACGGTTCTCTCCGGAAGGTTTTAATTGGTGAAGGTGAAGAAGC / / / / / / / // / / / | | BsrDI MnlI BdaI HaeIII | || MboII TsoI TaqI | Tsp4CI* CviJI | |MseI HphI StuI | TspEI Hin4II* M T V I T I A K R G L P K L T T S T S S * Q * S P L P R E A F Q N * P L P L L R D S N H H C Q E R P S K I N H F H F F D ----:----|----:----|----:----|----:----|----:----|----:----| X V T I V M A L L P R G F N V V E V E E X S L L * W Q W S L G E L I L W K W K K H C Y D G N G L S A K W F * G S G S R R MboII | MboII Csp6I | TspDTI BsrI |RsaI | | MboII \ \\ \ \ \ ACAACAACTGCCAGTTCAAGTAGTACGATAACATCTGTTGCTTCTTCTTCATCTTCTTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTTGACGGTCAAGTTCATCATGCTATTGTAGACAACGAAGAAGAAGTAGAAGAAAT / // / // / BsrI |Csp6I | |MboII MboII RsaI | TspDTI MboII T T T A S S S S T I T S V A S S S S S L Q Q L P V Q V V R * H L L L L L H L L Y N N C Q F K * Y D N I C C F F F I F F T ----:----|----:----|----:----|----:----|----:----|----:----| V V V A L E L L V I V D T A E E E D E K S L L Q W N L Y Y S L M Q Q K K K M K K C C S G T * T T R Y C R N S R R * R R * Ksp632I* XbaI | MnlI |MaeI MboII | | MmeI |Hpy178III* FokI | BseGI | | | BseRI || MnlI \ \ \ \ \ \ \ \\ \ CCACTTTTGTCCAACTCTACATCCTCTTCTATTATACCAAGTATTACTCCTCCCTCTAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGAAAACAGGTTGAGATGTAGGAGAAGATAATATGGTTCATAATGAGGAGGGAGATCT / // // / // FokI |BseGI || BseRI |XbaI MboII |Ksp632I* Hpy178III* |MmeI MnlI MnlI MaeI P L L S N S T S S S I I P S I T P P S R H F C P T L H P L L L Y Q V L L L P L E T F V Q L Y I L F Y Y T K Y Y S S L * K ----:----|----:----|----:----|----:----|----:----|----:----| G S K D L E V D E E I I G L I V G G E L V V K T W S * M R K * * V L Y * E E R * W K Q G V R C G R R N Y W T N S R G R S TfiI HinfI | BssKI | |SecI* | |HpaII | ||ScrFI TspDTI MnlI | ||CauII* | Tsp4CI* MslI \ \ \\\ \ \ \ AATGGTAATCCTTATATTTTGGATTCCGGGGATATGCCTAATGGAACAGTTTTCATTGTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCATTAGGAATATAAAACCTAAGGCCCCTATACGGATTACCTTGTCAAAAGTAACAT / / / / / / / MnlI | | BssKI TspDTI Tsp4CI* MslI | | SecI* | CauII* | HpaII | ScrFI HinfI TfiI N G N P Y I L D S G D M P N G T V F I V M V I L I F W I P G I C L M E Q F S L * W * S L Y F G F R G Y A * W N S F H C S ----:----|----:----|----:----|----:----|----:----|----:----| F P L G * I K S E P S I G L P V T K M T F H Y D K Y K P N R P Y A * H F L K * Q I T I R I N Q I G P I H R I S C N E N Y FauI | TfiI | HinfI | | AciI | | FnuDII* SspI MboII \ \ \ \ \ GTGGGGGGAATCGCGGGAGTGATTTTTTTGGCAATATTGCTATGGTGGGTAATAACAACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CACCCCCCTTAGCGCCCTCACTAAAAAAACCGTTATAACGATACCACCCATTATTGTTGA / / / / / / | | | AciI SspI MboII | | FnuDII* | HinfI | TfiI FauI V G G I A G V I F L A I L L W W V I T T W G E S R E * F F W Q Y C Y G G * * Q L G G N R G S D F F G N I A M V G N N N L ----:----|----:----|----:----|----:----|----:----|----:----| T P P I A P T I K K A I N S H H T I V V L P P F R P L S K K P L I A I T P L L L H P S D R S H N K Q C Y Q * P P Y Y C S SetI |HindII |Hpy166II Hpy178III* || Hin4I | TfiI Hin4I || Hin4I | HinfI Hin4I \\ \ \ \ \ TATTCTTCGCATAGGTTGACCAGAAGTGTTCAGGACTACGAATCAAAGATGTTTTCCACA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGAAGCGTATCCAACTGGTCTTCACAAGTCCTGATGCTTAGTTTCTACAAAAGGTGT / / / / / / SetI | Hin4I | HinfI Hin4I | Hin4I | TfiI Hin4I Hpy166II Hpy178III* HindII Y S S H R L T R S V Q D Y E S K M F S T I L R I G * P E V F R T T N Q R C F P H F F A * V D Q K C S G L R I K D V F H T ----:----|----:----|----:----|----:----|----:----|----:----| * E E C L N V L L T * S * S D F I N E V K N K A Y T S W F H E P S R I L S T K W I R R M P Q G S T N L V V F * L H K G C FauI TfiI BceAI AjuI | ApoI BfiI BsrI HinfI BsiYI* | AciI | TspEI \ \ \ \ \ \ \ \ CAACATACCCAGTTTTACGGCGATTCCCCATATATGGATTATCCCGCCAAAGAAAATTTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTATGGGTCAAAATGCCGCTAAGGGGTATATACCTAATAGGGCGGTTTCTTTTAAAG / / / / / / / / BfiI BsrI | | BceAI AciI FauI TspEI | | AjuI ApoI | BsiYI* HinfI TfiI Q H T Q F Y G D S P Y M D Y P A K E N F N I P S F T A I P H I W I I P P K K I S T Y P V L R R F P I Y G L S R Q R K F P ----:----|----:----|----:----|----:----|----:----|----:----| C C V W N * P S E G Y I S * G A L S F K V V Y G T K R R N G M Y P N D R W L F N L M G L K V A I G W I H I I G G F F I E MboI | DpnI | |BstKTI | |BsiYI* TfiI | || AsuI* BslFI PfoI HinfI | || AvaII | HinfI BssKI |FalI | || |BmgT120I | | Hpy188I | HpaII |FalI | || ||SetI | | | PleI | ScrFI ||SfaNI | || |||AjuI | | | |MlyI | CauII* ||BseGI \ \\ \\\\ \ \ \ \\ \ \ \\\ CAAGATCAGGTCCATATCAGCGAGTCCGATATTAGTCCCGGAAATAAGGATGAATCGGTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTAGTCCAGGTATAGTCGCTCAGGCTATAATCAGGGCCTTTATTCCTACTTAGCCAC /// / // /// / /// / / / / ||| | |AvaII ||| PleI ||BssKI | | | SfaNI ||| | |AsuI* ||| MlyI ||PfoI | | HinfI ||| | BmgT120I ||Hpy188I |HpaII | | TfiI ||| AjuI |HinfI CauII* | BseGI ||| MboI BslFI ScrFI FalI ||| SetI FalI ||DpnI |BstKTI BsiYI* Q D Q V H I S E S D I S P G N K D E S V K I R S I S A S P I L V P E I R M N R * R S G P Y Q R V R Y * S R K * G * I G E ----:----|----:----|----:----|----:----|----:----|----:----| W S * T W I L S D S I L G P F L S S D T G L D P G Y * R T R Y * D R F Y P H I P L I L D M D A L G I N T G S I L I F R H SmlI AflII |MseI FokI ||TspDTI | TspDTI ||| TspEI | | CviRI* FalI ||| | TaqI CviJI | | | HphI FalI ||| | AsuII HaeIII \ \ \ \ \ \\\ \ \ \ AAAGATGCACTTGTATCTCATACTAATAATGAAAAACCATTCTTAAGTAATTTCGAAAGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACGTGAACATAGAGTATGATTATTACTTTTTGGTAAGAATTCATTAAAGCTTTCC / / // / / // / / / | | |HphI FalI | |AflII | | HaeIII | | CviRI* FalI | |SmlI | | CviJI | FokI | MseI | | TauI TspDTI TspDTI | AsuII | TaqI TspEI K D A L V S H T N N E K P F L S N F E R K M H L Y L I L I M K N H S * V I S K G R C T C I S Y * * * K T I L K * F R K A ----:----|----:----|----:----|----:----|----:----|----:----| F S A S T D * V L L S F G N K L L K S L S L H V Q I E Y * Y H F V M R L Y N R F F I C K Y R M S I I F F W E * T I E F P BseGI AciI CviRI* BisI | Hpy188I |BlsI | |TfiI ApoI ||FokI | |HinfI TspEI ||TauI | || SfaNI TspDTI HphI MmeI SetI \\\ \ \\ \ \ \ \ \ CCGCTATTCTCTCTTGCATCCGAATCCAACAGAAATTCACTTTTCATTTCACCAACAGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGATAAGAGAGAACGTAGGCTTAGGTTGTCTTTAAGTGAAAAGTAAAGTGGTTGTCCA /// / / / / / / / / / / / ||| FokI | | | | | | | HphI MmeI SetI ||AciI | | | | | | TspEI |BisI | | | | | | ApoI BlsI | | | | | TspDTI | | | | SfaNI | | | HinfI | | | TfiI | | Hpy188I | CviRI* BseGI P L F S L A S E S N R N S L F I S P T G R Y S L L H P N P T E I H F S F H Q Q V A I L S C I R I Q Q K F T F H F T N R * ----:----|----:----|----:----|----:----|----:----|----:----| G S N E R A D S D L L F E S K M E G V P A A I R E Q M R I W C F N V K * K V L L R * E R K C G F G V S I * K E N * W C T CviJI EcoRV HphI CviJI | MaeI \ \ \ \ \ GATATCTTATACAAAACAAGGCTATCTAAACTTTACCAAGAAAGCCCTAGATTATTACAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGAATATGTTTTGTTCCGATAGATTTGAAATGGTTCTTTCGGGATCTAATAATGTC / / / / / EcoRV HphI CviJI | MaeI CviJI D I L Y K T R L S K L Y Q E S P R L L Q I S Y T K Q G Y L N F T K K A L D Y Y R Y L I Q N K A I * T L P R K P * I I T E ----:----|----:----|----:----|----:----|----:----|----:----| S I K Y L V L S D L S * W S L G L N N C H Y R I C F L A I * V K G L F G * I I V I D * V F C P * R F K V L F A R S * * L Hin4I Hin4I | AccI | |MboII | |TspDTI Hin4I ApoI | |Hpy166II SetI Hin4I TspEI | ||FokI \ \ \ \ \\\ AAACCTGTGATTATGACAAGTGATAATGTATCTACAAATTCTCTGGTGTCTACAATCTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGACACTAATACTGTTCACTATTACATAGATGTTTAAGAGACCACAGATGTTAGAGA / / / //// / SetI Hin4I Hin4I |||| FokI Hin4I Hin4I |||AccI TspEI ||Hpy166II ApoI |MboII TspDTI K P V I M T S D N V S T N S L V S T I S N L * L * Q V I M Y L Q I L W C L Q S L T C D Y D K * * C I Y K F S G V Y N L F ----:----|----:----|----:----|----:----|----:----|----:----| F G T I I V L S L T D V F E R T D V I E S V Q S * S L H Y H I * L N E P T * L R F R H N H C T I I Y R C I R Q H R C D R Ksp632I* Hpy99I Tsp4CI* |BseGI |SfaNI | MnlI SetI BbvII* || AciI ||TaqI | |TaqII | TspDTI | HphI \\ \ \\\ \ \\ \ \ \ \ TCATCATCCGCATCGTCGCTCGATAACGGTAATGAAAAGGAGGTGGGTGAAGACATAAGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGTAGGCGTAGCAGCGAGCTATTGCCATTACTTTTCCTCCACCCACTTCTGTATTCC / / / / // / / / / / / | | | Hpy99I || | TaqII SetI TspDTI | BbvII* | | AciI || | MnlI | MboII | Ksp632I* || Tsp4CI* HphI BseGI |SfaNI TaqI S S S A S S L D N G N E K E V G E D I R H H P H R R S I T V M K R R W V K T * G I I R I V A R * R * * K G G G * R H K E ----:----|----:----|----:----|----:----|----:----|----:----| E D D A D D S S L P L S F S T P S S M L K M M R M T A R Y R Y H F P P P H L C L * * G C R R E I V T I F L L H T F V Y P TseI AluI MboII CviJI TspEI |BisI |FauI ||HphI ||MwoI ||BlsI ||BstAPI BbvI ||SetI MboII |||HphI | SfaNI ||| MseI | AciI |||| CviRI* | | TaqI ||| |TspEI BccI \ \ \\\\ \ \ \ \ \\\ \\ \ AAACCCGCAAAAATTGCATCTTCACCAAGTCGAAAGCTGCTTAATTCACCAGAAAGTGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGGCGTTTTTAACGTAGAAGTGGTTCAGCTTTCGACGAATTAAGTGGTCTTTCACTA / / //// / / / / //// / / / | | |||CviRI* | | | | |||| | TspEI BccI | | ||TspEI | | | | |||| MseI | | |FauI | | | | |||TseI | | HphI | | | | ||BisI | BstAPI | | | | |BlsI | MboII | | | | |HphI | MwoI | | | | CviJI AciI | | | | AluI | | | SetI | | TaqI | SfaNI BbvI K P A K I A S S P S R K L L N S P E S D N P Q K L H L H Q V E S C L I H Q K V M T R K N C I F T K S K A A * F T R K * W ----:----|----:----|----:----|----:----|----:----|----:----| F G A F I A D E G L R F S S L E G S L S S V R L F Q M K V L D F A A * N V L F H F G C F N C R * W T S L Q K I * W F T I BsiYI* Csp6I | TspEI |RsaI MaeIII | |TsoI || Tsp4CI* \ \ \\ \\ \ GGTAGCGTAAATCGTAACCATAGTAAGGGTAATTTGTTGGTCGTACAGTCCAAAAGAAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCGCATTTAGCATTGGTATCATTCCCATTAAACAACCAGCATGTCAGGTTTTCTTTT / / / / /// / | BsiYI* TsoI TspEI ||Tsp4CI* SetI MaeIII |Csp6I RsaI G S V N R N H S K G N L L V V Q S K R K V A * I V T I V R V I C W S Y S P K E N * R K S * P * * G * F V G R T V Q K K T ----:----|----:----|----:----|----:----|----:----|----:----| P L T F R L W L L P L K N T T C D L L F H Y R L D Y G Y Y P Y N T P R V T W F F T A Y I T V M T L T I Q Q D Y L G F S F Hin4II* | AvaI | XhoI | SmlI | Hpy178III* | |TaqI | |BmeT110I | || FatI | || SduI | || HgiAI* | || |MnlI BdaI | || |CviAII | GsuI SetI | || || NspI | Eco57MI SetI |TaqI | || || NlaIII | | BseGI \ \\ \ \\ \\ \ \ \ \ CCTACACCTTCGACTTATCTCGAGCACATGCTGGAGGGGAAAGAACAGGATGAGTAA 910 920 930 940 950 ----:----|----:----|----:----|----:----|----:----|----:-- GGATGTGGAAGCTGAATAGAGCTCGTGTACGACCTCCCCTTTCTTGTCCTACTCATT / / / /// / // / / / SetI | | ||| | |FatI | | BseGI | | ||| | CviAII | Eco57MI | | ||| NlaIII | GsuI | | ||| NspI BdaI | | ||| MnlI | | ||SmlI | | ||XhoI | | ||AvaI | | |BmeT110I | | |HgiAI* | | |TaqI | | |SduI | | Hpy178III* | Hin4II* TaqI P T P S T Y L E H M L E G K E Q D E * L H L R L I S S T C W R G K N R M S X Y T F D L S R A H A G G E R T G * V X ----:----|----:----|----:----|----:----|----:----|----:-- G V G E V * R S C M S S P F S C S S Y V * V K S K D R A C A P P S L V P H T R C R R S I E L V H Q L P F F L I L L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AjuI 1 AluI 1 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BceAI 1 BdaI 1 BfiI 1 BmrI,BmuI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 1 BseGI 5 BstF5I,BtsCI BseRI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 1 CauII* 2 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CviAII 1 CviJI 5 CviKI-1 CviRI* 3 HpyCH4V DpnI 1 MalI Eco57MI 1 EcoRV 1 Eco32I FalI 2 FatI 1 FauI 3 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 4 Hin4II* 2 HpyAV HindII 1 HincII HinfI 7 HpaII 2 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeIII 1 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MlyI 1 SchI MmeI 2 MnlI 6 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PfoI 1 PleI 1 PpsI RsaI 2 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 8 SfaNI 4 LweI SmlI 2 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaqI 6 TaqII 1 TauI 1 TfiI 6 PfeI TseI 1 ApeKI TsoI 2 Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 8 TasI,Tsp509I,Sse9I XbaI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BclI BetI* BglI BglII BinI* BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BsmAI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsI Cac8I Cfr10I Cfr9I CfrI ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoT22I EgeI EheI Esp3I EspI* FseI FspAI GlaI GsaI HaeII HgaI HgiCI* HgiJII* HhaI Hin6I HindIII HinP1I HpaI HspAI KasI KpnI MaeII MauBI McrI* MfeI MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StyI SwaI TaiI TatI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XcmI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769