Restriction Map of NUP159/YIL115C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

NUP159/YIL115C on chromosome IX from coordinates 148709 to 144327.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BseMII |BseGI |BspCNI ||Csp6I |||RsaI |||| BsmAI |||| | FokI |||| | |DdeI BbvII* |||| | || TspDTI | MboII Hin4II* |||| | || |TspRI Hpy188I | |MseI \ \\\\ \ \\ \\ \ \ \\ ATGTCTTCTTTGAAGGATGAAGTACCCACTGAGACTTCCGAAGACTTCGGTTTTAAGTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAAGAAACTTCCTACTTCATGGGTGACTCTGAAGGCTTCTGAAGCCAAAATTCAAA / // // // / / / / Hin4II* || || || FokI Hpy188I | MseI || || || DdeI BbvII* || || |TspDTI MboII || || BsmAI || |Csp6I || |TspRI || RsaI |BspCNI |BseGI BseMII M S S L K D E V P T E T S E D F G F K F C L L * R M K Y P L R L P K T S V L S F V F F E G * S T H * D F R R L R F * V F ----:----|----:----|----:----|----:----|----:----|----:----| X D E K F S S T G V S V E S S K P K L N X T K K S P H L V W Q S K R L S R N * T H R R Q L I F Y G S L S G F V E T K L K ApoI Hin4II* TspDTI SetI TspEI SetI | Hin4II* | CviRI* SfaNI \ \ \ \ \ \ \ \ TTAGGTCAAAAACAAATTCTACCTTCCTTCAATGAAAAACTGCCATTTGCATCTCTACAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCAGTTTTTGTTTAAGATGGAAGGAAGTTACTTTTTGACGGTAAACGTAGAGATGTT / / / / / / / SetI | SetI | Hin4II* | CviRI* TspEI Hin4II* TspDTI ApoI L G Q K Q I L P S F N E K L P F A S L Q * V K N K F Y L P S M K N C H L H L Y K R S K T N S T F L Q * K T A I C I S T K ----:----|----:----|----:----|----:----|----:----|----:----| K P * F C I R G E K L S F S G N A D R C K L D F V F E V K R * H F V A M Q M E V * T L F L N * R G E I F F Q W K C R * L TseI Hpy178III* Tsp4CI* |BisI MnlI |TaqI | BbvI ||BlsI | AciI \\ \ \ \\\ \ \ AATCTCGATATTTCAAACAGTAAGTCTTTATTCGTTGCTGCCTCTGGTAGTAAGGCGGTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGAGCTATAAAGTTTGTCATTCAGAAATAAGCAACGACGGAGACCATCATTCCGCCAC / // / / /// / / | |TaqI Tsp4CI* BbvI ||TseI MnlI AciI | Hpy178III* |BisI SfaNI BlsI N L D I S N S K S L F V A A S G S K A V I S I F Q T V S L Y S L L P L V V R R W S R Y F K Q * V F I R C C L W * * G G G ----:----|----:----|----:----|----:----|----:----|----:----| F R S I E F L L D K N T A A E P L L A T F D R Y K L C Y T K I R Q Q R Q Y Y P P I E I N * V T L R * E N S G R T T L R H MlyI MseI PleI |HpaI TspEI | SetI |HindII | BseMII | |TspGWI |Hpy166II | |BspCNI HphI | ||Hpy188I || AclI | || TspEI MboI | |||HinfI || MaeII | || |Hin4I | DpnI | |||| MnlI || | SetI | || || DdeI | |BstKTI | |||| |Hin4I || | TaiI \ \\ \\ \ \ \\ \ \\\\ \\ \\ \ \ GTCGGCGAATTACAATTACTGAGAGATCATATCACCTCCGACTCTACTCCGTTAACGTTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCGCTTAATGTTAATGACTCTCTAGTATAGTGGAGGCTGAGATGAGGCAATTGCAAG // / / // // / //// / / // // / / || TspEI | || || MboI |||| | | |MnlI || | MmeI |BspCNI | || |DpnI |||| | | HinfI || MaeII |Hin4I | || BstKTI |||| | Hin4I || AclI BseMII | |HphI |||| Hpy188I |MseI | DdeI |||TspGWI |TaiI TspEI ||PleI |SetI |MlyI Hpy166II SetI HindII HpaI V G E L Q L L R D H I T S D S T P L T F S A N Y N Y * E I I S P P T L L R * R S R R I T I T E R S Y H L R L Y S V N V Q ----:----|----:----|----:----|----:----|----:----|----:----| T P S N C N S L S * I V E S E V G N V N P R R I V I V S L D Y * R R S * E T L T D A F * L * Q S I M D G G V R S R * R E FatI |CviAII || NlaIII || | MboI || | BclI || | | DpnI || | | |BstKTI SspI || | | || SetI MmeI | TspDTI || | | || | HphI \ \ \ \\ \ \ \\ \ \ AAGTGGGAGAAAGAAATCCCAGATGTAATATTTGTGTGCTTTCATGGTGATCAGGTTTTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACCCTCTTTCTTTAGGGTCTACATTATAAACACACGAAAGTACCACTAGTCCAAAAC / / // // / / TspDTI | || || BclI HphI SspI | || || MboI | || || SetI | || |DpnI | || BstKTI | |FatI | CviAII NlaIII K W E K E I P D V I F V C F H G D Q V L S G R K K S Q M * Y L C A F M V I R F W V G E R N P R C N I C V L S W * S G F G ----:----|----:----|----:----|----:----|----:----|----:----| L H S F S I G S T I N T H K * P S * T K * T P S L F G L H L I Q T S E H H D P K L P L F F D W I Y Y K H A K M T I L N Q ApoI TspEI MaeIII CviRI* BcgI | TaqI Tsp45I BcgI | EcoT22I MnlI |TspEI | AsuII Tsp4CI* \ \ \ \ \\ \ \ \ GTTTCAACCAGAAATGCATTATATTCGTTAGACTTGGAGGAATTGAGTGAATTTCGAACG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGTTGGTCTTTACGTAATATAAGCAATCTGAACCTCCTTAACTCACTTAAAGCTTGC / / / / / / / / / BcgI | CviRI* MnlI BcgI TspEI | | Tsp4CI* EcoT22I | AsuII | TaqI TspEI ApoI V S T R N A L Y S L D L E E L S E F R T F Q P E M H Y I R * T W R N * V N F E R F N Q K C I I F V R L G G I E * I S N G ----:----|----:----|----:----|----:----|----:----|----:----| T E V L F A N Y E N S K S S N L S N R V P K L W F H M I N T L S P P I S H I E F N * G S I C * I R * V Q L F Q T F K S R AclI MaeII | MseI | SetI CviJI MfeI | TaiI |BsrI TspEI | | MboII TspEI \\ \ \ \ \ \ GTCACTTCTTTTGAGAAGCCAGTTTTCCAATTGAAGAACGTTAATAACACTTTAGTAATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGAAGAAAACTCTTCGGTCAAAAGGTTAACTTCTTGCAATTATTGTGAAATCATTAA / // / / / // / Tsp45I |CviJI | | | |MboII TspEI MaeIII BsrI | | | MseI | | MaeII | | AclI | TaiI | SetI TspEI MfeI V T S F E K P V F Q L K N V N N T L V I S L L L R S Q F S N * R T L I T L * * F H F F * E A S F P I E E R * * H F S N F ----:----|----:----|----:----|----:----|----:----|----:----| T V E K S F G T K W N F F T L L V K T I P * K K Q S A L K G I S S R * Y C K L L D S R K L L W N E L Q L V N I V S * Y N MseI |AhaIII* BsrI ||ApoI TspRI TaqI ||TspEI | MseI | DdeI \\\ \ \ \ \ TTAAATTCAGTCAATGATTTATCAGCACTGGATTTAAGAACAAAATCGACTAAGCAACTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTAAGTCAGTTACTAAATAGTCGTGACCTAAATTCTTGTTTTAGCTGATTCGTTGAC // / / / / / / / || TspEI TspRI BsrI MseI TaqI DdeI BsrI || ApoI |MseI AhaIII* L N S V N D L S A L D L R T K S T K Q L * I Q S M I Y Q H W I * E Q N R L S N W K F S Q * F I S T G F K N K I D * A T G ----:----|----:----|----:----|----:----|----:----|----:----| K F E T L S K D A S S K L V F D V L C S K L N L * H N I L V P N L F L I S * A V * I * D I I * * C Q I * S C F R S L L Q AclI MnlI MaeII MaeIII |MaeIII Tsp45I || SetI | ApoI BsrI || TaiI SetI | TspEI \ \\ \ \ \ \ GCACAAAACGTTACCTCTTTTGATGTCACAAATTCGCAGTTAGCAGTTCTACTAAAAGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTTTGCAATGGAGAAAACTACAGTGTTTAAGCGTCAATCGTCAAGATGATTTTCTA / / / / / / / | | | MaeIII MnlI | TspEI | | SetI | ApoI | MaeII Tsp45I | AclI MaeIII TaiI SetI A Q N V T S F D V T N S Q L A V L L K D H K T L P L L M S Q I R S * Q F Y * K I T K R Y L F * C H K F A V S S S T K R * ----:----|----:----|----:----|----:----|----:----|----:----| A C F T V E K S T V F E C N A T R S F S P V F R * R K Q H * L N A T L L E V L L C L V N G R K I D C I R L * C N * * F I FatI CviRI* |CviAII || NlaIII TspEI \\ \ \ AGAAGTTTTCAAAGTTTTGCATGGCGAAATGGCGAAATGGAAAAACAATTTGAGTTCTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCAAAAGTTTCAAAACGTACCGCTTTACCGCTTTACCTTTTTGTTAAACTCAAGAGA / // / | |FatI TspEI | CviAII CviRI* NlaIII R S F Q S F A W R N G E M E K Q F E F S E V F K V L H G E M A K W K N N L S S L K F S K F C M A K W R N G K T I * V L S ----:----|----:----|----:----|----:----|----:----|----:----| L L K * L K A H R F P S I S F C N S N E Y F N E F N Q M A F H R F P F V I Q T R S T K L T K C P S I A F H F F L K L E R XmnI Tsp4CI* |AluI | Hpy188I |CviJI | |TspEI || SetI | ||SapI || | BsrI | ||Ksp632I* || | | MboII SspI MboII MaeIII \ \\\ \\ \ \ \ \ \ \ CTACCGTCAGAATTAGAAGAGCTTCCAGTAGAAGAATATTCCCCTTTGAGTGTTACCATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGCAGTCTTAATCTTCTCGAAGGTCATCTTCTTATAAGGGGAAACTCACAATGGTAA / / / /// / / / / / | | | ||| | MboII SspI MboII MaeIII | | | ||| BsrI | | | ||CviJI | | | ||AluI | | | |XmnI | | | SetI | | Ksp632I* | | TspEI | | SapI | Hpy188I Tsp4CI* L P S E L E E L P V E E Y S P L S V T I Y R Q N * K S F Q * K N I P L * V L P F T V R I R R A S S R R I F P F E C Y H S ----:----|----:----|----:----|----:----|----:----|----:----| R G D S N S S S G T S S Y E G K L T V M E V T L I L L A E L L L I N G K S H * W * R * F * F L K W Y F F I G R Q T N G N BsmAI Eco31I AciI | Hpy188I TspDTI \ \ \ \ CTCTCTCCACAGGATTTTTTGGCGGTTTTCGGTAATGTTATATCAGAGACCGATGACGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAGAGGTGTCCTAAAAAACCGCCAAAAGCCATTACAATATAGTCTCTGGCTACTGCTT / / / AciI | TspDTI Hpy188I Eco31I BsmAI L S P Q D F L A V F G N V I S E T D D E S L H R I F W R F S V M L Y Q R P M T K L S T G F F G G F R * C Y I R D R * R S ----:----|----:----|----:----|----:----|----:----|----:----| R E G C S K K A T K P L T I D S V S S S E R E V P N K P P K R Y H * I L S R H R E R W L I K Q R N E T I N Y * L G I V F TseI |BisI ||BlsI TaqII TatI |||Hin6I BbvI | MboI Bsp1407I ||||GlaI |BceAI | | DpnI |Csp6I |||||HhaI ||Hpy178III* | | |BstKTI ||RsaI PsiI ||||||HaeII ||| MnlI \ \ \\ \\\ \ \\\\\\\ \\\ \ GTTTCATACGATCAAAAAATGTACATTATAAAGCACATAGACGGCAGCGCCTCATTTCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGTATGCTAGTTTTTTACATGTAATATTTCGTGTATCTGCCGTCGCGGAGTAAAGTT / // / /// / ///// // TaqII || MboI ||| PsiI ||||Hin6I |Hpy178III* |DpnI ||Bsp1407I |||GlaI |BbvI BstKTI ||TatI ||TseI BceAI |Csp6I ||HhaI MnlI RsaI |HaeII |BisI BlsI V S Y D Q K M Y I I K H I D G S A S F Q F H T I K K C T L * S T * T A A P H F K F I R S K N V H Y K A H R R Q R L I S R ----:----|----:----|----:----|----:----|----:----|----:----| T E Y S * F I Y M I F C M S P L A E N * L K M R D F F T C * L A C L R C R R M E N * V I L F H V N Y L V Y V A A G * K L TatI SetI Bsp1407I | BsiYI* SetI |Csp6I | | MnlI NlaIV ||RsaI MaeIII \ \ \ \ \\\ \ GAAACTTTTGATATTACACCTCCATTCGGGCAAATAGTAAGGTTCCCATATATGTACAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGAAAACTATAATGTGGAGGTAAGCCCGTTTATCATTCCAAGGGTATATACATGTTT / / / / / /// SetI | MnlI | NlaIV ||Bsp1407I BsiYI* SetI ||TatI |Csp6I RsaI E T F D I T P P F G Q I V R F P Y M Y K K L L I L H L H S G K * * G S H I C T K N F * Y Y T S I R A N S K V P I Y V Q S ----:----|----:----|----:----|----:----|----:----|----:----| S V K S I V G G N P C I T L N G Y I Y L L F K Q Y * V E M R A F L L T G M Y T C F S K I N C R W E P L Y Y P E W I H V F SetI MslI | CviRI* NheI |FatI MseI | | MaeII |MaeI ||CviAII |TspEI | | | SetI ||Cac8I ||| SfaNI SetI ||SfaNI | | | TaiI ||| BmtI ||| |NlaIII \ \\\ \ \ \ \ \\\ \ \\\ \\ GTTACCTTGTCTGGTTTAATTGAACCTGATGCAAACGTAAATGTGCTAGCATCATCATGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGGAACAGACCAAATTAACTTGGACTACGTTTGCATTTACACGATCGTAGTAGTACA / / / /// / / / / /// // // | MaeIII | ||SetI | | MaeII | ||NheI || |FatI SetI | |SfaNI | TaiI | |MaeI || CviAII | TspEI | SetI | Cac8I |NlaIII MseI CviRI* BmtI MslI V T L S G L I E P D A N V N V L A S S C L P C L V * L N L M Q T * M C * H H H V Y L V W F N * T * C K R K C A S I I M F ----:----|----:----|----:----|----:----|----:----|----:----| T V K D P K I S G S A F T F T S A D D H L * R T Q N L Q V Q H L R L H A L M M M N G Q R T * N F R I C V Y I H * C * * T SetI | BssKI | SecI* | EcoRII | | ScrFI | | BseBI | | | TfiI | | | HinfI MlyI HinfI | | | |Hin4II* PleI | TaqI BslFI | | | || Hpy188I \ \ \ \ \ \ \ \\ \ TCAAGTGAAGTAAGTATATGGGACTCGAAACAAGTTATTGAACCTTCCCAGGATTCTGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCACTTCATTCATATACCCTGAGCTTTGTTCAATAACTTGGAAGGGTCCTAAGACTT / // / / / / /// // SfaNI |PleI | TaqI | SetI ||| |Hpy188I MlyI HinfI BslFI ||| HinfI ||| TfiI ||Hin4II* ||EcoRII ||BssKI |SecI* BseBI ScrFI S S E V S I W D S K Q V I E P S Q D S E Q V K * V Y G T R N K L L N L P R I L N K * S K Y M G L E T S Y * T F P G F * T ----:----|----:----|----:----|----:----|----:----|----:----| E L S T L I H S E F C T I S G E W S E S N L H L L Y I P S S V L * Q V K G P N Q * T F Y T Y P V R F L N N F R G L I R F BccI Eco57I MnlI | TspRI CspCI SetI Eco57MI \ \ \ \ \ \ CGAGCAGTATTGCCCATCAGTGAGGAAACAGATAAGGACACAAATCCAATAGGTGTGGCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCGTCATAACGGGTAGTCACTCCTTTGTCTATTCCTGTGTTTAGGTTATCCACACCGT // / / / / |TspRI BccI CspCI SetI Eco57MI MnlI Eco57I R A V L P I S E E T D K D T N P I G V A E Q Y C P S V R K Q I R T Q I Q * V W Q S S I A H Q * G N R * G H K S N R C G S ----:----|----:----|----:----|----:----|----:----|----:----| R A T N G M L S S V S L S V F G I P T A V L L I A W * H P F L Y P C L D L L H P S C Y Q G D T L F C I L V C I W Y T H C HindII Hpy166II | AcyI | MaeII | |ZraI XbaI | || SetI |MaeI | || TaiI |Hpy178III* | || AatII || SetI | || |MaeIII || | BetI* | || ||CspCI || | BsiYI* | || ||Hpy99I || | |HpaII Hin4I \ \\ \\\ \\ \ \\ \ GTTGACGTCGTTACTTCAGGCACTATTCTAGAACCTTGTTCCGGTGTTGATACGATAGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTGCAGCAATGAAGTCCGTGATAAGATCTTGGAACAAGGCCACAACTATGCTATCTC ////// / /// / // / |||||CspCI MaeIII ||SetI | || Hin4I ||||MaeII |XbaI | |BetI* ||||AcyI | | HpaII |||ZraI | BsiYI* ||Hpy99I Hpy178III* |AatII MaeI |TaiI |SetI Hpy166II HindII V D V V T S G T I L E P C S G V D T I E L T S L L Q A L F * N L V P V L I R * S * R R Y F R H Y S R T L F R C * Y D R A ----:----|----:----|----:----|----:----|----:----|----:----| T S T T V E P V I R S G Q E P T S V I S L Q R R * K L C * E L V K N R H Q Y S L N V D N S * A S N * F R T G T N I R Y L MwoI |AciI |BisI Hpy166II SetI ||BlsI | BarI | AluI |||TauI | | Hin4I | CviJI TspDTI |||BsrBI | | Hin4II* | | SetI | BarI FatI \\\\ \ \ \ \ \ \ \ \ \ CGATTGCCGCTCGTTTACATATTGAATAACGAAGGTAGCTTACAGATAGTCGGGTTGTTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAACGGCGAGCAAATGTATAACTTATTGCTTCCATCGAATGTCTATCAGCCCAACAAA / //// / / / / / / / / / / | |||BsrBI | | | Hin4II* | | CviJI | BarI NlaIII | |||AciI | | Hin4I | | AluI TspDTI | ||BisI | BarI | SetI | |BlsI Hpy166II SetI | TauI MwoI R L P L V Y I L N N E G S L Q I V G L F D C R S F T Y * I T K V A Y R * S G C F I A A R L H I E * R R * L T D S R V V S ----:----|----:----|----:----|----:----|----:----|----:----| R N G S T * M N F L S P L K C I T P N N A I A A R K C I S Y R L Y S V S L R T T S Q R E N V Y Q I V F T A * L Y D P Q K BbvI |AciI ||CfrI ||BisI CviAII |||BlsI | NlaIII ||||TauI | | TseI ||||CviJI Hpy178III* FatI | | |BisI ||||HaeIII | TfiI |CviAII | | ||BlsI ||||| MwoI | HinfI || NlaIII \ \ \\\ \\\\\ \ \ \ \\ \ CATGTGGCAGCAATCAAAAGCGGCCATTATAGCATAAATCTGGAATCTTTAGAACATGAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTACACCGTCGTTAGTTTTCGCCGGTAATATCGTATTTAGACCTTAGAAATCTTGTACTC // /// //// // / / / // || ||TseI |||| |MwoI | HinfI | |FatI || |BisI |||| CfrI | TfiI | CviAII || BlsI |||HaeIII Hpy178III* NlaIII |FatI |||CviJI CviAII |||BbvI ||BisI ||AciI |BlsI TauI H V A A I K S G H Y S I N L E S L E H E M W Q Q S K A A I I A * I W N L * N M R C G S N Q K R P L * H K S G I F R T * E ----:----|----:----|----:----|----:----|----:----|----:----| * T A A I L L P W * L M F R S D K S C S E H P L L * F R G N Y C L D P I K L V H M H C C D F A A M I A Y I Q F R * F M L Hpy188I | ApoI | XmnI | TspEI BsiYI* \ \ \ AAATCTCTCTCTCCTACATCAGAAAAAATTCCTATTGCTGGACAGGAGCAGGAAGAAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGAGAGAGAGGATGTAGTCTTTTTTAAGGATAACGACCTGTCCTCGTCCTTCTTTTT / / / / | | | BsiYI* | | TspEI | | ApoI | XmnI Hpy188I K S L S P T S E K I P I A G Q E Q E E K N L S L L H Q K K F L L L D R S R K K K I S L S Y I R K N S Y C W T G A G R K K ----:----|----:----|----:----|----:----|----:----|----:----| F D R E G V D S F I G I A P C S C S S F S I E R E * M L F F E * Q Q V P A P L F F R E R R C * F F N R N S S L L L F F F Hpy188I MboII | TfiI | FalI | HinfI | FalI | | XmnI | | TfiI CviJI | | |FalI | | HinfI |TspDTI | | |FalI \ \ \ \\ \ \ \\ AAGAAAAATAATGAATCAAGTAAGGCTTTATCAGAGAATCCTTTCACATCAGCAAATACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTATTACTTAGTTCATTCCGAAATAGTCTCTTAGGAAAGTGTAGTCGTTTATGT // / // / / // |FalI HinfI |CviJI | | |XmnI |FalI TfiI TspDTI | | HinfI MboII | | TfiI | FalI | FalI Hpy188I K K N N E S S K A L S E N P F T S A N T R K I M N Q V R L Y Q R I L S H Q Q I H E K * * I K * G F I R E S F H I S K Y I ----:----|----:----|----:----|----:----|----:----|----:----| F F F L S D L L A K D S F G K V D A F V F S F Y H I L Y P K I L S D K * M L L Y L F I I F * T L S * * L I R E C * C I C CviJI |AciI |BisI ||BlsI CviJI |||TseI | SfeI* |||TauI | Cac8I |||AlwNI | | CviRI* |||NspBII* | | | PstI MseI ||||BisI | | | | MboII CviJI | BbvI |||||BlsI | | | | | BsmAI \ \ \ \\\\\\ \ \ \ \ \ \ TCAGGCTTCACTTTTCTTAAAACACAACCAGCCGCTGCCAATAGCCTGCAGTCTCAAAGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCGAAGTGAAAAGAATTTTGTGTTGGTCGGCGACGGTTATCGGACGTCAGAGTTTCA / / / /////// / / / / / / CviJI MseI BbvI ||||||TseI | | | | MboII BsmAI |||||BisI | | | SfeI* ||||BlsI | | CviRI* |||NspBII* | Cac8I |||AciI | PstI ||BisI CviJI |BlsI AlwNI CviJI TauI S G F T F L K T Q P A A A N S L Q S Q S Q A S L F L K H N Q P L P I A C S L K V R L H F S * N T T S R C Q * P A V S K F ----:----|----:----|----:----|----:----|----:----|----:----| D P K V K R L V C G A A A L L R C D * L M L S * K E * F V V L R Q W Y G A T E F * A E S K K F C L W G S G I A Q L R L T BsiYI* | MboI | | DpnI | | MnlI | | |BseGI | | |BstKTI | | || AciI | | || |BinI* | | || || Hin4I | | || || Hin4I FokI | | || || |MseI SduI | | || || ||AhaIII* SetI HgiAI* | | || || ||| TspEI \ \ \ \ \\ \\ \\\ \ TCTTCAACCTTTGGTGCTCCCTCATTTGGATCATCCGCATTTAAAATTGACTTGCCATCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTGGAAACCACGAGGGAGTAAACCTAGTAGGCGTAAATTTTAACTGAACGGTAGT / / / // / / / // / SetI HgiAI* BsiYI* || | | | |MseI TspEI SduI FokI || | | | AhaIII* || | | BinI* || | | AciI || | Hin4I || | Hin4I || MboI |DpnI BstKTI BseGI MnlI S S T F G A P S F G S S A F K I D L P S L Q P L V L P H L D H P H L K L T C H Q F N L W C S L I W I I R I * N * L A I S ----:----|----:----|----:----|----:----|----:----|----:----| E E V K P A G E N P D D A N L I S K G D N K L R Q H E R M Q I M R M * F Q S A M R * G K T S G * K S * G C K F N V Q W * BccI | BsmAI | | BsrI | | |Hin4I BinI* | | |Hin4I | MboI | | ||TatI | XhoII | | |||HgaI | |HgaI | | |||Csp6I | ||DpnI | | ||||RsaI Hpy166II | |||BstKTI | | ||||ScaI BsrI BsrI | TspRI | ||||AlwNI \ \ \\\\\ \ \ \ \ \ \\\\\ GTCTCATCTACCAGTACTGGTGTAGCGTCCAGTGAACAAGACGCAACAGATCCTGCTTCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGTAGATGGTCATGACCACATCGCAGGTCACTTGTTCTGCGTTGTCTAGGACGAAGA / / // /// / / / / // / / | | || ||| BsrI TspRI Hpy166II | || | HgaI | | || ||| HgaI BsrI | || XhoII | | || ||TatI | || MboI | | || |Csp6I | |DpnI | | || ScaI | BstKTI | | || RsaI | AlwNI | | |BsmAI BinI* | | BsrI | Hin4I | Hin4I BccI V S S T S T G V A S S E Q D A T D P A S S H L P V L V * R P V N K T Q Q I L L L L I Y Q Y W C S V Q * T R R N R S C F C ----:----|----:----|----:----|----:----|----:----|----:----| T E D V L V P T A D L S C S A V S G A E L R M * W Y Q H L T W H V L R L L D Q K D * R G T S T Y R G T F L V C C I R S R AciI | FnuDII* | | BsiYI* | | | FauI | | | |MwoI Tsp4CI* DdeI | | | |Hpy188I | AjuI EspI* | | | || AluI | HindII | CviJI | | | || CviJI | Hpy166II | |BsrI BsiYI* | | | || | SetI | | Hpy188I \ \\ \ \ \ \ \\ \ \ \ \ \ GCTAAGCCAGTATTCGGCAAACCCGCGTTCGGAGCTATTGCCAAAGAACCGTCAACATCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTCGGTCATAAGCCGTTTGGGCGCAAGCCTCGATAACGGTTTCTTGGCAGTTGTAGT // / / / / / / // / / || BsiYI* | | | | CviJI || | Hpy188I |CviJI | | | | AluI || Hpy166II EspI* | | | FauI || HindII DdeI | | | SetI |Tsp4CI* BsrI | | Hpy188I AjuI | MwoI FnuDII* BsiYI* AciI A K P V F G K P A F G A I A K E P S T S L S Q Y S A N P R S E L L P K N R Q H Q * A S I R Q T R V R S Y C Q R T V N I R ----:----|----:----|----:----|----:----|----:----|----:----| A L G T N P L G A N P A I A L S G D V D Q * A L I R C V R T R L * Q W L V T L M S L W Y E A F G R E S S N G F F R * C * AjuI BsiYI* PflMI | CviJI Cac8I BsiYI* SduI | |MnlI | CviJI | BccI HgiAI* | || Hpy178III* \ \ \ \ \ \ \\ \ GAATATGCCTTTGGCAAGCCATCTTTTGGTGCTCCCTCCTTTGGCTCTGGAAAGTCATCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATACGGAAACCGTTCGGTAGAAAACCACGAGGGAGGAAACCGAGACCTTTCAGTAGA / / / / // / / / | | | | |HgiAI* BsiYI* | Hpy178III* | | | | |SduI CviJI | | | | BccI MnlI | | | BsiYI* | | | PflMI | | AjuI | CviJI Cac8I E Y A F G K P S F G A P S F G S G K S S N M P L A S H L L V L P P L A L E S H L I C L W Q A I F W C S L L W L W K V I C ----:----|----:----|----:----|----:----|----:----|----:----| S Y A K P L G D K P A G E K P E P F D D L I H R Q C A M K Q H E R R Q S Q F T M F I G K A L W R K T S G G K A R S L * R Cac8I | BetI* | BsiYI* | BspMII* | |HpaII | |Hpy178III* | || MboI | || XhoII | || | DpnI BsiYI* | || | |BstKTI | Csp6I TfiI | || | || MnlI | |RsaI HinfI | || | || | BinI* CviJI | |MnlI BsiYI* \ \ \\ \ \\ \ \ \ \ \\ \ GTTGAATCGCCTGCCTCCGGATCTGCCTTTGGTAAGCCCTCTTTTGGTACTCCTTCCTTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTAGCGGACGGAGGCCTAGACGGAAACCATTCGGGAGAAAACCATGAGGAAGGAAA / / / /// / / / / /// / / | | | ||| | BinI* | BsiYI* ||Csp6I | TspDTI | | | ||| XhoII CviJI |RsaI BsiYI* | | | ||| MnlI MnlI | | | ||| MboI | | | ||DpnI | | | |BspMII* | | | |BstKTI | | | |BetI* | | | Hpy178III* | | | HpaII | | BsiYI* | Cac8I HinfI TfiI V E S P A S G S A F G K P S F G T P S F L N R L P P D L P L V S P L L V L L P L * I A C L R I C L W * A L F W Y S F L W ----:----|----:----|----:----|----:----|----:----|----:----| T S D G A E P D A K P L G E K P V G E K Q Q I A Q R R I Q R Q Y A R K Q Y E K R N F R R G G S R G K T L G R K T S R G K CviJI |AciI |BisI ||BlsI |||TauI |||| Cac8I |||| | BetI* |||| | BsiYI* |||| | BspMII* |||| | |HpaII |||| | |Hpy178III* |||| | || MboI CviJI |||| | || XhoII TspDTI |||| | || | DpnI Hin4II* |||| | || | |BstKTI | Hpy178III* |||| | || | || MnlI | | ApoI |||| | || | || |CviRI* | | TspEI |||| | || | || || BinI* CviJI \ \ \ \\\\ \ \\ \ \\ \\ \ \ GGCTCTGGAAATTCATCTGTTGAGCCGCCTGCCTCCGGATCTGCATTTGGTAAGCCCTCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAGACCTTTAAGTAGACAACTCGGCGGACGGAGGCCTAGACGTAAACCATTCGGGAGA // / / //// / / /// / / / / / || | TspEI |||| | | ||| | | BinI* | BsiYI* || | ApoI |||| | | ||| | CviRI* CviJI || Hpy178III* |||| | | ||| XhoII |CviJI |||| | | ||| MnlI Hin4II* |||| | | ||| MboI |||| | | ||DpnI |||| | | |BspMII* |||| | | |BstKTI |||| | | |BetI* |||| | | Hpy178III* |||| | | HpaII |||| | BsiYI* |||| Cac8I |||AciI ||BisI |BlsI CviJI TauI G S G N S S V E P P A S G S A F G K P S A L E I H L L S R L P P D L H L V S P L L W K F I C * A A C L R I C I W * A L F ----:----|----:----|----:----|----:----|----:----|----:----| P E P F E D T S G G A E P D A N P L G E Q S Q F N M Q Q A A Q R R I Q M Q Y A R A R S I * R N L R R G G S R C K T L G R DdeI EspI* | CviJI | |AciI | |BisI | ||BlsI | |||TauI | |||| Cac8I BsiYI* | |||| | BetI* | CviJI | |||| | BsiYI* | TspDTI | |||| | BspMII* | Hin4II* | |||| | |HpaII BsiYI* | | Hpy178III* | |||| | |Hpy178III* | Csp6I | | | ApoI | |||| | || MboI | |RsaI | | | TspEI | |||| | || XhoII | |MnlI | | | | BseMII | |||| | || | DpnI | ||EcoP15I | | | | |BspCNI | |||| | || | |BstKTI \ \\\ \ \ \ \ \\ \ \\\\ \ \\ \ \\ TTTGGTACTCCTTCCTTTGGCTCTGGAAATTCATCTGCTGAGCCGCCTGCTTCCGGATCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCATGAGGAAGGAAACCGAGACCTTTAAGTAGACGACTCGGCGGACGAAGGCCTAGA /// / / /// / // / ///// / / /// / ||| | | ||| | || TspEI ||||| | | ||| XhoII ||| | | ||| | || ApoI ||||| | | ||| MboI ||| | | ||| | |BspCNI ||||| | | ||DpnI ||| | | ||| | BseMII ||||| | | |BspMII* ||| | | ||| Hpy178III* ||||| | | |BstKTI ||| | | ||CviJI ||||| | | |BetI* ||| | | |Hin4II* ||||| | | Hpy178III* ||| | | TspDTI ||||| | | HpaII ||| | BsiYI* ||||| | BsiYI* ||| EcoP15I ||||| Cac8I ||Csp6I ||||AciI |RsaI |||BisI MnlI ||BlsI |CviJI |TauI EspI* DdeI F G T P S F G S G N S S A E P P A S G S L V L L P L A L E I H L L S R L L P D L W Y S F L W L W K F I C * A A C F R I C ----:----|----:----|----:----|----:----|----:----|----:----| K P V G E K P E P F E D A S G G A E P D K Q Y E K R Q S Q F N M Q Q A A Q K R I K T S R G K A R S I * R S L R R S G S R BsmI CviRI* BsiYI* | Hpy188I | Csp6I | | CviRI* | |RsaI | | | MaeIII BinI* CviJI | |MnlI | | | | SfaNI \ \ \ \\ \ \ \ \ \ GCCTTTGGTAAGCCCTCTTTTGGTACATCTGCATTCGGAACTGCATCAAGTAACGAAACT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAACCATTCGGGAGAAAACCATGTAGACGTAAGCCTTGACGTAGTTCATTGCTTTGA / / / /// / / / / / / BinI* | BsiYI* ||| | | | CviRI* | SfaNI CviJI ||| | | Hpy188I MaeIII ||| | CviRI* ||| BsmI ||Csp6I |RsaI MnlI A F G K P S F G T S A F G T A S S N E T P L V S P L L V H L H S E L H Q V T K L L W * A L F W Y I C I R N C I K * R N * ----:----|----:----|----:----|----:----|----:----|----:----| A K P L G E K P V D A N P V A D L L S V Q R Q Y A R K Q Y M Q M R F Q M L Y R F G K T L G R K T C R C E S S C * T V F S BinI* | Hpy178III* | | MboI | | BamHI | | XhoII TseI | | | DpnI CviJI | | | NlaIV |BisI | | | |BstKTI |TspDTI | | | || BbvI ||BlsI CviRI* | | | || | BinI* |||CviRI* | AciI FauI \ \ \ \\ \ \ \\\\ \ \ \ AACTCTGGATCCATATTTGGAAAGGCTGCATTTGGTTCATCATCTTTTGCACCCGCCAAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGACCTAGGTATAAACCTTTCCGACGTAAACCAAGTAGTAGAAAACGTGGGCGGTTG / /// / / ///// / / | ||| | BinI* ||||CviRI* | AciI | ||| | BbvI ||||TseI CviRI* | ||| XhoII |||BisI | ||| BamHI ||BlsI | ||| MboI |CviJI | ||NlaIV TspDTI | ||DpnI | |BstKTI | Hpy178III* BinI* N S G S I F G K A A F G S S S F A P A N T L D P Y L E R L H L V H H L L H P P T L W I H I W K G C I W F I I F C T R Q Q ----:----|----:----|----:----|----:----|----:----|----:----| L E P D M N P F A A N P E D D K A G A L * S Q I W I Q F P Q M Q N M M K Q V R W V R S G Y K S L S C K T * * R K C G G V SfeI* |SetI || Tsp4CI* || | HindII MboI || | Hpy166II Hpy188I || | | CviJI | DpnI || | | |MnlI | |BstKTI || | | || Hin4I | ||TspDTI || | | || Hin4I | ||| BinI* || | | || | BsiYI* \ \\\ \ \\ \ \ \\ \ \ AATGAACTTTTCGGATCAAACTTTACTATTTCAAAACCTACAGTTGACAGCCCAAAGGAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTGAAAAGCCTAGTTTGAAATGATAAAGTTTTGGATGTCAACTGTCGGGTTTCCTC / / // / / / // / / / / FauI | || MboI BinI* SetI || | | | SetI | |TspDTI || | | BsiYI* | |DpnI || | CviJI | BstKTI || | Hin4I Hpy188I || | Hin4I || | MnlI || Hpy166II || HindII |SfeI* Tsp4CI* N E L F G S N F T I S K P T V D S P K E M N F S D Q T L L F Q N L Q L T A Q R R * T F R I K L Y Y F K T Y S * Q P K G G ----:----|----:----|----:----|----:----|----:----|----:----| L S S K P D F K V I E F G V T S L G F S C H V K R I L S * * K L V * L Q C G L P I F K E S * V K S N * F R C N V A W L L Hin4I MaeII Hin4I |MaeIII |PflMI HinfI |Tsp45I |BsiYI* | Hin4I SetI || SetI || BccI | |DdeI | TfiI || TaiI || | MboI | || MboII | HinfI || | MboII || | | DpnI | || | PleI | |HphI || | |SetI || | | |BstKTI | || | |MlyI \ \\ \\ \ \\ \\ \ \ \\ \ \\ \ \\ GTAGATTCAACGTCACCTTTCCCATCTTCTGGCGATCAAAGTGAAGATGAGTCTAAGAGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTAAGTTGCAGTGGAAAGGGTAGAAGACCGCTAGTTTCACTTCTACTCAGATTCTCA / / / / / / / / / // / / / / / / | | | | | | | | | || MboI | | | | PleI | | | | | | | | | |DpnI | | | | MlyI | | | | | | | | | BstKTI | | | DdeI | | | | | | | | BccI | | MboII | | | | | | | BsiYI* | HinfI | | | | | | | PflMI Hin4I | | | | | | Hin4I | | | | | | Hin4I | | | | | Tsp45I | | | | | MaeIII | | | | | MboII | | | | SetI | | | MaeII | | TaiI | | SetI | HinfI | TfiI HphI V D S T S P F P S S G D Q S E D E S K S * I Q R H L S H L L A I K V K M S L R V R F N V T F P I F W R S K * R * V * E * ----:----|----:----|----:----|----:----|----:----|----:----| T S E V D G K G D E P S * L S S S D L L P L N L T V K G M K Q R D F H L H T * S Y I * R * R E W R R A I L T F I L R L T MlyI PleI |MboII || AccI SetI || MboII Hin4I || |Hpy166II Ksp632I* | Csp6I || ||HinfI |TaqI | |RsaI SetI SetI MnlI \\ \\\ \\ \ \\ \ \ \ GATGTAGACTCTTCTTCGACACCTTTTGGTACGAAACCTAACACCTCTACGAAACCAAAG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTACATCTGAGAAGAAGCTGTGGAAAACCATGCTTTGGATTGTGGAGATGCTTTGGTTTC // / // / /// // / / / || | || HinfI ||SetI || SetI SetI MnlI || | |AccI |Hin4I |Csp6I || | Hpy166II Ksp632I* RsaI || MboII TaqI |PleI MboII MlyI D V D S S S T P F G T K P N T S T K P K M * T L L R H L L V R N L T P L R N Q R C R L F F D T F W Y E T * H L Y E T K D ----:----|----:----|----:----|----:----|----:----|----:----| S T S E E E V G K P V F G L V E V F G F H H L S K K S V K Q Y S V * C R * S V L I Y V R R R C R K T R F R V G R R F W L MboI XhoII | DpnI CviJI | |BstKTI | Hpy178III* | ||Hpy178III* | | TfiI MboII | ||| BinI* | | HinfI \ \ \\\ \ \ \ \ ACCAATGCCTTTGATTTTGGGAGTTCTTCCTTTGGATCTGGATTTTCAAAGGCTCTGGAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTACGGAAACTAAAACCCTCAAGAAGGAAACCTAGACCTAAAAGTTTCCGAGACCTT / // / / / / / MboII || | | BinI* | Hpy178III* || | Hpy178III* CviJI || XhoII || MboI |DpnI BstKTI T N A F D F G S S S F G S G F S K A L E P M P L I L G V L P L D L D F Q R L W N Q C L * F W E F F L W I W I F K G S G I ----:----|----:----|----:----|----:----|----:----|----:----| V L A K S K P L E E K P D P N E F A R S S W H R Q N Q S N K R Q I Q I K L P E P G I G K I K P T R G K S R S K * L S Q F MseI CviJI |BarI Csp6I | MboII |AhaIII* |RsaI | | SetI BarI NlaIV ||ApoI || HphI | | BspCNI |Ksp632I* | Hpy188I ||TspEI || DdeI | | |BseMII || Tsp4CI* \ \ \\\ \\ \ \ \ \\ \\ \ TCTGTTGGTTCCGATACAACTTTTAAATTCGGTACTCAGGCTTCACCTTTCTCTTCACAG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAACCAAGGCTATGTTGAAAATTTAAGCCATGAGTCCGAAGTGGAAAGAGAAGTGTC / / / / // / // / / // // / / / HinfI | Hpy188I BarI || | || | | || || BarI | Ksp632I* TfiI NlaIV || | || | | || |BseMII Tsp4CI* || | || | | || BspCNI || | || | | |SetI || | || | | MboII || | || | CviJI || | || DdeI || | |Csp6I || | |HphI || | RsaI || TspEI || ApoI |MseI AhaIII* S V G S D T T F K F G T Q A S P F S S Q L L V P I Q L L N S V L R L H L S L H S C W F R Y N F * I R Y S G F T F L F T V ----:----|----:----|----:----|----:----|----:----|----:----| D T P E S V V K L N P V * A E G K E E C I Q Q N R Y L K * I R Y E P K V K R K V R N T G I C S K F E T S L S * R E R * L MboI XhoII | DpnI | |BstKTI | || MseI HphI Hin4II* | || | BinI* \ \ \ \\ \ \ TTAGGAAACAAATCACCATTCAGTTCCTTCACAAAAGATGATACTGAAAATGGATCTTTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCTTTGTTTAGTGGTAAGTCAAGGAAGTGTTTTCTACTATGACTTTTACCTAGAAAT / / // / / HphI Hin4II* || | MseI || XhoII || MboI |DpnI BstKTI L G N K S P F S S F T K D D T E N G S L * E T N H H S V P S Q K M I L K M D L * R K Q I T I Q F L H K R * Y * K W I F K ----:----|----:----|----:----|----:----|----:----|----:----| N P F L D G N L E K V F S S V S F P D K T L F C I V M * N R * L L H Y Q F H I K * S V F * W E T G E C F I I S F I S R * MboII |TspDTI || AsuI* CviJI || AvaII | SduI || |BmgT120I | HgiJII* || ||NlaIV | | BsrI TspRI BslFI || ||BsrDI \ \ \ \ \ \\ \\\ AGTAAGGGCTCTACCAGTGAAATCAATGACGATAATGAAGAACACGAAAGCAATGGTCCC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTCCCGAGATGGTCACTTTAGTTACTGCTATTACTTCTTGTGCTTTCGTTACCAGGG / / / / / / / // | | | TspRI | TspDTI | |AvaII | | | BsrI | MboII | |AsuI* | | CviJI BslFI | BmgT120I | HgiJII* | NlaIV | SduI BsrDI BinI* S K G S T S E I N D D N E E H E S N G P V R A L P V K S M T I M K N T K A M V P * G L Y Q * N Q * R * * R T R K Q W S Q ----:----|----:----|----:----|----:----|----:----|----:----| L L P E V L S I L S S L S S C S L L P G L Y P S * W H F * H R Y H L V R F C H D T L A R G T F D I V I I F F V F A I T G TfiI MaeII HinfI | SetI | Hin4I | TaiI | | Tsp4CI* BetI* | | AciI | | | MboII MaeI Hin4I \ \ \ \ \ \ \ \ \ AACGTAAGCGGTAATGATTTGACAGATTCTACGGTTGAGCAAACATCTTCTACTAGATTA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCATTCGCCATTACTAAACTGTCTAAGATGCCAACTCGTTTGTAGAAGATGATCTAAT / / / / / / / / | MaeII AciI | | | MboII Hin4I TaiI | | Tsp4CI* MaeI SetI | HinfI | TfiI Hin4I N V S G N D L T D S T V E Q T S S T R L T * A V M I * Q I L R L S K H L L L D Y R K R * * F D R F Y G * A N I F Y * I T ----:----|----:----|----:----|----:----|----:----|----:----| L T L P L S K V S E V T S C V D E V L N W R L R Y H N S L N * P Q A F M K * * I V Y A T I I Q C I R R N L L C R R S S * FokI | MnlI | |MboII SecI* | ||TspDTI Hin6I | Hpy188I | |||MnlI |GlaI | | MnlI | |||| TaqI ||HhaI HpaII | |BccI BseGI | |||| | HphI ||| BseRI \ \ \\ \ \ \\\\ \ \ \\\ \ CCGGAAACTCCCTCGGATGAAGATGGTGAAGTTGTCGAGGAGGAAGCGCAAAAATCCCCC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTTTGAGGGAGCCTACTTCTACCACTTCAACAGCTCCTCCTTCGCGTTTTTAGGGGG // // / // // / // /// / |BetI* || | |MnlI || | |TaqI ||| BseRI HpaII || | BseGI || | HphI ||Hin6I || BccI || FokI |GlaI |SecI* || MnlI HhaI Hpy188I |TspDTI |MboII MnlI P E T P S D E D G E V V E E E A Q K S P R K L P R M K M V K L S R R K R K N P P G N S L G * R W * S C R G G S A K I P H ----:----|----:----|----:----|----:----|----:----|----:----| G S V G E S S S P S T T S S S A C F D G V P F E R P H L H H L Q R P P L A F I G R F S G R I F I T F N D L L F R L F G G SspI | XcmI Cac8I | | FatI | AluI | | |CviAII | CviJI | | || NlaIII MseI | | SetI | | || |CviJI |AhaIII* \ \ \ \ \ \\ \\ \\ ATAGGCAAGCTAACTGAAACTATAAAAAAAAGTGCCAATATTGACATGGCTGGTTTAAAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TATCCGTTCGATTGACTTTGATATTTTTTTTCACGGTTATAACTGTACCGACCAAATTTT / / / / / /// // | CviJI | | | ||CviJI |MseI | AluI | | | |FatI AhaIII* Cac8I | | | CviAII SetI | | NlaIII | XcmI SspI I G K L T E T I K K S A N I D M A G L K * A S * L K L * K K V P I L T W L V * K R Q A N * N Y K K K C Q Y * H G W F K K ----:----|----:----|----:----|----:----|----:----|----:----| M P L S V S V I F F L A L I S M A P K F W L C A L Q F * L F F H W Y Q C P Q N L Y A L * S F S Y F F T G I N V H S T * F FatI |CviAII Hpy188I || NlaIII |TfiI BsiYI* || | BceAI |HinfI CviRI* \ \\ \ \ \\ \ AATCCTGTATTTGGAAATCATGTCAAAGCAAAATCCGAATCGCCGTTTTCAGCATTTGCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGACATAAACCTTTAGTACAGTTTCGTTTTAGGCTTAGCGGCAAAAGTCGTAAACGT / / // / / / / BsiYI* | |FatI BceAI | HinfI CviRI* | CviAII | TfiI NlaIII Hpy188I N P V F G N H V K A K S E S P F S A F A I L Y L E I M S K Q N P N R R F Q H L Q S C I W K S C Q S K I R I A V F S I C N ----:----|----:----|----:----|----:----|----:----|----:----| F G T N P F * T L A F D S D G N E A N A F D Q I Q F D H * L L I R I A T K L M Q I R Y K S I M D F C F G F R R K * C K C AluI CviJI AarI SspI | SetI SetI BspMI MaeIII \ \ \ \ \ \ ACAAATATTACCAAACCAAGCTCTACAACACCTGCTTTTTCGTTTGGTAACTCCACAATG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTATAATGGTTTGGTTCGAGATGTTGTGGACGAAAAAGCAAACCATTGAGGTGTTAC / / / / / / SspI | CviJI SetI BspMI MaeIII | AluI AarI SetI T N I T K P S S T T P A F S F G N S T M Q I L P N Q A L Q H L L F R L V T P Q * K Y Y Q T K L Y N T C F F V W * L H N E ----:----|----:----|----:----|----:----|----:----|----:----| V F I V L G L E V V G A K E N P L E V I L L Y * W V L S * L V Q K K T Q Y S W L C I N G F W A R C C R S K R K T V G C H AluI TspDTI CviJI | HphI | SetI SpeI | | Tsp4CI* | | MboII |MaeI \ \ \ \ \ \ \\ AATAAAAGTAATACATCTACGGTTTCACCAATGGAAGAAGCTGATACTAAAGAAACTAGT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTCATTATGTAGATGCCAAAGTGGTTACCTTCTTCGACTATGATTTCTTTGATCA / / / / / / // | | Tsp4CI* | | MboII |SpeI | HphI | CviJI MaeI TspDTI | AluI SetI N K S N T S T V S P M E E A D T K E T S I K V I H L R F H Q W K K L I L K K L V * K * Y I Y G F T N G R S * Y * R N * * ----:----|----:----|----:----|----:----|----:----|----:----| F L L L V D V T E G I S S A S V L S V L S Y F Y Y M * P K V L P L L Q Y * L F * I F T I C R R N * W H F F S I S F F S T AsuI* DraII Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I |||NlaIV ||||ApaI ||||SduI ||||BseSI ||||HgiJII* ||||| Ksp632I* ||||| | SetI TfiI ||||| | | BsaXI HinfI ||||| | | | TspGWI MboII BsaXI \\\\\ \ \ \ \ \ \ GAAAAGGGCCCCATAACCTTGAAGAGTGTGGAGAATCCGTTTCTACCAGCGAAAGAAGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCCCGGGGTATTGGAACTTCTCACACCTCTTAGGCAAAGATGGTCGCTTTCTTCTT / /// / / / / / / | ||| | | TspGWI | HinfI BsaXI | ||| | Ksp632I* | TfiI | ||| | BsaXI MboII | ||| SetI | ||Bsp120I | ||DraII | ||AsuI* | |BmgT120I | |DraII | |AsuI* | |NlaIV | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI E K G P I T L K S V E N P F L P A K E E K R A P * P * R V W R I R F Y Q R K K K K G P H N L E E C G E S V S T S E R R K ----:----|----:----|----:----|----:----|----:----|----:----| S F P G M V K F L T S F G N R G A F S S H F P G W L R S S H P S D T E V L S L L F L A G Y G Q L T H L I R K * W R F F F MboI | DpnI | GsuI | Eco57MI | |BstKTI MboII | || MslI TsoI PflMI | BsrI | || BinI* | BccI BsiYI* Hpy178III* \ \ \ \\ \ \ \ \ \ AGAACTGGAGAAAGTTCTAAAAAGGATCATAACGATGACCCAAAAGATGGTTATGTATCA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGACCTCTTTCAAGATTTTTCCTAGTATTGCTACTGGGTTTTCTACCAATACATAGT // /// / // / / / |BsrI ||| | || TsoI | BsiYI* MboII ||| | |BinI* | PflMI ||| | MslI BccI ||| MboI ||DpnI |BstKTI Eco57MI GsuI R T G E S S K K D H N D D P K D G Y V S E L E K V L K R I I T M T Q K M V M Y Q N W R K F * K G S * R * P K R W L C I R ----:----|----:----|----:----|----:----|----:----|----:----| L V P S L E L F S * L S S G F S P * T D F F Q L F N * F P D Y R H G L L H N H I S S S F T R F L I M V I V W F I T I Y * ApoI XmnI Hpy188I TspEI \ \ GGAAGTGAAATATCTGTAAGGACTTCTGAAAGTGCTTTTGATACCACAGCAAACGAAGAA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCACTTTATAGACATTCCTGAAGACTTTCACGAAAACTATGGTGTCGTTTGCTTCTT / / / Hpy178III* Hpy188I XmnI G S E I S V R T S E S A F D T T A N E E E V K Y L * G L L K V L L I P Q Q T K K K * N I C K D F * K C F * Y H S K R R N ----:----|----:----|----:----|----:----|----:----|----:----| P L S I D T L V E S L A K S V V A F S S L F H F I Q L S K Q F H K Q Y W L L R L S T F Y R Y P S R F T S K I G C C V F F MaeII |BtrI || SetI || TaiI || |Hpy166II || || FatI || || BspHI MboII || || |CviAII |MaeIII || || |Hpy178III* |Tsp45I || || || NlaIII TspDTI \\ \\ \\ \\ \ \ ATTCCAAAGTCACAGGACGTGAACAATCATGAAAAAAGCGAAACAGACCCAAAATATAGT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGTTTCAGTGTCCTGCACTTGTTAGTACTTTTTTCGCTTTGTCTGGGTTTTATATCA / / / / // / / // / | MboII | | || | | |BspHI TspDTI TspEI | | || | | |FatI ApoI | | || | | Hpy178III* | | || | | CviAII | | || | NlaIII | | || Hpy166II | | |MaeII | | BtrI | TaiI | SetI Tsp45I MaeIII I P K S Q D V N N H E K S E T D P K Y S F Q S H R T * T I M K K A K Q T Q N I V S K V T G R E Q S * K K R N R P K I * S ----:----|----:----|----:----|----:----|----:----|----:----| I G F D C S T F L * S F L S V S G F Y L F E L T V P R S C D H F F R F L G L I Y N W L * L V H V I M F F A F C V W F I T HindII Hpy166II | FatI | |CviAII | || NspI | || NlaIII | || | Hin4I | || | Hin4I | || | | MboI | || | | BclI TaqI | || | | | DpnI AsuII | || | | | |BstKTI Hin4I | TspDTI | || | | | ||Hpy178III* Hin4I | | TspDTI \ \\ \ \ \ \\\ \ \ \ \ CAACATGCTGTGGTTGATCACGATAACAAGTCTAAAGAAATGAATGAAACTTCGAAGAAT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTACGACACCAACTAGTGCTATTGTTCAGATTTCTTTACTTACTTTGAAGCTTCTTA / / /// // / / / // / | | ||Hin4I || | Hpy178III* Hin4I || TspDTI | | ||Hin4I || BclI Hin4I |AsuII | | |FatI || MboI |TaqI | | CviAII |DpnI TspDTI | NlaIII BstKTI | NspI Hpy166II HindII Q H A V V D H D N K S K E M N E T S K N N M L W L I T I T S L K K * M K L R R I T C C G * S R * Q V * R N E * N F E E * ----:----|----:----|----:----|----:----|----:----|----:----| * C A T T S * S L L D L S I F S V E F F D V H Q P Q D R Y C T * L F S H F K S S L M S H N I V I V L R F F H I F S R L I MboII | AciI | BsrBI | | HindII | | Hpy166II | | | FatI | | | |PflMI | | | |CviAII | | | |BsiYI* | | | || NlaIII | | | || | StyI | | | || | SecI* | | |TspDTI || | |BccI BstXI \ \ \\ \\ \ \\ \ AATGAAAGGAGCGGTCAACCAAATCATGGTGTCCAAGGAGATGGAATAGCATTGAAAAAA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTCCTCGCCAGTTGGTTTAGTACCACAGGTTCCTCTACCTTATCGTAACTTTTTT / / / // / / // /// MboII | | || | | |FatI ||SecI* | | || | | CviAII ||StyI | | || | NlaIII |BstXI | | || BsiYI* BccI | | || PflMI | | |Hpy166II | | |HindII | | TspDTI | AciI BsrBI N E R S G Q P N H G V Q G D G I A L K K M K G A V N Q I M V S K E M E * H * K K * K E R S T K S W C P R R W N S I E K R ----:----|----:----|----:----|----:----|----:----|----:----| L S L L P * G F * P T W P S P I A N F F Y H F S R D V L D H H G L L H F L M S F I F P A T L W I M T D L S I S Y C Q F F Hin4I Hin4I TspEI | TaqI ApoI | AsuII TspEI | Eco57I | TspDTI | Eco57MI | | TfiI | | MboII | | HinfI | | | BbvII* \ \ \ \ \ \ \ GACAATGAAAAAGAGAATTTTGATTCAAATATGGCAATAAAGCAATTCGAAGACCACCAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTACTTTTTCTCTTAAAACTAAGTTTATACCGTTATTTCGTTAAGCTTCTGGTGGTT // / / / / / / / |TspEI HinfI Hin4I | | | MboII BbvII* |ApoI TfiI Hin4I | | AsuII MboII TspDTI | | TaqI | TspEI Eco57MI Eco57I D N E K E N F D S N M A I K Q F E D H Q T M K K R I L I Q I W Q * S N S K T T N Q * K R E F * F K Y G N K A I R R P P I ----:----|----:----|----:----|----:----|----:----|----:----| S L S F S F K S E F I A I F C N S S W W L C H F L S N Q N L Y P L L A I R L G G V I F F L I K I * I H C Y L L E F V V L Hin4I Hin4I TfiI MboII |FnuDII* Hin4I |Ksp632I* || Cac8I Tsp4CI* BtsI Hin4I ||MnlI || |MboII | AccI TspRI HinfI ||| Hpy188I || || HgaI | |Hpy166II | MseI | Hpy188I \\\ \ \\ \\ \ \ \\ \ \ \ \ TCTTCAGAAGAGGACGCGAGCGAAAAAGACAGTAGACAAAGCAGTGAAGTTAAAGAATCA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTCTTCTCCTGCGCTCGCTTTTTCTGTCATCTGTTTCGTCACTTCAATTTCTTAGT / / / / / / / // / / / / // | | Hin4I | MboII | | || TspRI | | MseI |Hpy188I | | Hin4I | Cac8I | | |AccI | Hin4I HinfI | Ksp632I* FnuDII* | | Hpy166II | Hin4I TfiI | Hpy188I | Tsp4CI* BtsI MnlI HgaI S S E E D A S E K D S R Q S S E V K E S L Q K R T R A K K T V D K A V K L K N Q F R R G R E R K R Q * T K Q * S * R I R ----:----|----:----|----:----|----:----|----:----|----:----| D E S S S A L S F S L L C L L S T L S D I K L L P R S R F L C Y V F C H L * L I R * F L V R A F F V T S L A T F N F F * MaeIII Tsp45I FatI Tsp4CI* AflIII | BssKI BspLU11I* | |HpaII |CviAII | |TspRI FokI || MaeIII | |Hin4I |DdeI || Tsp45I | |Hin4I BseMII ||Hpy188I || |NspI | ||ScrFI |BseGI |||HinfI PleI || |NlaIII | ||CauII* |BspCNI ||||TspDTI |MlyI \\ \\ \ \\\ \\ \\\\\ \\ GATGATAACATGTCACTCAACAGTGACCGGGATGAAAGTATATCTGAGTCCTACGATAAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATTGTACAGTGAGTTGTCACTGGCCCTACTTTCATATAGACTCAGGATGCTATTT / // / / // / / / // // / / / | || | | || | | | |BspCNI || | HinfI PleI | || | | || | | | |BseGI || FokI MlyI | || | | || | | | BseMII || DdeI | || | | || | | BssKI |TspDTI | || | | || | CauII* Hpy188I | || | | || | HpaII | || | | || | ScrFI | || | | || Tsp45I | || | | || MaeIII | || | | |Hin4I | || | | |Hin4I | || | | Tsp4CI* | || | TspRI | || Tsp45I | || MaeIII | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI D D N M S L N S D R D E S I S E S Y D K M I T C H S T V T G M K V Y L S P T I N * * H V T Q Q * P G * K Y I * V L R * T ----:----|----:----|----:----|----:----|----:----|----:----| S S L M D S L L S R S S L I D S D * S L L H Y C T V * C H G P H F Y I Q T R R Y I I V H * E V T V P I F T Y R L G V I F AluI CviJI | SetI | | FatI | | SetI | | |CviAII | | || NlaIII | | || BsiYI* | | || | MnlI | | || | | HindIII | | || | | | AluI | | || | | | CviJI | | || | | | |BdaI | | || | | | |BdaI | | || | | | ||SetI | | || | | | ||| MseI | | || | | | ||| |AhaIII* | | || | | | ||| || MaeII BdaI | | || | | | ||| || |PmaCI BdaI | | || | | | ||| || |BsaAI |MseI | | || | | | ||| || || SetI BsrI |VspI MboII | | || | | | ||| ||MwoI || TaiI \ \\ \ \ \ \\ \ \ \ \\\ \\\ \\ \ CTGGAAGATATTAATACTGATGAGCTACCTCATGGTGGAGAAGCTTTTAAAGCACGTGAA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTTCTATAATTATGACTACTCGATGGAGTACCACCTCTTCGAAAATTTCGTGCACTT / / / / / / / // // / /// // // / // BsrI BdaI | MboII | | | || || | ||| || || | |MaeII BdaI VspI | | | || || | ||| || || | BsaAI MseI | | | || || | ||| || || | PmaCI | | | || || | ||| || || TaiI | | | || || | ||| || || SetI | | | || || | ||| || |MseI | | | || || | ||| || AhaIII* | | | || || | ||| |MwoI | | | || || | ||| HindIII | | | || || | ||CviJI | | | || || | ||AluI | | | || || | |BdaI | | | || || | |BdaI | | | || || | SetI | | | || || MnlI | | | || |FatI | | | || CviAII | | | |BsiYI* | | | NlaIII | | SetI | CviJI | AluI SetI L E D I N T D E L P H G G E A F K A R E W K I L I L M S Y L M V E K L L K H V K G R Y * Y * * A T S W W R S F * S T * S ----:----|----:----|----:----|----:----|----:----|----:----| S S S I L V S S S G * P P S A K L A R S V P L Y * Y Q H A V E H H L L K * L V H Q F I N I S I L * R M T S F S K F C T F Hin6I |GlaI |Eco47III TspDTI TspEI ||HhaI |TatI | BbvII* |||HaeII |Bsp1407I | | MboII |||| AciI ||Csp6I | | | TfiI |||| | NspBII* |||RsaI | | | HinfI \\\\ \ \ \\\\ \ \ \ \ GTGAGCGCTTCCGCTGATTTTGATGTACAAACTTCATTAGAAGACAATTATGCTGAATCT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCGCGAAGGCGACTAAAACTACATGTTTGAAGTAATCTTCTGTTAATACGACTTAGA //// / / /// / / / |||Hin6I NspBII* | ||Bsp1407I | BbvII* HinfI ||| AciI | ||TatI | MboII TfiI ||Eco47III | |Csp6I TspEI ||GlaI | RsaI |HhaI TspDTI HaeII V S A S A D F D V Q T S L E D N Y A E S * A L P L I L M Y K L H * K T I M L N L E R F R * F * C T N F I R R Q L C * I W ----:----|----:----|----:----|----:----|----:----|----:----| T L A E A S K S T C V E N S S L * A S D L S R K R Q N Q H V F K M L L C N H Q I H A S G S I K I Y L S * * F V I I S F R SetI StyI TspDTI | Hpy188I SecI* SfaNI | BseGI \ \ \ \ \ \ GGCATACAGACAGACCTTTCAGAAAGTTCCAAGGAAAATGAAGTTCAAACGGATGCCATA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTATGTCTGTCTGGAAAGTCTTTCAAGGTTCCTTTTACTTCAAGTTTGCCTACGGTAT / / / / / / SetI Hpy188I SecI* | | BseGI StyI | TspDTI SfaNI G I Q T D L S E S S K E N E V Q T D A I A Y R Q T F Q K V P R K M K F K R M P Y H T D R P F R K F Q G K * S S N G C H T ----:----|----:----|----:----|----:----|----:----|----:----| P M C V S R E S L E L S F S T * V S A M Q C V S L G K L F N W P F H L E F P H W A Y L C V K * F T G L F I F N L R I G Y SalI TatI |TaqI Tsp4CI* |AccI |Csp6I ||HindII ||RsaI ||Hpy166II |||Hpy166II ||| PshAI MslI |||| Hin4II* ||| | BseMII | FokI |||| Tsp4CI* ||| | |BspCNI | TspGWI |||| | MseI ||| | || CviRI* \ \ \\\\ \ \ \\\ \ \\ \ CCCGTGAAACACAACAGTACACAAACTGTTAAGAAGGAAGCAGTCGACAATGGTCTGCAA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCACTTTGTGTTGTCATGTGTTTGACAATTCTTCCTTCGTCAGCTGTTACCAGACGTT // / / /// / / /// /// / / || FokI | ||TatI | MseI ||| ||| | MwoI |TspGWI | || Tsp4CI* ||| ||| CviRI* MslI | || Hin4II* ||| ||BspCNI | |Hpy166II ||| |BseMII | |Csp6I ||| PshAI | RsaI ||SalI Tsp4CI* |AccI |TaqI Hpy166II HindII P V K H N S T Q T V K K E A V D N G L Q P * N T T V H K L L R R K Q S T M V C K R E T Q Q Y T N C * E G S S R Q W S A N ----:----|----:----|----:----|----:----|----:----|----:----| G T F C L L V C V T L F S A T S L P R C V R S V C C Y V F Q * S P L L R C H D A G H F V V T C L S N L L F C D V I T Q L FatI AflIII BspLU11I* |CviAII AlfI DdeI || NspI MaeIII AlfI |MwoI || NlaIII Tsp45I |TspEI || CviJI || |TspEI Hin4II* | SetI || HphI \\ \ \\ \\ \ \ \ \\ \ ACTGAGCCTGTTGAAACATGTAATTTTTCTGTTCAAACATTTGAAGGTGACGAAAATTAT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCGGACAACTTTGTACATTAAAAAGACAAGTTTGTAAACTTCCACTGCTTTTAATA // / // / / / / // |CviJI | || TspEI Hin4II* SetI | |TspEI DdeI | |BspLU11I* | HphI | |AflIII Tsp45I | |FatI MaeIII | CviAII AlfI NlaIII AlfI NspI T E P V E T C N F S V Q T F E G D E N Y L S L L K H V I F L F K H L K V T K I I * A C * N M * F F C S N I * R * R K L F ----:----|----:----|----:----|----:----|----:----|----:----| V S G T S V H L K E T * V N S P S S F * F Q A Q Q F M Y N K Q E F M Q L H R F N S L R N F C T I K R N L C K F T V F I I MfeI TspEI CviRI* | AlfI | BsrDI | AlfI SspI CviRI* \ \ \ \ \ \ TTAGCAGAGCAATGCAAACCAAAGCAATTGAAAGAATATTACACAAGTGCAAAAGTATCA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGTCTCGTTACGTTTGGTTTCGTTAACTTTCTTATAATGTGTTCACGTTTTCATAGT / / / / / CviRI* | TspEI SspI CviRI* BsrDI | MfeI AlfI AlfI L A E Q C K P K Q L K E Y Y T S A K V S * Q S N A N Q S N * K N I T Q V Q K Y Q S R A M Q T K A I E R I L H K C K S I K ----:----|----:----|----:----|----:----|----:----|----:----| K A S C H L G F C N F S Y * V L A F T D N L L A I C V L A I S L I N C L H L L I * C L L A F W L L Q F F I V C T C F Y * MaeII Hpy188I | MseI TatI | BseMII ApoI | SetI |Csp6I | |BspCNI SspI TspEI | TaiI SetI ||RsaI | |Tsp4CI* \ \ \ \ \ \\\ \ \\ AATATTCCTTTCGTTTCACAAAATTCTACGTTAAGGTTGATTGAGAGTACATTTCAGACG 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAGGAAAGCAAAGTGTTTTAAGATGCAATTCCAACTAACTCTCATGTAAAGTCTGC / / / / / /// / //// SspI | | | MseI ||TatI | |||McrI* | | | SetI |Csp6I | ||Tsp4CI* | | MaeII RsaI | |BspCNI | TaiI | BseMII | SetI Hpy188I TspEI ApoI N I P F V S Q N S T L R L I E S T F Q T I F L S F H K I L R * G * L R V H F R R Y S F R F T K F Y V K V D * E Y I S D G ----:----|----:----|----:----|----:----|----:----|----:----| F I G K T E C F E V N L N I S L V N * V L Y E K R K V F N * T L T S Q S Y M E S I N R E N * L I R R * P Q N L T C K L R BseGI TaqI | BetI* McrI* Hpy166II | BspMII* | AluI | BccI | |HpaII | CviJI | Tsp4CI* | |Hpy178III* FokI | |DdeI | |FokI | || BciVI | MboI | ||SetI | || Hpy188I | || | BsiYI* | BclI \ \\\ \ \\ \ \ \\ \ \ \ \ GTCGAAGCTGAGTTTACTGTTCTGATGGAAAACATCCGGAATATGGATACTTTTTTTACT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTTCGACTCAAATGACAAGACTACCTTTTGTAGGCCTTATACCTATGAAAAAAATGA // / / / / / // / // || | | | | | |FokI BseGI |BspMII* || | | | | | Hpy188I |BsiYI* || | | | | BccI |BetI* || | | | Tsp4CI* Hpy178III* || | | Hpy166II HpaII || | DdeI BciVI || CviJI || AluI |SetI TaqI V E A E F T V L M E N I R N M D T F F T S K L S L L F * W K T S G I W I L F L L R S * V Y C S D G K H P E Y G Y F F Y * ----:----|----:----|----:----|----:----|----:----|----:----| T S A S N V T R I S F M R F I S V K K V P R L Q T * Q E S P F C G S Y P Y K K * D F S L K S N Q H F V D P I H I S K K S Csp6I |RsaI || MwoI DpnI || HphI |BstKTI || Tsp4CI* AccI || TaqI || | AciI |BssNAI || | BseGI SfaNI || | | TspRI |Hpy166II \\ \ \ \ \\ \ \ \ \\ GATCAATCGAGCATCCCTTTGGTGAAGCGTACAGTGCGGTCTATCAATAATCTGTATACT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTTAGCTCGTAGGGAAACCACTTCGCATGTCACGCCAGATAGTTATTAGACATATGA // / / / //// / // || BclI BseGI | |||| AciI |AccI || MboI TaqI | |||Tsp4CI* Hpy166II |DpnI | |||HphI BssNAI |FokI | ||Csp6I BstKTI | |MwoI | |RsaI | TspRI SfaNI D Q S S I P L V K R T V R S I N N L Y T I N R A S L W * S V Q C G L S I I C I L S I E H P F G E A Y S A V Y Q * S V Y L ----:----|----:----|----:----|----:----|----:----|----:----| S * D L M G K T F R V T R D I L L R Y V Q D I S C G K P S A Y L A T * * Y D T Y I L R A D R Q H L T C H P R D I I Q I S CviJI AlwNI | ApoI MnlI | TspEI MseI SspI Hpy188I Hpy166II \ \ \ \ \ \ \ TGGAGAATACCAGAGGCTGAAATTCTATTAAATATTCAGAATAATATCAAGTGTGAACAA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTCTTATGGTCTCCGACTTTAAGATAATTTATAAGTCTTATTATAGTTCACACTTGTT / / / / / / / / MnlI | CviJI TspEI | | Hpy188I Hpy166II AlwNI ApoI | SspI MseI W R I P E A E I L L N I Q N N I K C E Q G E Y Q R L K F Y * I F R I I S S V N K E N T R G * N S I K Y S E * Y Q V * T N ----:----|----:----|----:----|----:----|----:----|----:----| Q L I G S A S I R N F I * F L I L H S C K S F V L P Q F E I L Y E S Y Y * T H V P S Y W L S F N * * I N L I I D L T F L Hpy178III* Eco57I | Hin4II* Eco57MI CviRI* | | SetI MaeIII | Hpy178III* \ \ \ \ \ \ \ ATGCAAATAACAAATGCTAACATTCAAGACCTGAAGGAAAAAGTTACAGATTATGTCAGG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTATTGTTTACGATTGTAAGTTCTGGACTTCCTTTTTCAATGTCTAATACAGTCC / /// / / / CviRI* ||SetI | Eco57MI Hpy178III* |Hpy178III* | Eco57I Hin4II* MaeIII M Q I T N A N I Q D L K E K V T D Y V R C K * Q M L T F K T * R K K L Q I M S G A N N K C * H S R P E G K S Y R L C Q E ----:----|----:----|----:----|----:----|----:----|----:----| I C I V F A L M * S R F S F T V S * T L F A F L L H * C E L G S P F L * L N H * H L Y C I S V N L V Q L F F N C I I D P CviJI | MboII | | MnlI | | |BsaXI | | |CviRI* | | || Eco57I | | || Eco57MI MseI CviRI* | | || | TsoI BseRI \ \ \ \\ \ \ \ AAAGATATTGCACAAATAACTGAAGATGTAGCCAATGCAAAAGAGGAGTATCTGTTTTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTATAACGTGTTTATTGACTTCTACATCGGTTACGTTTTCTCCTCATAGACAAAAAT / / /// / / / / / CviRI* | ||| | | TsoI | MseI | ||| | Eco57MI BseRI | ||| | Eco57I | ||| CviRI* | ||MnlI | |BsaXI | MboII CviJI K D I A Q I T E D V A N A K E E Y L F L K I L H K * L K M * P M Q K R S I C F * R Y C T N N * R C S Q C K R G V S V F N ----:----|----:----|----:----|----:----|----:----|----:----| F S I A C I V S S T A L A F S S Y R N K S L Y Q V F L Q L H L W H L L P T D T K F I N C L Y S F I Y G I C F L L I Q K * MaeII | MseI | SetI | TaiI | | MboI TspEI SfaNI | | BglII |BspCNI CviRI* | | XhoII ||BseMII | EcoT22I | | | DpnI ||| SfaNI | | BsaXI TaqI | | | |BstKTI ||| | Hin4I | | |MslI BciVI | | | ||DdeI Cac8I ||| | Hin4I \ \ \\ \ \ \ \ \\\ \ \\\ \ \ ATGCATTTTGATGATGCTTCGAGTGGATACGTTAAAGATCTCAGCACGCATCAATTTAGA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTAAAACTACTACGAAGCTCACCTATGCAATTTCTAGAGTCGTGCGTAGTTAAATCT / // // / / / / / // / / / // // | || |MslI | TaqI | | | || | | | || |TspEI | || SfaNI BciVI | | | || | | | || Hin4I | |BsaXI | | | || | | | || Hin4I | CviRI* | | | || | | | |BseMII EcoT22I | | | || | | | BspCNI | | | || | | Cac8I | | | || | DdeI | | | || XhoII | | | || BglII | | | || MboI | | | |DpnI | | | BstKTI | | MseI | MaeII TaiI SetI M H F D D A S S G Y V K D L S T H Q F R C I L M M L R V D T L K I S A R I N L E A F * * C F E W I R * R S Q H A S I * N ----:----|----:----|----:----|----:----|----:----|----:----| I C K S S A E L P Y T L S R L V C * N L L A N Q H H K S H I R * L D * C A D I * H M K I I S R T S V N F I E A R M L K S AluI CviJI | SetI Eam1105I | |EciI |MaeII | || TaqI TspEI CviRI* || SetI | || | Hin4I | MseI | BsmI || TaiI | || | Hin4I AciI | VspI Ksp632I* \ \ \\ \ \ \\ \ \ \ \ \ \ ATGCAAAAGACATTACGTCAAAAGCTATTCGATGTGTCCGCCAAAATTAATCATACTGAA 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTTCTGTAATGCAGTTTTCGATAAGCTACACAGGCGGTTTTAATTAGTATGACTT / / // / / // / / / // / | CviRI* || | | || | TaqI AciI |VspI Ksp632I* | BsmI || | | || Hin4I |MseI SfaNI || | | || Hin4I TspEI || | | |EciI || | | CviJI || | | AluI || | SetI || MaeII |TaiI |SetI Eam1105I M Q K T L R Q K L F D V S A K I N H T E C K R H Y V K S Y S M C P P K L I I L K A K D I T S K A I R C V R Q N * S Y * R ----:----|----:----|----:----|----:----|----:----|----:----| I C F V N R * F S N S T D A L I L * V S F A F S M V D F A I R H T R W F * D Y Q H L L C * T L L * E I H G G F N I M S F MseI |Eco57I Hpy166II |AhaIII* | AjuI |Eco57MI | | Tsp4CI* MboII || TspEI | | | TspRI AjuI \ \\ \ \ \ \ \ \ GAGTTGCTGAACATTTTAAAATTGTTCACTGTAAAGAATAAGAGATTGGACGATAATCCA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAACGACTTGTAAAATTTTAACAAGTGACATTTCTTATTCTCTAACCTGCTATTAGGT / / // // / / / MboII | |MseI || | Tsp4CI* AjuI | | || Hpy166II | | |TspRI | | TspEI | | AjuI | AhaIII* Eco57MI Eco57I E L L N I L K L F T V K N K R L D D N P S C * T F * N C S L * R I R D W T I I H V A E H F K I V H C K E * E I G R * S I ----:----|----:----|----:----|----:----|----:----|----:----| S N S F M K F N N V T F F L L N S S L G L T A S C K L I T * Q L S Y S I P R Y D L Q Q V N * F Q E S Y L I L S Q V I I W CviRI* | MaeII | |PmaCI FalI | |BsaAI FalI | |MaeIII | MaeI | |Tsp45I | MwoI | || SetI | | AluI | || TaiI | | CviJI | || | Tsp4CI* | | | SetI | || | | FalI | | | | TfiI | || | | FalI | | | | HinfI | || | | Hpy166II TspEI \ \ \ \ \ \ \\ \ \ \ \ TTAGTGGCAAAACTAGCTAAAGAATCTCTTGCACGTGACGGTTTACTAAAAGAAATCAAA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| AATCACCGTTTTGATCGATTTCTTAGAGAACGTGCACTGCCAAATGATTTTCTTTAGTTT / / /// / // // // / | | ||CviJI HinfI || || || Hpy166II | | ||AluI TfiI || || |Tsp4CI* | | |MaeI || || |Tsp45I | | SetI || || |MaeIII | MwoI || || FalI FalI || || FalI FalI || |MaeII || BsaAI || PmaCI |TaiI |SetI CviRI* L V A K L A K E S L A R D G L L K E I K * W Q N * L K N L L H V T V Y * K K S N S G K T S * R I S C T * R F T K R N Q I ----:----|----:----|----:----|----:----|----:----|----:----| N T A F S A L S D R A R S P K S F S I L M L P L V L * L I E Q V H R N V L L F * * H C F * S F F R K C T V T * * F F D F SetI | BseRI MaeIII | | CviJI | SetI | | | FokI | | MnlI | | | SfaNI | | |MfeI | | | |Hin4I | | |TspEI BarI | | | || Hpy99I \ \ \\ \ \ \ \ \\ \ TTATTGCGTGAGCAAGTGAGTAGGTTACAATTGGAGGAGAAAGGTAAAAAGGCTTCGTCG 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACGCACTCGTTCACTCATCCAATGTTAACCTCCTCTTTCCATTTTTCCGAAGCAGC / / / / // / / / / / / TspEI SetI | | |TspEI SetI | | | | SfaNI | | |MfeI | | | | FokI | | BarI | | | Hpy99I | MaeIII | | CviJI MnlI | Hin4I BseRI L L R E Q V S R L Q L E E K G K K A S S Y C V S K * V G Y N W R R K V K R L R R I A * A S E * V T I G G E R * K G F V V ----:----|----:----|----:----|----:----|----:----|----:----| N N R S C T L L N C N S S F P L F A E D I I A H A L S Y T V I P P S L Y F P K T * Q T L L H T P * L Q L L F T F L S R R TaqI | MboII | | BseGI | | CviRI* | | |BarI | | ||EcoT22I Hin4I | | ||| SfaNI | FatI MseI | | ||| | Ksp632I* | |CviAII |AhaIII* | | ||| | | MnlI | || NlaIII || TspDTI \ \ \\\ \ \ \ \ \\ \ \\ \ TTCGATGCATCCTCTTCAATAACAAAGGACATGAAAGGATTTAAAGTAGTAGAAGTTGGG 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTACGTAGGAGAAGTTATTGTTTCCTGTACTTTCCTAAATTTCATCATCTTCAACCC /// / /// / // /// ||| CviRI* ||Hin4I | |FatI ||TspDTI ||EcoT22I || | CviAII |MseI ||BseGI || NlaIII AhaIII* |MboII |Ksp632I* |TaqI SfaNI BarI MnlI F D A S S S I T K D M K G F K V V E V G S M H P L Q * Q R T * K D L K * * K L G R C I L F N N K G H E R I * S S R S W V ----:----|----:----|----:----|----:----|----:----|----:----| N S A D E E I V F S M F P N L T T S T P T R H M R K L L L P C S L I * L L L L Q E I C G R * Y C L V H F S K F Y Y F N P CfrI | BalI | CviJI | HaeIII | |FatI TspDTI HphI FatI | ||CviAII |TspEI | ApoI |CviAII | ||| NlaIII || MboII | TspEI || NlaIII \ \\\ \ \\ \ \ \ \\ \ TTGGCCATGAATACGAAAAAGCAAATTGGTGATTTCTTCAAAAATTTGAACATGGCAAAA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGGTACTTATGCTTTTTCGTTTAACCACTAAAGAAGTTTTTAAACTTGTACCGTTTT /// // / // / / / // ||| |FatI | |TspEI HphI | | |FatI ||| CviAII | MboII | | CviAII ||CfrI TspDTI | NlaIII |NlaIII TspEI HaeIII ApoI CviJI BalI L A M N T K K Q I G D F F K N L N M A K W P * I R K S K L V I S S K I * T W Q N G H E Y E K A N W * F L Q K F E H G K I ----:----|----:----|----:----|----:----|----:----|----:----| N A M F V F F C I P S K K L F K F M A F T P W S Y S F A F Q H N R * F N S C P L Q G H I R F L L N T I E E F I Q V H C F TAG --- ATC * X X --- Y I L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 AccI 4 FblI,XmiI AciI 15 BspACI,SsiI AclI 3 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 7 DraI AjuI 2 AlfI 2 AluI 11 AluBI AlwNI 3 CaiI ApaI 1 ApoI 13 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 3 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 8 BceAI 2 BcgI 1 BciVI 2 BfuI BclI 3 FbaI,Ksp22I BdaI 2 BetI* 6 BsaWI BglII 1 BinI* 11 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 3 BmtI 1 BspOI BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 8 BseRI 3 BseSI 1 BaeGI,BstSLI BsiYI* 23 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 3 BsrGI,BstAUI BspCNI 8 BspHI 1 CciI,PagI,RcaI BspLU11I* 2 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 4 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 2 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 11 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 17 BstXI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 9 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 13 CviQI,RsaNI CspCI 1 CviAII 16 CviJI 39 CviKI-1 CviRI* 21 HpyCH4V DdeI 11 BstDEI,HpyF3I DpnI 17 MalI DraII 2 EcoO109I Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 5 AcuI Eco57MI 6 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 3 Mph1103I,NsiI,Zsp2I EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 16 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 3 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 17 Hin4II* 11 HpyAV Hin6I 3 HinP1I,HspAI HindII 7 HincII HindIII 1 HinfI 19 HpaI 1 KspAI HpaII 7 HapII,BsiSI,MspI HphI 10 AsuHPI Hpy166II 18 Hpy8I Hpy178III* 19 Hpy188III Hpy188I 22 Hpy99I 2 Ksp632I* 7 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 13 HpyCH4IV MaeIII 16 MboI 17 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 29 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 5 SchI MmeI 1 MnlI 25 MseI 22 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 3 BstNSI,XceI PflMI 4 BasI,AccB7I,Van91I PleI 5 PpsI PmaCI 2 BbrPI,Eco72I,AcvI,PmlI,PspCI PshAI 1 BstPAI,BoxI PsiI 1 AanI PstI 1 RsaI 13 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 54 SfaNI 10 LweI SfeI* 2 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 7 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 13 TaqI 14 TaqII 1 TatI 6 TauI 5 TfiI 14 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 8 NmuCI Tsp4CI* 17 HpyCH4III,TaaI,Bst4CI TspDTI 23 TspEI 33 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 9 TscAI VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 8 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI Acc65I AflII AgeI AloI ApaLI AscI Asp718I AvaI AvrII BaeI BbvCI Bce83I* BfiI BglI BmeT110I BplI Bpu10I BsaBI BsePI BseYI BsgI BsiI* BstAPI BstEII BtgZI Cfr10I Cfr9I ClaI DinI DraIII DrdI DsaI* Ecl136II EcoICRI EcoNI EcoRI EcoRV EgeI EheI Esp3I FseI FspAI GsaI HgiCI* KasI KpnI MauBI MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI OliI PacI PasI PfoI PmeI PpiI PpuMI PspXI PsrI PvuI PvuII RsrII SacI SacII SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI Tth111I XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769