Restriction Map of HIS5/YIL116W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HIS5/YIL116W on chromosome IX from coordinates 142928 to 144085.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15254

ApoI NlaIV TspEI TspEI PsiI | SetI \ \ \ \ \ ATGGTTTTTGATTTGAAAAGAATTGTTAGACCAAAAATTTATAACTTGGAACCTTATCGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAAAACTAAACTTTTCTTAACAATCTGGTTTTTAAATATTGAACCTTGGAATAGCG / / / / TspEI | PsiI NlaIV TspEI SetI ApoI M V F D L K R I V R P K I Y N L E P Y R W F L I * K E L L D Q K F I T W N L I A G F * F E K N C * T K N L * L G T L S L ----:----|----:----|----:----|----:----|----:----|----:----| X T K S K F L I T L G F I * L K S G * R X P K Q N S F F Q * V L F K Y S P V K D H N K I Q F S N N S W F N I V Q F R I A HgaI | GsuI | Eco57MI | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII | | || AsuI* | | || AvaII | | || NlaIII CviRI* MaeI | | || |TspDTI | HphI MnlI SecI* | AcyI | | || |BmgT120I \ \ \ \ \ \ \ \ \\ \\ TGTGCAAGAGATGATTTCACCGAGGGTATATTGCTAGACGCCAATGAAAATGCCCATGGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGTTCTCTACTAAAGTGGCTCCCATATAACGATCTGCGGTTACTTTTACGGGTACCT / / / / / / / / / //// | HphI MnlI SecI* | AcyI | | | |||BmgT120I CviRI* MaeI | | | ||SetI | | | |DsaI* | | | |SecI* | | | |StyI | | | |NcoI | | | |FatI | | | TspDTI | | | CviAII | | NlaIII | HgaI Eco57MI GsuI C A R D D F T E G I L L D A N E N A H G V Q E M I S P R V Y C * T P M K M P M D C K R * F H R G Y I A R R Q * K C P W T ----:----|----:----|----:----|----:----|----:----|----:----| Q A L S S K V S P I N S S A L S F A W P S H L L H N * R P Y I A L R W H F H G H T C S I I E G L T Y Q * V G I F I G M S MaeIII | BinI* | |BssKI | || HphI | || HpaII | || ScrFI | || CauII* | || | MboI | || | BamHI | || | XhoII | || | | DpnI | || | | NlaIV | || | | |BstKTI | || | | || BinI* | || | | || | MfeI SetI | || | | || | TspEI | BsrI TspEI TspEI | || | | || | | MnlI \ \ \ \ \ \\ \ \ \\ \ \ \ CCTACTCCAGTTGAATTGAGCAAGACCAATTTACATCGTTACCCGGATCCTCACCAATTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGAGGTCAACTTAACTCGTTCTGGTTAAATGTAGCAATGGGCCTAGGAGTGGTTAAC / / / / // //// / / // | BsrI TspEI TspEI || |||| | | |TspEI AvaII || |||| | | |MfeI AsuI* || |||| | | MnlI || |||| | BinI* || |||| XhoII || |||| BamHI || |||| MboI || |||NlaIV || |||DpnI || ||BstKTI || ||BssKI || |HpaII || CauII* || ScrFI |MaeIII |HphI BinI* P T P V E L S K T N L H R Y P D P H Q L L L Q L N * A R P I Y I V T R I L T N W Y S S * I E Q D Q F T S L P G S S P I G ----:----|----:----|----:----|----:----|----:----|----:----| G V G T S N L L V L K C R * G S G * W N V * E L Q I S C S W N V D N G P D E G I R S W N F Q A L G I * M T V R I R V L Q ApoI TspEI EcoRI | Hpy178III* EcoP15I | | AciI BsrDI | MnlI \ \ \ \ \ \ GAATTCAAGACCGCAATGACGAAATACAGGAACAAAACAAGCAGTTATGCCAATGACCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAGTTCTGGCGTTACTGCTTTATGTCCTTGTTTTGTTCGTCAATACGGTTACTGGGT / / / / / / | | AciI BsrDI | MnlI | Hpy178III* EcoP15I EcoRI TspEI ApoI E F K T A M T K Y R N K T S S Y A N D P N S R P Q * R N T G T K Q A V M P M T Q I Q D R N D E I Q E Q N K Q L C Q * P R ----:----|----:----|----:----|----:----|----:----|----:----| S N L V A I V F Y L F L V L L * A L S G P I * S R L S S I C S C F L C N H W H G F E L G C H R F V P V F C A T I G I V W SetI BsiYI* | MboI | XhoII | | DpnI StyI | | |BstKTI AvrII | | || Hpy188I SetI SecI* | | || | SfaNI SetI |MseI |MaeI | | || | BinI* \ \\ \\ \ \ \\ \ \ GAGGTAAAACCTTTAACTGCTGACAATCTGTGCCTAGGTGTGGGATCTGATGAGAGTATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCATTTTGGAAATTGACGACTGTTAGACACGGATCCACACCCTAGACTACTCTCATAA / / / /// // / / / SetI SetI MseI ||SecI* || | | SfaNI ||AvrII || | BinI* ||StyI || Hpy188I |BsiYI* || XhoII |MaeI || MboI SetI |DpnI BstKTI E V K P L T A D N L C L G V G S D E S I R * N L * L L T I C A * V W D L M R V L G K T F N C * Q S V P R C G I * * E Y * ----:----|----:----|----:----|----:----|----:----|----:----| S T F G K V A S L R H R P T P D S S L I L P L V K L Q Q C D T G L H P I Q H S Y L Y F R * S S V I Q A * T H S R I L T N BssKI |AvaI |BssKI |SecI* |Cfr9I ||HpaII FatI ||ScrFI |CviAII ||CauII* ||Cac8I ||BmeT110I XmnI ||| SphI |||SmaI |TfiI ||| NspI |||ScrFI |HinfI ||| NlaIII |||CauII* ||MboII \\\ \ \\\\ \\\ GATGCTATTATTAGAGCATGCTGTGTTCCCGGGAAAGAAAAGATTCTGGTTCTTCCACCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGATAATAATCTCGTACGACACAAGGGCCCTTTCTTTTCTAAGACCAAGAAGGTGGT / /// //// // / | ||FatI |||BssKI || HinfI | |CviAII ||Cfr9I || TfiI | Cac8I ||BssKI |MboII NlaIII ||SecI* XmnI NspI ||AvaI SphI |BmeT110I |CauII* |HpaII |ScrFI CauII* ScrFI SmaI D A I I R A C C V P G K E K I L V L P P M L L L E H A V F P G K K R F W F F H Q C Y Y * S M L C S R E R K D S G S S T N ----:----|----:----|----:----|----:----|----:----|----:----| S A I I L A H Q T G P F S F I R T R G G Q H * * * L M S H E R S L F S E P E E V I S N N S C A T N G P F F L N Q N K W W TatI |Csp6I MseI ||RsaI CviRI* VspI \\\ \ \ ACATATTCTATGTACTCTGTTTGTGCAAACATTAATGATATAGAAGTCGTCCAATGTCCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATAAGATACATGAGACAAACACGTTTGTAATTACTATATCTTCAGCAGGTTACAGGA /// / / ||TatI CviRI* VspI |Csp6I MseI RsaI T Y S M Y S V C A N I N D I E V V Q C P H I L C T L F V Q T L M I * K S S N V L I F Y V L C L C K H * * Y R S R P M S F ----:----|----:----|----:----|----:----|----:----|----:----| V Y E I Y E T Q A F M L S I S T T W H G L M N * T S Q K H L C * H Y L L R G I D C I R H V R N T C V N I I Y F D D L T R Tsp4CI* AluI | Hpy188I CviJI | | Hpy99I | SetI MlyI MseI | | Tsp4CI* BciVI MmeI | | MseI PleI \ \ \ \ \ \ \ \ \ \ TTAACTGTTTCCGACGGTTCTTTTCAAATGGATACCGAAGCTGTATTAACCATTTTGAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGACAAAGGCTGCCAAGAAAAGTTTACCTATGGCTTCGACATAATTGGTAAAACTTT / / / / / / / / / // | | | Tsp4CI* BciVI MmeI | CviJI MseI |PleI | | Hpy188I | AluI MlyI | | Hpy99I SetI | Tsp4CI* MseI L T V S D G S F Q M D T E A V L T I L K * L F P T V L F K W I P K L Y * P F * K N C F R R F F S N G Y R S C I N H F E K ----:----|----:----|----:----|----:----|----:----|----:----| K V T E S P E K * I S V S A T N V M K F K L Q K R R N K E F P Y R L Q I L W K S * S N G V T R K L H I G F S Y * G N Q F BssKI SexAI BetI* EcoRII |HpaII | ScrFI || NlaIV TsoI TspEI HphI | BseBI || |CviJI |HinfI | MseI |MaeIII | | SetI || || TspEI \\ \ \ \\ \ \ \ \\ \\ \ AACGACTCGCTAATTAAGTTGATGTTCGTTACTTCACCAGGTAATCCAACCGGAGCCAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGAGCGATTAATTCAACTACAAGCAATGAAGTGGTCCATTAGGTTGGCCTCGGTTT / / // / / // / //// TsoI HinfI |MseI HphI | || EcoRII |||CviJI TspEI | || SexAI ||NlaIV | || BssKI |BetI* | |BseBI HpaII | |ScrFI | SetI MaeIII N D S L I K L M F V T S P G N P T G A K T T R * L S * C S L L H Q V I Q P E P K R L A N * V D V R Y F T R * S N R S Q N ----:----|----:----|----:----|----:----|----:----|----:----| F S E S I L N I N T V E G P L G V P A L F R S A L * T S T R * K V L Y D L R L W V V R * N L Q H E N S * W T I W G S G F BsrI | MmeI | | MseI MseI | | | TaqI SetI TspEI BslFI \ \ \ \ \ \ \ \ ATTAAGACCAGTTTAATCGAAAAGGTCTTACAGAATTGGGACAATGGGTTAGTCGTTGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTCTGGTCAAATTAGCTTTTCCAGAATGTCTTAACCCTGTTACCCAATCAGCAACAA // / / / / / / / || | MmeI | | SetI TspEI BslFI || BsrI | TaqI |MseI MseI TspEI I K T S L I E K V L Q N W D N G L V V V L R P V * S K R S Y R I G T M G * S L L * D Q F N R K G L T E L G Q W V S R C * ----:----|----:----|----:----|----:----|----:----|----:----| I L V L K I S F T K C F Q S L P N T T T F * S W N L R F P R V S N P C H T L R Q N L G T * D F L D * L I P V I P * D N N CviJI HindIII | SfeI* | AluI | | AluI | CviJI | | CviJI | | SetI | | | HphI | | | MaeII | | | TstI | | | |BsaAI | | | SetI | | | |SnaBI | | | | SpeI | | | || SetI | | | | |MaeI | | | || TaiI | | | | || MaeIII | | | || | TspDTI | | | | || Tsp45I TsoI \ \ \ \\ \ \ \ \ \ \ \\ \ \ GATGAAGCTTACGTAGATTTTTGTGGTGGCTCTACAGCTCCACTAGTCACCAAGTATCCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTCGAATGCATCTAAAAACACCACCGAGATGTCGAGGTGATCAGTGGTTCATAGGA / / // // / / ///// // / / | | || || TspDTI | ||||HphI || | TsoI | | || |MaeII | |||CviJI || Tsp45I | | || SnaBI | |||AluI || MaeIII | | || BsaAI | ||SfeI* |SpeI | | |TaiI | |SetI MaeI | | |SetI | TstI | | HindIII CviJI | CviJI | AluI SetI D E A Y V D F C G G S T A P L V T K Y P M K L T * I F V V A L Q L H * S P S I L * S L R R F L W W L Y S S T S H Q V S * ----:----|----:----|----:----|----:----|----:----|----:----| S S A * T S K Q P P E V A G S T V L Y G Q H L K R L N K H H S * L E V L * W T D I F S V Y I K T T A R C S W * D G L I R BssKI CviJI |HpaII BciVI ||ScrFI |MaeIII ||CauII* || TstI ||| BsiYI* || | CviRI* ||| | SetI \\ \ \ \\\ \ \ AACTTGGTTACTTTGCAAACTCTATCCAAGTCATTCGGTTTAGCCGGGATTAGGTTGGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACCAATGAAACGTTTGAGATAGGTTCAGTAAGCCAAATCGGCCCTAATCCAACCCA / / / / / /// / | TstI | CviRI* | ||| SetI BciVI MaeIII | ||BssKI | |BsiYI* | CauII* | HpaII | ScrFI CviJI N L V T L Q T L S K S F G L A G I R L G T W L L C K L Y P S H S V * P G L G W V L G Y F A N S I Q V I R F S R D * V G Y ----:----|----:----|----:----|----:----|----:----|----:----| L K T V K C V R D L D N P K A P I L N P * S P * K A F E I W T M R N L R S * T P V Q N S Q L S * G L * E T * G P N P Q T MwoI |CfrI || BalI || CviJI || HaeIII || | ApoI || | TspEI || | | MseI || | | |AhaIII* || | | || Hin4II* || | | || |CviRI* || | | || || EcoP15I || | | || || | MwoI || | | || || | |BsrDI || | | || || | ||KasI || | | || || | ||HgiCI* || | | || || | |||AcyI || | | || || | |||NarI || | | || || | |||Hin6I || | | || || | ||||GlaI || | | || || | ||||DinI || | | || || | ||||NlaIV || | | || || | |||||HhaI || | | || || | ||||||HaeII || | | || || | ||||||| PsiI NdeI || | | || || | ||||||| | TspDTI | CviRI* || | | || || | ||||||| | | SspI \ \ \\ \ \ \\ \\ \ \\\\\\\ \ \ \ ATGACATATGCAACAGCAGAGTTGGCCAGAATTTTAAATGCAATGAAGGCGCCTTATAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTATACGTTGTCGTCTCAACCGGTCTTAAAATTTACGTTACTTCCGCGGAATATTA / / / / / / // / / / // ///// / / | CviRI* MwoI | CfrI | || | | | || ||||| | SspI NdeI HaeIII | || | | | || ||||| TspDTI CviJI | || | | | || ||||| PsiI BalI | || | | | || ||||HgiCI* | || | | | || ||||KasI | || | | | || |||Hin6I | || | | | || |||NarI | || | | | || |||AcyI | || | | | || ||NlaIV | || | | | || ||DinI | || | | | || ||GlaI | || | | | || |HhaI | || | | | || HaeII | || | | | |EcoP15I | || | | | BsrDI | || | | MwoI | || | CviRI* | || Hin4II* | |MseI | AhaIII* TspEI ApoI M T Y A T A E L A R I L N A M K A P Y N * H M Q Q Q S W P E F * M Q * R R L I I D I C N S R V G Q N F K C N E G A L * Y ----:----|----:----|----:----|----:----|----:----|----:----| I V Y A V A S N A L I K F A I F A G * L Y S M H L L L T P W F K L H L S P A K Y H C I C C C L Q G S N * I C H L R R I I MaeI | CviJI | | MnlI | | | Hpy188I | | | | MnlI | | | | |CviRI* | | | | || MwoI | | | | || | AluI | | | | || | CviJI | | | | || | | SetI | | | | || | | | Hpy178III* | | | | || | | | | Tsp4CI* BccI \ \ \ \ \\ \ \ \ \ \ \ ATTTCCTCCCTAGCCTCTGAATATGCACTAAAAGCTGTTCAAGACAGTAATCTAAAGAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGAGGGATCGGAGACTTATACGTGATTTTCGACAAGTTCTGTCATTAGATTTCTTC /// / / / / / / / / / ||| | | | | | CviJI | Tsp4CI* BccI ||| | | | | | AluI Hpy178III* ||| | | | | SetI ||| | | | MwoI ||| | | CviRI* ||| | MnlI ||| Hpy188I ||MnlI |CviJI MaeI I S S L A S E Y A L K A V Q D S N L K K F P P * P L N M H * K L F K T V I * R R F L P S L * I C T K S C S R Q * S K E D ----:----|----:----|----:----|----:----|----:----|----:----| I E E R A E S Y A S F A T * S L L R F F Y K R G L R Q I H V L L Q E L C Y D L S N G G * G R F I C * F S N L V T I * L L Hin6I |GlaI |MboII ||HhaI ||TspDTI ||| MseI ||| EcoNI CviJI ||| | BsiYI* | MboII ||| | | MnlI | | TaqI ||| | | TspEI | | AsuII Ksp632I* ||| | | | MseI \ \ \ \ \\\ \ \ \ \ ATGGAAGCCACTTCGAAAATAATCAATGAAGAGAAAATGCGCCTCTTAAAGGAATTAACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCGGTGAAGCTTTTATTAGTTACTTCTCTTTTACGCGGAGAATTTCCTTAATTGA // / / /// / // / // |MboII AsuII Ksp632I* ||| | || MnlI |MseI CviJI TaqI ||| | |MseI TspEI ||| | EcoNI ||| BsiYI* ||Hin6I |GlaI TspDTI MboII HhaI M E A T S K I I N E E K M R L L K E L T W K P L R K * S M K R K C A S * R N * L G S H F E N N Q * R E N A P L K G I N C ----:----|----:----|----:----|----:----|----:----|----:----| I S A V E F I I L S S F I R R K F S N V S P L W K S F L * H L S F A G R L P I L H F G S R F Y D I F L F H A E * L F * S MaeII XcmI | SetI BstXI | TaiI | SfaNI TspEI MseI \ \ \ \ \ \ GCTTTGGATTACGTTGATGACCAATATGTTGGTGGATTAGATGCTAATTTTCTTTTAATA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACCTAATGCAACTACTGGTTATACAACCACCTAATCTACGATTAAAAGAAAATTAT / / / / / / / | MaeII | XcmI SfaNI TspEI MseI TaiI BstXI SetI A L D Y V D D Q Y V G G L D A N F L L I L W I T L M T N M L V D * M L I F F * Y F G L R * * P I C W W I R C * F S F N T ----:----|----:----|----:----|----:----|----:----|----:----| A K S * T S S W Y T P P N S A L K R K I Q K P N R Q H G I H Q H I L H * N E K L S Q I V N I V L I N T S * I S I K K * Y MboI | DpnI | |BstKTI | || BinI* | || | MaeIII | || | Tsp45I | || | | TspGWI | || | | | Tth111I | || | | | | BarI MfeI CviJI | || | | | | HphI TsoI TspEI | BarI \ \\ \ \ \ \ \ \ \ \ \ CGGATCAACGGGGGTGACAATGTCTTGGCAAAGAAGTTATATTACCAATTGGCTACTCAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GCCTAGTTGCCCCCACTGTTACAGAACCGTTTCTTCAATATAATGGTTAACCGATGAGTT // / / / / / / / / / || MboI | | | | HphI TsoI | CviJI |DpnI | | | Tth111I | BarI BstKTI | | | BarI TspEI | | Tsp45I MfeI | | MaeIII | TspGWI BinI* R I N G G D N V L A K K L Y Y Q L A T Q G S T G V T M S W Q R S Y I T N W L L N D Q R G * Q C L G K E V I L P I G Y S I ----:----|----:----|----:----|----:----|----:----|----:----| R I L P P S L T K A F F N Y * W N A V * V S * R P H C H R P L S T I N G I P * E P D V P T V I D Q C L L * I V L Q S S L CviJI | BetI* | BspMII* | |HpaII | |Hpy178III* MaeIII | || BseGI MnlI | SetI | || | TspEI Hpy188I | | TspEI | ||MmeI | | FokI \ \ \ \ \ \\\ \ \ \ TCTGGGGTTGTCGTCAGATTTAGAGGTAACGAATTAGGCTGTTCCGGATGTTTGAGAATT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCCCAACAGCAGTCTAAATCTCCATTGCTTAATCCGACAAGGCCTACAAACTCTTAA / / / / / / // / / Hpy188I SetI | | | | || BseGI TspEI MnlI | | | | |BspMII* | | | | |BetI* | | | | Hpy178III* | | | | HpaII | | | MmeI | | CviJI | TspEI MaeIII S G V V V R F R G N E L G C S G C L R I L G L S S D L E V T N * A V P D V * E L W G C R Q I * R * R I R L F R M F E N Y ----:----|----:----|----:----|----:----|----:----|----:----| D P T T T L N L P L S N P Q E P H K L I I Q P Q R * I * L Y R I L S N R I N S F R P N D D S K S T V F * A T G S T Q S N Tsp4CI* TatI | MnlI |Csp6I | NlaIV ||RsaI | | FatI ||ScaI MaeII | | |CviAII ||| Esp3I | SetI | | || NlaIII BseRI ||| BsmAI | TaiI \ \ \\ \ \ \\\ \ \ \ ACCGTTGGAACCCATGAGGAGAACACACATTTGATAAAGTACTTCAAGGAGACGTTATAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAACCTTGGGTACTCCTCTTGTGTGTAAACTATTTCATGAAGTTCCTCTGCAATATA // // / // / /// / / / |FokI || | |FatI BseRI ||TatI | | MaeII | || | CviAII |Csp6I | TaiI | || NlaIII ScaI | SetI | |NlaIV RsaI BsmAI | MnlI Esp3I Tsp4CI* T V G T H E E N T H L I K Y F K E T L Y P L E P M R R T H I * * S T S R R R Y I R W N P * G E H T F D K V L Q G D V I * ----:----|----:----|----:----|----:----|----:----|----:----| V T P V W S S F V C K I F Y K L S V N Y * R Q F G H P S C V N S L T S * P S T I G N S G M L L V C M Q Y L V E L L R * I AluI CviJI | CfrI | SetI | Cac8I | | BalI | | CviJI | | HaeIII \ \ \ AAGCTGGCCAATGAATAA 1150 ----:----|----:--- TTCGACCGGTTACTTATT / / / / / | | | | CfrI | | | HaeIII | | | CviJI | | | BalI | | Cac8I | CviJI | AluI SetI K L A N E * S W P M N X A G Q * I X ----:----|----:--- L S A L S Y Y A P W H I L Q G I F L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 5 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 2 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BccI 1 BciVI 2 BfuI BetI* 2 BsaWI BinI* 4 AlwI,BspPI,AclWI BmeT110I 1 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseRI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 3 BstXI 1 Cac8I 2 BstC8I CauII* 4 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI CfrI 2 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 14 CviKI-1 CviRI* 6 HpyCH4V DinI 1 EgeI,EheI,SfoI DpnI 3 MalI DsaI* 1 BtgI,BstDSI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 3 FokI 1 GlaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HinfI 2 HpaII 5 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy178III* 3 Hpy188III Hpy188I 4 Hpy99I 1 KasI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 6 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 2 MunI MlyI 1 SchI MmeI 3 MnlI 8 MseI 11 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PleI 1 PpsI PsiI 2 AanI RsaI 2 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 17 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmaI 1 SnaBI 1 Eco105I,BstSNI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TatI 2 TfiI 1 PfeI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 15 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I BaeI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BclI BdaI BfiI BglI BglII BisI BlsI BmtI BplI Bpu10I BsaBI BsaXI BseMII BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cfr10I ClaI CspCI DdeI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoRV EcoT22I EspI* FalI FauI Fnu4HI FnuDII* FseI FspAI GsaI HgiAI* HgiJII* Hin4I HindII HpaI Hpy166II Hpy8I KpnI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SduI SfiI SgfI SgrAI SgrDI SmlI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TseI TspRI XbaI XhoI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769