Restriction Map of SLM1/YIL105C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SLM1/YIL105C on chromosome IX from coordinates 169641 to 167581.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MaeIII Tsp45I | MwoI SetI | |Eco57I | AciI | |Eco57MI | Hin4I | || MboII | Hin4I | || | AluI | | MnlI | || | CviJI | | | BsmAI | || | | SetI | | | Eco31I | || | | |Hin4I TaqI Hin4I | | | Hpy188I | || | | |Hin4I \ \ \ \ \ \ \ \\ \ \ \\ ATGTCGAAAAACAACACAATGACCTCTGCGGTCTCTGATATGCTGTCACAGCAACAGCTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCTTTTTGTTGTGTTACTGGAGACGCCAGAGACTATACGACAGTGTCGTTGTCGAT / / / / / / / / / / / // / | TaqI | Hin4I | | | | | | | || CviJI Hin4I | Hin4I | | | | | | | || AluI SetI | | | | | | | |Hin4I | | | | | | | |Hin4I | | | | | | | |SetI | | | | | | | MboII | | | | | | Tsp45I | | | | | | MaeIII | | | | | Eco57MI | | | | | Eco57I | | | | MwoI | | | Eco31I | | | BsmAI | | Hpy188I | MnlI AciI M S K N N T M T S A V S D M L S Q Q Q L C R K T T Q * P L R S L I C C H S N S * V E K Q H N D L C G L * Y A V T A T A K ----:----|----:----|----:----|----:----|----:----|----:----| X D F F L V I V E A T E S I S D C C C S X T S F C C L S R Q P R Q Y A T V A V A H R F V V C H G R R D R I H Q * L L L * AlwNI | SetI | |CviRI* | || AarI | || BspMI | || |MwoI | || |BstAPI | || || TseI | || || CviRI* | || || |BisI | || || ||BlsI | || || |||TseI | || || ||||BisI MboI | || || |||||BlsI |EcoP15I | || || ||||||FalI ||DpnI | || || ||||||FalI |||FatI | || || ||||||| Eco57I |||BstKTI | || || ||||||| Eco57MI ||||MwoI | || || ||||||| | BbvI ||||CviAII | || || ||||||| | | BbvI ||||BstAPI \ \\ \\ \\\\\\\ \ \ \ \\\\\ AATCTTCAGCACCTGCATAACTTGCAGCAGCATACGAGAAGTATGACTTCAGCAGATCAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGAAGTCGTGGACGTATTGAACGTCGTCGTATGCTCTTCATACTGAAGTCGTCTAGTA // / / /////// / / //// / |SetI | | ||||||Eco57MI | BbvI |||| CviAII AlwNI | | ||||||Eco57I BbvI |||MboI | | ||||||TseI ||EcoP15I | | |||||BisI ||NlaIII | | ||||BlsI ||FalI | | |||TseI ||FalI | | ||BisI |DpnI | | |BlsI BstAPI | | |FalI BstKTI | | |FalI MwoI | | CviRI* | | BspMI | | AarI | BstAPI | MwoI CviRI* N L Q H L H N L Q Q H T R S M T S A D H I F S T C I T C S S I R E V * L Q Q I M S S A P A * L A A A Y E K Y D F S R S C ----:----|----:----|----:----|----:----|----:----|----:----| F R * C R C L K C C C V L L I V E A S * L D E A G A Y S A A A Y S F Y S K L L D I K L V Q M V Q L L M R S T H S * C I M TseI |BisI ||BlsI |||TseI ||||BisI |||||BlsI ||||||TseI ||||||MwoI |||||||BisI ||||||||BlsI NlaIII |||||||||TseI |FalI |||||||||MwoI |FalI ||||||||||BisI || AclI |||||||||||BlsI || MaeII ||||||||||||BbvI || | SetI ||||||||||||| MwoI || | TaiI EcoP15I ||||||||||||| BbvI \\ \ \ \ \\\\\\\\\\\\\ \ GCCAACGTTTTACAACAACAGCAACAACAACAACAACAACAACAGCAGCAGCAGCAGCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTGCAAAATGTTGTTGTCGTTGTTGTTGTTGTTGTTGTTGTCGTCGTCGTCGTCGTT / / / / //////////// / | | MaeII EcoP15I |||||||||||| MwoI | | AclI |||||||||||MwoI | TaiI |||||||||||TseI | SetI ||||||||||BisI FatI |||||||||BlsI ||||||||TseI |||||||BisI ||||||BlsI |||||MwoI |||||TseI ||||BisI |||BlsI ||MwoI ||TseI |BisI BlsI A N V L Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q P T F Y N N S N N N N N N N S S S S S N Q R F T T T A T T T T T T T A A A A A T ----:----|----:----|----:----|----:----|----:----|----:----| A L T K C C C C C C C C C C C C C C C C H W R K V V V A V V V V V V V A A A A A G V N * L L L L L L L L L L L L L L L L Hin6I |GlaI ||HhaI ||EcoP15I ||| BbvI ||| Cac8I ||| HindIII ||| |EcoP15I TseI ||| ||AluI MwoI ||| ||CviJI BbvI ||| ||| SetI EcoP15I |BisI ||| ||| EcoP15I | EcoP15I ||BlsI ||| ||| | EcoP15I | | BseGI AluI |||BbvI ||| ||| | | FokI | | | Hpy188I CviJI \\\\ \\\ \\\ \ \ \ \ \ \ \ \ CAGCAGCAGAGCGCAAGCTTTCAAAATGGCAGTTTGACATCCGATATAAACCAACAAAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTCGTCTCGCGTTCGAAAGTTTTACCGTCAAACTGTAGGCTATATTTGGTTGTTTCG / //// //// / /// / / / / // / / / | |||| |||| | ||| | | FokI | || Hpy188I | CviJI | |||| |||| | ||| | EcoP15I | |EcoP15I | AluI | |||| |||| | ||| EcoP15I | BseGI SetI | |||| |||| | ||HindIII EcoP15I AloI | |||| |||| | ||BbvI | |||| |||| | |EcoP15I | |||| |||| | CviJI | |||| |||| | AluI | |||| |||| EcoP15I | |||| |||| Cac8I | |||| |||| SetI | |||| |||Hin6I | |||| ||GlaI | |||| |HhaI | |||| BbvI | |||BbvI | ||TseI | |BisI | BbvI | BlsI BbvI Q Q Q S A S F Q N G S L T S D I N Q Q S S S R A Q A F K M A V * H P I * T N K A A A E R K L S K W Q F D I R Y K P T K L ----:----|----:----|----:----|----:----|----:----|----:----| C C C L A L K * F P L K V D S I F W C L V A A S R L S E F H C N S M R Y L G V F L L L A C A K L I A T Q C G I Y V L L A SpeI |MaeI AclI || Hin4II* MaeII SetI || |TspEI | SetI |AloI BsrI || ||AloI | TaiI \\ \ \\ \\\ \ \ TATTTGAATGGACAACCAGTTCCTTCCACTAGTAATTCAACGTTTCAAAACAATAGGACG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAACTTACCTGTTGGTCAAGGAAGGTGATCATTAAGTTGCAAAGTTTTGTTATCCTGC / / // / / / BsrI | |SpeI | | MaeII | | | | AclI | | | TaiI | | | SetI | | TspEI | Hin4II* | MaeI AloI Y L N G Q P V P S T S N S T F Q N N R T I * M D N Q F L P L V I Q R F K T I G R F E W T T S S F H * * F N V S K Q * D A ----:----|----:----|----:----|----:----|----:----|----:----| * K F P C G T G E V L L E V N * F L L V S N S H V V L E K W * Y N L T E F C Y S I Q I S L W N R G S T I * R K L V I P R HgaI | ApoI | TspEI | EcoRI | |MnlI | || Hpy178III* MlyI | || | TspDTI PleI | || | | CviRI* GsuI | TaqI | || | | | SetI Eco57MI BsrDI | | HinfI \ \\ \ \ \ \ \ \ \ \ \ CTGACGATGAATTCTGGAGGGTTGCAAGGTATCATAAGCAATGGTTCTCCTAATATCGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGCTACTTAAGACCTCCCAACGTTCCATAGTATTCGTTACCAAGAGGATTATAGCTG / / / / / / / / / // / | | | | | | SetI Eco57MI BsrDI |PleI TaqI | | | | | CviRI* GsuI MlyI | | | | TspDTI | | | Hpy178III* | | EcoRI | | TspEI | | ApoI | HgaI MnlI L T M N S G G L Q G I I S N G S P N I D * R * I L E G C K V S * A M V L L I S T D D E F W R V A R Y H K Q W F S * Y R L ----:----|----:----|----:----|----:----|----:----|----:----| S V I F E P P N C P I M L L P E G L I S A S S S N Q L T A L Y * L C H N E * Y R Q R H I R S P Q L T D Y A I T R R I D V BinI* | MboI AluI | TsoI CviJI BslFI | XhoII | SetI | MaeIII | | DpnI | |StyI TaqI | | BsrDI | | |BstKTI | |SecI* \ \ \ \ \ \ \\ \ \\ TCGAACACCAATGTAACCATTGCTGTCCCAGATCCCAATAATAACAACGGGAAACAGCTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTGTGGTTACATTGGTAACGACAGGGTCTAGGGTTATTATTGTTGCCCTTTGTCGAG / / // / / / // / / / | TaqI || MaeIII | | || XhoII | CviJI HinfI |BsrDI | | || MboI | AluI BslFI | | |DpnI SetI | | BstKTI | TsoI BinI* S N T N V T I A V P D P N N N N G K Q L R T P M * P L L S Q I P I I T T G N S S E H Q C N H C C P R S Q * * Q R E T A P ----:----|----:----|----:----|----:----|----:----|----:----| E F V L T V M A T G S G L L L L P F C S S S C W H L W Q Q G L D W Y Y C R S V A R V G I Y G N S D W I G I I V V P F L E MnlI |TsoI || Tsp4CI* || | TaqI || | | MboII || | | BbvII* || | | | CviJI MseI || | | | |MaeI SetI MaeII \ \\ \ \ \ \\ \ \ CAAGGGAAAAACTCTTTAACCAACACTTCAATACTGTCGAGGGCTAGGTCTTCCTTACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCCTTTTTGAGAAATTGGTTGTGAAGTTATGACAGCTCCCGATCCAGAAGGAATGTT / / / / // / // / SecI* MseI | | || | |MaeI TaiI StyI | | || | BbvII* SetI | | || | SetI | | || CviJI | | |MboII | | TaqI | Tsp4CI* TsoI MnlI Q G K N S L T N T S I L S R A R S S L Q K G K T L * P T L Q Y C R G L G L P Y N R E K L F N Q H F N T V E G * V F L T T ----:----|----:----|----:----|----:----|----:----|----:----| W P F F E K V L V E I S D L A L D E K C G L S F S K L W C K L V T S P * T K R V L P F V R * G V S * Y Q R P S P R G * L BspCNI |Hin4I |Hin4I |BseMII || BinI* || | MboI || | XhoII || | | DpnI || | | |BstKTI || | | || MaeI || | | || | MboI || | | || | BglII || | | || | XhoII || | | || | | DpnI BbvI SetI DdeI || | | || | | |BstKTI Hin4I TaiI EspI* || | | || | | || BslFI Hin4I \ \ \\ \ \ \\ \ \ \\ \ \ CGTCAAAGACTTGCTCAGCAACAGCAACAACAACAAGATCCTAGATCTCCATTAGTAATA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTTCTGAACGAGTCGTTGTCGTTGTTGTTGTTCTAGGATCTAGAGGTAATCATTAT / / / // / // / /// / / / MaeII EspI* | || | || | ||| XhoII | Hin4I DdeI | || | || | ||| BglII | Hin4I | || | || | ||| MboI BslFI | || | || | ||DpnI | || | || | |BstKTI | || | || | MaeI | || | || XhoII | || | || MboI | || | |DpnI | || | BstKTI | || BinI* | |BseMII | BspCNI Hin4I Hin4I R Q R L A Q Q Q Q Q Q Q D P R S P L V I V K D L L S N S N N N K I L D L H * * Y S K T C S A T A T T T R S * I S I S N T ----:----|----:----|----:----|----:----|----:----|----:----| R * L S A * C C C C C C S G L D G N T I V D F V Q E A V A V V V L D * I E M L L T L S K S L L L L L L L I R S R W * Y Y AsuI* AvaII |BmgT120I ||BsrI ||NlaIV ||| SfeI* ||| | TseI ||| | AluI ||| | CviJI ||| | PvuII ||| | NspBII* ||| | |BisI ||| | ||BlsI ||| | ||SetI MnlI SetI ||| | |||Hin6I | TseI | BbvI ||| | ||||GlaI | CviRI* | | AluI ||| | ||||MstI* | |BisI | | CviJI ||| | |||||HhaI | ||BlsI | | | SetI \\\ \ \\\\\\ \ \\\ \ \ \ \ CTGGTCCCTACAGCTGCGCAACCAACAGATATTCTTGCAGCGAGGTTTTCAGCTTGGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACCAGGGATGTCGACGCGTTGGTTGTCTATAAGAACGTCGCTCCAAAAGTCGAACCTCT //// //////// / //// / / // |||| |||||||Hin6I | |||| SetI | |BbvI |||| ||||||MstI* | |||TseI | CviJI |||| ||||||GlaI | ||BisI | AluI |||| |||||TseI | |BlsI SetI |||| |||||HhaI | CviRI* |||| ||||BisI MnlI |||| |||BlsI |||| ||NspBII* |||| ||PvuII |||| ||CviJI |||| ||AluI |||| |SfeI* |||| SetI |||AvaII |||AsuI* ||BmgT120I ||NlaIV |BbvI BsrI L V P T A A Q P T D I L A A R F S A W R W S L Q L R N Q Q I F L Q R G F Q L G E G P Y S C A T N R Y S C S E V F S L E K ----:----|----:----|----:----|----:----|----:----|----:----| S T G V A A C G V S I R A A L N E A Q L V P G * L Q A V L L Y E Q L S T K L K S Q D R C S R L W C I N K C R P K * S P S MboI | DpnI | |BstKTI | || Hpy166II Hpy178III* | || | HphI | TspEI | || | |MseI | |BseGI \ \\ \ \\ \ \\ AATGTCATCAAGTCGGTGATCGTTTACTTAACAGAAATCGCTTCTATTCAGGATGAAATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAGTAGTTCAGCCACTAGCAAATGAATTGTCTTTAGCGAAGATAAGTCCTACTTTAA // / / / / / / / || | | | MseI | | TspEI || | | HphI | BseGI || | Hpy166II Hpy178III* || MboI |DpnI BstKTI N V I K S V I V Y L T E I A S I Q D E I M S S S R * S F T * Q K S L L F R M K L C H Q V G D R L L N R N R F Y S G * N C ----:----|----:----|----:----|----:----|----:----|----:----| F T M L D T I T * K V S I A E I * S S I F H * * T P S R K S L L F R K * E P H F I D D L R H D N V * C F D S R N L I F N TaqI FatI |MboI |CviAII || DpnI || NspI || |TaqI || NlaIII || |PvuI || | TatI || |McrI* || | Bsp1407I || |BstKTI FokI || | |Csp6I || ||Hpy178III* | TspDTI || | ||RsaI Hin4I || ||| TfiI | | DdeI || | ||| TspEI Hin4I || ||| HinfI \ \ \ \\ \ \\\ \ \ \\ \\\ \ GTTAGACAGCAACTAAGATTATCACATGCTGTACAATTCCCATTCTTTTCGATCGAGAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCTGTCGTTGATTCTAATAGTGTACGACATGTTAAGGGTAAGAAAAGCTAGCTCTTA / / / / // /// // // /// / | FokI DdeI | || ||| |TspEI || ||| HinfI TspDTI | || ||| Hin4I || ||| TfiI | || ||| Hin4I || ||Hpy178III* | || ||Bsp1407I || |TaqI | || ||TatI || MboI | || |Csp6I |DpnI | || RsaI BstKTI | |FatI McrI* | CviAII TaqI NlaIII PvuI NspI V R Q Q L R L S H A V Q F P F F S I E N L D S N * D Y H M L Y N S H S F R S R I * T A T K I I T C C T I P I L F D R E S ----:----|----:----|----:----|----:----|----:----|----:----| T L C C S L N D C A T C N G N K E I S F Q * V A V L I I V H Q V I G M R K S R S N S L L * S * * M S Y L E W E K R D L I Hin4I |AluI |CviJI |Hin4I |Hin4I ||MnlI TatI |||SetI |Csp6I |||Cac8I ||RsaI Hin4I \\\\ \\\ \ CAATACCAACCAAGCTCGCAGGAGGATAAATCAGTACAAAAGTTTTTTTTGCCATTGGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATGGTTGGTTCGAGCGTCCTCCTATTTAGTCATGTTTTCAAAAAAAACGGTAACCCA // / / / /// / || | | Cac8I ||| Hin4I || | CviJI ||TatI || | AluI |Csp6I || | MnlI RsaI || SetI |Hin4I |Hin4I Hin4I Q Y Q P S S Q E D K S V Q K F F L P L G N T N Q A R R R I N Q Y K S F F C H W V I P T K L A G G * I S T K V F F A I G * ----:----|----:----|----:----|----:----|----:----|----:----| * Y W G L E C S S L D T C F N K K G N P D I G V L S A P P Y I L V F T K K A M P L V L W A R L L I F * Y L L K K Q W Q T FokI FatI BspHI |CviAII |Hpy178III* || TfiI || HinfI || NlaIII || | MaeI || | |HgaI CviJI || | || BseGI | TaqI TspEI BsrI || | || | TspDTI \ \ \ \ \\ \ \\ \ \ AATGGCTCGATACAGGACTTACCAACAATTTTGAACCAGTATCATGAATCCCTAGCATCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCGAGCTATGTCCTGAATGGTTGTTAAAACTTGGTCATAGTACTTAGGGATCGTAGG / / / / / // / // // | TaqI | BsrI | || | || |MwoI CviJI TspEI | || | || |HgaI | || | || TspDTI | || | |MaeI | || | BseGI | || HinfI | || TfiI | |BspHI | |FatI | |FokI | Hpy178III* | CviAII NlaIII N G S I Q D L P T I L N Q Y H E S L A S M A R Y R T Y Q Q F * T S I M N P * H P W L D T G L T N N F E P V S * I P S I Q ----:----|----:----|----:----|----:----|----:----|----:----| L P E I C S K G V I K F W Y * S D R A D Y H S S V P S V L L K S G T D H I G L M I A R Y L V * W C N Q V L I M F G * C G MwoI |Hin6I ||GlaI |||HhaI |||SfaNI Hin4I |||FnuDII* | MnlI |||| DdeI TspEI | | SmlI |||| | MwoI SfaNI | | | BbvII* \\\\ \ \ \ \ \ \ \ AGCGCGTCTAAGGCATCAAGGGAATTGACCAATGATGTTATTCCTCGTTTGGAAGACTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCGCAGATTCCGTAGTTCCCTTAACTGGTTACTACAATAAGGAGCAAACCTTCTGAAC /// // / / / / ||| || DdeI SfaNI Hin4I MnlI ||| |SfaNI TspEI ||| MwoI ||FnuDII* ||Hin6I |GlaI HhaI S A S K A S R E L T N D V I P R L E D L A R L R H Q G N * P M M L F L V W K T * R V * G I K G I D Q * C Y S S F G R L E ----:----|----:----|----:----|----:----|----:----|----:----| L A D L A D L S N V L S T I G R K S S K W R T * P M L P I S W H H * E E N P L S A R R L C * P F Q G I I N N R T Q F V Q MboII | MboI | BglII | XhoII | | DpnI | | |BstKTI BtsI | | || BseRI | SfeI* | | || | Bce83I* | | CviRI* | | || | Hpy178III* | | | PstI | | || | | Hin4I | | | TspRI ApoI | | || | | | MmeI | | | | Hpy188I TspEI \ \ \\ \ \ \ \ \ \ \ \ \ \ AGGAGAGATCTAATAGTCAAGATAAAGGAAATAAAATCACTGCAGTCGGATTTCAAAAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTCTAGATTATCAGTTCTATTTCCTTTATTTTAGTGACGTCAGCCTAAAGTTTTTA / / // / / / / / / / / / / / | | || | | | | | MmeI | | | | Hpy188I | | || | | | | Hpy178III* | | | SfeI* | | || | | | Hin4I | | CviRI* | | || | | Bce83I* | PstI | | || | BseRI TspRI | | || XhoII BtsI | | || BglII | | || MboI | | |DpnI | | BstKTI | BbvII* | MboII SmlI R R D L I V K I K E I K S L Q S D F K N G E I * * S R * R K * N H C S R I S K I E R S N S Q D K G N K I T A V G F Q K F ----:----|----:----|----:----|----:----|----:----|----:----| L L S R I T L I F S I F D S C D S K L F S S L D L L * S L P F L I V A T P N * F P S I * Y D L Y L F Y F * Q L R I E F I Hpy178III* CviJI | HinfI HaeIII | TspDTI |FatI | | SfaNI ||CviAII | | | MseI ||| NlaIII | | | |AhaIII* MaeIII ||| | TspEI | | | ||PleI \ \\\ \ \ \ \ \ \\\ TCTTGTTCCAAAGAGTTACAACAAACAAAACAGGCCATGAAGCAATTTCAGGAGTCTTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGAACAAGGTTTCTCAATGTTGTTTGTTTTGTCCGGTACTTCGTTAAAGTCCTCAGAAAT / / // // / // / /// TspEI MaeIII || |FatI | || | ||MseI ApoI || CviAII | || | |AhaIII* |NlaIII | || | SfaNI HaeIII | || HinfI CviJI | |Hpy178III* | TspDTI TspEI S C S K E L Q Q T K Q A M K Q F Q E S L L V P K S Y N K Q N R P * S N F R S L * L F Q R V T T N K T G H E A I S G V F K ----:----|----:----|----:----|----:----|----:----|----:----| E Q E L S N C C V F C A M F C N * S D K N K N W L T V V F L V P W S A I E P T K R T G F L * L L C F L G H L L K L L R * BsePI Hin6I AluI |GlaI CviJI ||HhaI | SetI ||Hin6I TspRI | Cac8I ||Cac8I | BinI* | | Hin6I ||BseGI | | MboI | | |GlaI ||FnuDII* | | XhoII | | ||HhaI |||GlaI | | | DpnI | | |||HaeII MlyI ||||HhaI FokI | | | |BstKTI MseI | | |||| TsoI \ \\\\\ \ \ \ \ \\ \ \ \ \\\\ \ AAGGATGCGCGCTATTCAGTGCCAAAACAAGATCCATTCTTAACCAAGCTGGCGCTTGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTACGCGCGATAAGTCACGGTTTTGTTCTAGGTAAGAATTGGTTCGACCGCGAACTA / ///// / / / // / / / / ////// PleI ||||| TspRI FokI | || XhoII | | | |||||TsoI MlyI ||||BsePI | || MboI | | | ||||Hin6I ||||Hin6I | |DpnI | | | |||GlaI |||GlaI | BstKTI | | | ||HhaI ||FnuDII* BinI* | | | |HaeII ||Hin6I | | | Cac8I ||Cac8I | | CviJI ||HhaI | | AluI |GlaI | SetI BseGI MseI HhaI K D A R Y S V P K Q D P F L T K L A L D R M R A I Q C Q N K I H S * P S W R L I G C A L F S A K T R S I L N Q A G A * * ----:----|----:----|----:----|----:----|----:----|----:----| F S A R * E T G F C S G N K V L S A S S L P H A S N L A L V L D M R L W A P A Q L I R A I * H W F L I W E * G L Q R K I FatI CviRI* |CviAII || NlaIII || |HindIII || || AluI || || CviJI || || | SetI || || | | Eco57I Eco57I || || | | Eco57MI Eco57MI MnlI || || | | | TspEI |TspEI | Hpy178III* || || | | | |BsmAI || MseI | | XmnI || || | | | ||TspDTI \\ \ \ \ \ \\ \\ \ \ \ \\\ AGACAAATTAAAAAGCAACTTCAGGAGGAAAACTTTCTGCATGAAGCTTTTGATAATTTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTTAATTTTTCGTTGAAGTCCTCCTTTTGAAAGACGTACTTCGAAAACTATTAAAT / // / / / / /// / / / // | |MseI MnlI | XmnI | ||| | | | |BsmAI | TspEI Hpy178III* | ||| | | | TspEI Eco57MI | ||| | | TspDTI Eco57I | ||| | HindIII | ||| | Eco57MI | ||| | Eco57I | ||| CviJI | ||| AluI | ||SetI | |FatI | CviAII CviRI* NlaIII R Q I K K Q L Q E E N F L H E A F D N L D K L K S N F R R K T F C M K L L I I * T N * K A T S G G K L S A * S F * * F R ----:----|----:----|----:----|----:----|----:----|----:----| L C I L F C S * S S F K R C S A K S L K Y V F * F A V E P P F S E A H L K Q Y N S L N F L L K L L F V K Q M F S K I I * Hin6I |GlaI ||HhaI ||AlwNI |||HaeII ApoI |||| TspEI TspEI TspEI MseI \\\\ \ \ \ \ GAGACTTCAGGCGCTGAATTAGAAAAAATTGTAGTTATGGAAATTCAAAACTCTTTAACA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGAAGTCCGCGACTTAATCTTTTTTAACATCAATACCTTTAAGTTTTGAGAAATTGT //// / / / / |||Hin6I TspEI TspEI TspEI MseI ||GlaI ApoI |HhaI AlwNI HaeII E T S G A E L E K I V V M E I Q N S L T R L Q A L N * K K L * L W K F K T L * Q D F R R * I R K N C S Y G N S K L F N N ----:----|----:----|----:----|----:----|----:----|----:----| S V E P A S N S F I T T I S I * F E K V L S K L R Q I L F F Q L * P F E F S K L L S * A S F * F F N Y N H F N L V R * C MfeI BstXI TspEI EcoRV | BsrI BfiI |BslFI TaqI | TspEI \ \ \ \\ \ \ \ ATATATGCCAGATTACTGGGACAAGAAGCACAATTGGTTTTCGATATATTGATATCCAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATATACGGTCTAATGACCCTGTTCTTCGTGTTAACCAAAAGCTATATAACTATAGGTTT / / / // / / BstXI BsrI BfiI |BslFI TaqI EcoRV TspEI MfeI I Y A R L L G Q E A Q L V F D I L I S K Y M P D Y W D K K H N W F S I Y * Y P N I C Q I T G T R S T I G F R Y I D I Q I ----:----|----:----|----:----|----:----|----:----|----:----| I Y A L N S P C S A C N T K S I N I D L L I H W I V P V L L V I P K R Y I S I W Y I G S * Q S L F C L Q N E I Y Q Y G F AclI MaeII | SetI | TaiI | |HindII | |Hpy166II BinI* TfiI | || TspEI | MboI HinfI | || | XcmI | BamHI | Hpy178III* | || | | TspDTI | XhoII \ \ \ \\ \ \ \ \ \ TTAGATTCTGGATTTTTCAACGTTGACCCACAATTTGAATGGGATAACTTCATTTCAAGG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTAAGACCTAAAAAGTTGCAACTGGGTGTTAAACTTACCCTATTGAAGTAAAGTTCC / / / / / / // / / | | | | | Hpy166II || TspDTI BinI* | | | | | HindII |TspEI | | | | MaeII XcmI | | | | AclI | | | TaiI | | | SetI | | Hpy178III* | HinfI | TfiI TspEI L D S G F F N V D P Q F E W D N F I S R * I L D F S T L T H N L N G I T S F Q G R F W I F Q R * P T I * M G * L H F K G ----:----|----:----|----:----|----:----|----:----|----:----| N S E P N K L T S G C N S H S L K M E L I L N Q I K * R Q G V I Q I P Y S * K L * I R S K E V N V W L K F P I V E N * P DpnI NlaIV Hpy166II |BstKTI BdaI |BdaI || BinI* BdaI MnlI |BdaI \\ \ \ \ \\ GATCCCAACTTTTTATTGCCTAATCTACCGATGAGGACATTCAAAGAAATCGTTTACAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGGTTGAAAAATAACGGATTAGATGGCTACTCCTGTAAGTTTCTTTAGCAAATGTTT // / / / / // || | BinI* BdaI MnlI |Hpy166II || XhoII BdaI BdaI || BamHI BdaI || MboI |NlaIV |DpnI BstKTI D P N F L L P N L P M R T F K E I V Y K I P T F Y C L I Y R * G H S K K S F T N S Q L F I A * S T D E D I Q R N R L Q I ----:----|----:----|----:----|----:----|----:----|----:----| S G L K K N G L R G I L V N L S I T * L P D W S K I A * D V S S S M * L F R K C I G V K * Q R I * R H P C E F F D N V F BinI* TspEI MboI | TaqI | DpnI | |MboI | |BstKTI | || DpnI | || ApoI | || |BstKTI TspDTI | || TspEI \ \\ \\ \ \ \\ \ TACCAATTCGATCCTTTGACTTATGAAATCAAATCAGGGTTTTTAGAAAGAAGATCAAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTAAGCTAGGAAACTGAATACTTTAGTTTAGTCCCAAAAATCTTTCTTCTAGTTTT / / // / / // / | | || MboI TspDTI || MboI | | |DpnI |DpnI | | BstKTI BstKTI | | TaqI | TspEI BinI* Y Q F D P L T Y E I K S G F L E R R S K T N S I L * L M K S N Q G F * K E D Q N P I R S F D L * N Q I R V F R K K I K I ----:----|----:----|----:----|----:----|----:----|----:----| Y W N S G K V * S I L D P N K S L L D F I G I R D K S K H F * I L T K L F F I L V L E I R Q S I F D F * P K * F S S * F FatI |CviAII || ApoI || TspEI || EcoRI || NlaIII MboII || | Hpy178III* \ \\ \ \ TTTCTAAAATCCTATTCAAAAGGGTATTATGTGCTGACACCGAACTTTTTACATGAATTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGATTTTAGGATAAGTTTTCCCATAATACACGACTGTGGCTTGAAAAATGTACTTAAG // / // / |TspEI | || EcoRI |ApoI | || TspEI MboII | || ApoI | |FatI | CviAII NlaIII F L K S Y S K G Y Y V L T P N F L H E F F * N P I Q K G I M C * H R T F Y M N S S K I L F K R V L C A D T E L F T * I Q ----:----|----:----|----:----|----:----|----:----|----:----| N R F D * E F P Y * T S V G F K K C S N I E L I R N L L T N H A S V S S K V H I K * F G I * F P I I H Q C R V K * M F E AciI SecI* DsaI* | AciI | FnuDII* | NspBII* Csp6I TatI | |SacII |RsaI |Csp6I | |TspDTI || BsrI TspRI MseI ||RsaI \ \\ \\ \ \ \ \\\ AAGACCGCGGACAGAAAAAAAGATTTAGTACCAGTGATGTCGTTAGCATTAAGTGAATGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGCGCCTGTCTTTTTTTCTAAATCATGGTCACTACAGCAATCGTAATTCACTTACA / // / // / / | || DsaI* |Csp6I MseI RsaI | || SecI* TspRI | || AciI RsaI | |NspBII* BsrI | |FnuDII* | |AciI | TspDTI | SacII Hpy178III* K T A D R K K D L V P V M S L A L S E C R P R T E K K I * Y Q * C R * H * V N V D R G Q K K R F S T S D V V S I K * M Y ----:----|----:----|----:----|----:----|----:----|----:----| L V A S L F F S K T G T I D N A N L S H * S R P C F F L N L V L S T T L M L H I L G R V S F F I * Y W H H R * C * T F T PfoI BssKI | HpaII | ScrFI | CauII* | | TspGWI | | | TatI | | | Tsp4CI* ApoI MaeIII | | | |HphI TspEI Tsp45I | | | |Csp6I | TaqI BsrI Tsp4CI* | | | ||RsaI | | SfaNI | Hpy188I \ \ \ \ \\\ \ \ \ \ \ ACTGTGACGGAACATTCCCGGAAAAACAGTACATCATCACCAAATTCGACTGGTTCGGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGACACTGCCTTGTAAGGGCCTTTTTGTCATGTAGTAGTGGTTTAAGCTGACCAAGCCTA // / /// // /// / / / / || Tsp45I ||BssKI || ||TatI | | | Hpy188I || MaeIII ||PfoI || |Csp6I | | SfaNI |Tsp4CI* |TspGWI || RsaI | | BsrI |TatI |HpaII |HphI | TaqI Csp6I CauII* Tsp4CI* TspEI ScrFI ApoI T V T E H S R K N S T S S P N S T G S D L * R N I P G K T V H H H Q I R L V R M C D G T F P E K Q Y I I T K F D W F G C ----:----|----:----|----:----|----:----|----:----|----:----| V T V S C E R F F L V D D G F E V P E S Y Q S P V N G S F C Y M M V L N S Q N P S H R F M G P F V T C * * W I R S T R I FatI CviRI* |CviAII ||Cac8I ||| SphI Hpy99I ||| NspI |BceAI ||| NlaIII ||MaeIII ||| |DdeI ||Tsp45I DdeI ||| |EspI* ||| MfeI |BseGI FokI ||| ||MwoI TspEI ||| TspEI \\ \ \\\ \\\ \ \\\ \ GCTAAGTTTGTGTTGCATGCTAAGCAAAACGGCATAATTCGTCGTGGTCACAATTGGGTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTCAAACACAACGTACGATTCGTTTTGCCGTATTAAGCAGCACCAGTGTTAACCCAA / / // /// / / / / / | DdeI || ||| EspI* Hpy99I | | TspEI BseGI || ||| DdeI TspEI | | MfeI || ||FatI | Tsp45I || |CviAII | MaeIII || |MwoI BceAI || Cac8I |CviRI* |NlaIII |NspI |SphI FokI A K F V L H A K Q N G I I R R G H N W V L S L C C M L S K T A * F V V V T I G F * V C V A C * A K R H N S S W S Q L G F ----:----|----:----|----:----|----:----|----:----|----:----| A L N T N C A L C F P M I R R P * L Q T H * T Q T A H * A F R C L E D H D C N P S L K H Q M S L L V A Y N T T T V I P N MboI MseI BglII |AhaIII* XhoII || CviJI | DpnI || | TfiI TfiI | |BstKTI || | HinfI HinfI TspDTI TspEI | || MseI MboII \\ \ \ \ \ \ \ \\ \ \ TTTAAAGCCGATTCTTATGAATCAATGATGTCTTGGTTTGATAATTTGAAGATCTTAACA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTCGGCTAAGAATACTTAGTTACTACAGAACCAAACTATTAAACTTCTAGAATTGT // / / / / / // / / / || CviJI HinfI HinfI TspDTI | || | | MboII |MseI TfiI TfiI | || | MseI AhaIII* | || XhoII | || BglII | || MboI | |DpnI | BstKTI TspEI F K A D S Y E S M M S W F D N L K I L T L K P I L M N Q * C L G L I I * R S * H * S R F L * I N D V L V * * F E D L N I ----:----|----:----|----:----|----:----|----:----|----:----| K L A S E * S D I I D Q N S L K F I K V K * L R N K H I L S T K T Q Y N S S R L K F G I R I F * H H R P K I I Q L D * C ApoI TspEI TaqI ApoI TspEI EcoRI AsuII TspDTI TspEI | MseI |BccI Hpy188I \ \ \ \ \ \\ \ TCTACTTCGAATATACAAGACAAGTATAAATTCATAACACAAAAATTAAACTTGAATTCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGAAGCTTATATGTTCTGTTCATATTTAAGTATTGTGTTTTTAATTTGAACTTAAGT / / / // / // AsuII TspDTI TspEI |MseI | |Hpy188I TaqI ApoI TspEI | EcoRI | TspEI | ApoI BccI S T S N I Q D K Y K F I T Q K L N L N S L L R I Y K T S I N S * H K N * T * I Q Y F E Y T R Q V * I H N T K I K L E F R ----:----|----:----|----:----|----:----|----:----|----:----| D V E F I C S L Y L N M V C F N F K F E M * K S Y V L C T Y I * L V F I L S S N R S R I Y L V L I F E Y C L F * V Q I * AluI MseI CviJI VspI PvuII AluI | TsoI NspBII* CviJI | | BseMII |DdeI | SetI TsoI | | |BspCNI ||SetI \ \ \ \ \ \\ \\\ GATGGGAAACCCAAGCTAACCAATAACCATACCAGCATTAATAAGTATCAGCTGAGTAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCCTTTGGGTTCGATTGGTTATTGGTATGGTCGTAATTATTCATAGTCGACTCATTA / / / / /// / / / | CviJI TsoI | ||BspCNI | | DdeI | AluI | |BseMII | NspBII* SetI | VspI | PvuII | MseI | CviJI TsoI | AluI SetI D G K P K L T N N H T S I N K Y Q L S N M G N P S * P I T I P A L I S I S * V M W E T Q A N Q * P Y Q H * * V S A E * C ----:----|----:----|----:----|----:----|----:----|----:----| S P F G L S V L L W V L M L L Y * S L L L H S V W A L W Y G Y W C * Y T D A S Y I P F G L * G I V M G A N I L I L Q T I AsuI* AvaII |NlaIV XcmI TspDTI TspEI |BmgT120I \ \ \ \\ GCCAATAGCACAATGGTAGAAAATGATGAAAACGATGATATAAATAGTAATTATGTGGGG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTATCGTGTTACCATCTTTTACTACTTTTGCTACTATATTTATCATTAATACACCCC / / / / XcmI TspDTI TspEI NlaIV A N S T M V E N D E N D D I N S N Y V G P I A Q W * K M M K T M I * I V I M W G Q * H N G R K * * K R * Y K * * L C G V ----:----|----:----|----:----|----:----|----:----|----:----| A L L V I T S F S S F S S I F L L * T P H W Y C L P L F H H F R H Y L Y Y N H P G I A C H Y F I I F V I I Y I T I I H P BseGI |MboII SecI* |TspDTI DsaI* |BbvII* Hpy166II || FatI | MaeIII || |CviAII | Tsp4CI* TspEI FokI || || NlaIII \ \ \ \ \\ \\ \ TCCACGGTAACACCAAAATTGGACAATCAAACAAATACGAATACATCCATGTCTTCATTA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGCCATTGTGGTTTTAACCTGTTAGTTTGTTTATGCTTATGTAGGTACAGAAGTAAT // // / / / /// // // / || || MaeIII TspEI FokI ||| || |FatI SetI || |DsaI* ||| || CviAII || |SecI* ||| |BbvII* || Tsp4CI* ||| NlaIII |Hpy166II ||MboII |AvaII |TspDTI |AsuI* BseGI BmgT120I S T V T P K L D N Q T N T N T S M S S L P R * H Q N W T I K Q I R I H P C L H Y H G N T K I G Q S N K Y E Y I H V F I T ----:----|----:----|----:----|----:----|----:----|----:----| D V T V G F N S L * V F V F V D M D E N T W P L V L I P C D F L Y S Y M W T K M G R Y C W F Q V I L C I R I C G H R * * TfiI HinfI MboI | Hpy188I | DpnI SetI | |TspEI | |BstKTI SspI Hin4I \ \ \\ \ \\ \ \ CCTGATACTAATGATTCTGAATTACAAGATCAAGTTCCCAATATTTATATTCAAACTCCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTATGATTACTAAGACTTAATGTTCTAGTTCAAGGGTTATAAATATAAGTTTGAGGT // / // / / / || | || MboI SspI Hin4I || | |DpnI || | BstKTI || TspEI |Hpy188I HinfI TfiI P D T N D S E L Q D Q V P N I Y I Q T P L I L M I L N Y K I K F P I F I F K L Q * Y * * F * I T R S S S Q Y L Y S N S N ----:----|----:----|----:----|----:----|----:----|----:----| G S V L S E S N C S * T G L I * I * V G V Q Y * H N Q I V L D L E W Y K Y E F E R I S I I R F * L I L N G I N I N L S W ATAAACGATTTCAAATCATAA 2050 2060 ----:----|----:----|- TATTTGCTAAAGTTTAGTATT I N D F K S * * T I S N H X K R F Q I I X ----:----|----:----|- I F S K L D Y L L R N * I M Y V I E F * L # Enzymes that cut Frequency Isoschizomers AarI 1 AciI 3 BspACI,SsiI AclI 3 Psp1406I AhaIII* 2 DraI AloI 1 AluI 11 AluBI AlwNI 2 CaiI ApoI 8 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 9 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BceAI 1 BdaI 2 BfiI 1 BmrI,BmuI BglII 3 BinI* 6 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 2 BseGI 6 BstF5I,BtsCI BseMII 2 BsePI 1 BssHII,PauI BseRI 1 BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 2 BstKTI 13 BstXI 1 BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 5 CviQI,RsaNI CviAII 8 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 13 MalI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 5 EcoP15I 8 EcoRI 3 EcoRV 1 Eco32I EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 8 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 7 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HhaI 7 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 1 HpyAV Hin6I 7 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 8 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 6 Hpy99I 1 MaeI 4 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 6 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 2 SchI MmeI 1 MnlI 8 MseI 11 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 10 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 2 BstNSI,XceI PfoI 1 PleI 2 PpsI PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 5 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 21 SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 11 TatI 4 TfiI 6 PfeI TseI 9 ApeKI TsoI 5 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 29 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI VspI 1 PshBI,AseI XcmI 2 XhoII 7 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AjuI AlfI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BarI BbvCI BcgI BciVI BclI BetI* BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseSI BseYI BsgI BsiI* BsiYI* BsmI Bsp120I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstZ17I BtgZI BtrI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRII EcoT22I EgeI EheI Esp3I FauI FseI FspAI GsaI HgiAI* HgiCI* HgiJII* HpaI KasI KpnI Ksp632I* MauBI MluI Mph1103I MroNI MslI MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI RsrII SacI SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769