Restriction Map of XBP1/YIL101C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

XBP1/YIL101C on chromosome IX from coordinates 177250 to 175307.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.19369

EMBOSS_001 MaeIII Tsp45I Tsp4CI* | TspRI | | Tsp4CI* BssKI | | |Csp6I SecI* | | ||RsaI EcoRII TspDTI | | |||Hpy166II | ScrFI AciI | FauI MseI | | |||| MseI | BseBI \ \ \ \ \ \ \\\\ \ \ \ ATGAAATATCCCGCTTTTAGCATTAACAGTGACACGGTACACTTAACGGACAACCCCCTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTATAGGGCGAAAATCGTAATTGTCACTGTGCCATGTGAATTGCCTGTTGGGGGAC // / // / / / // / // || | || | | | || MseI |SecI* || | || | | | |Hpy166II TspGWI || | || | | | |Csp6I BseBI || | || | | | RsaI ScrFI || | || | | Tsp4CI* || | || | Tsp45I || | || | MaeIII || | || Tsp4CI* || | |MseI || | TspRI || FauI |TspDTI AciI M K Y P A F S I N S D T V H L T D N P L * N I P L L A L T V T R Y T * R T T P W E I S R F * H * Q * H G T L N G Q P P G ----:----|----:----|----:----|----:----|----:----|----:----| X F Y G A K L M L L S V T C K V S L G R X S I D R K * C * C H C P V S L P C G G H F I G S K A N V T V R Y V * R V V G Q AciI BisI |BlsI ||TauI ||MroNI ||Cfr10I |||HpaII ||||CfrI ||||NaeI ||||Cac8I ||||| CviJI Hin4I ||||| BslFI BsmAI | MnlI MlyI ||||| HaeIII HgaI Esp3I | Csp6I PleI ||||| |BsrI TspGWI | SetI | |RsaI |BsrI HinfI ||||| || Hin4I \ \ \ \ \\ \\ \ \\\\\ \\ \ GACGACTATCAGCGTCTCTACCTCGTCAGCGTACTGGATAGGGACTCGCCGCCGGCCAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGATAGTCGCAGAGATGGAGCAGTCGCATGACCTATCCCTGAGCGGCGGCCGGTCA / / / / / // /// / //// /// / / | HgaI | Esp3I | || ||PleI | |||| ||| | BslFI EcoRII | BsmAI | || |MlyI | |||| ||| CfrI BssKI | Hin4I | || BsrI | |||| ||Cfr10I SetI | |Csp6I | |||| ||HaeIII | RsaI | |||| ||Hin4I MnlI | |||| ||MroNI | |||| ||CviJI | |||| |HpaII | |||| |BsrI | |||| Cac8I | |||| NaeI | |||AciI | ||BisI | |BlsI | TauI HinfI D D Y Q R L Y L V S V L D R D S P P A S T T I S V S T S S A Y W I G T R R R P V R L S A S L P R Q R T G * G L A A G Q F ----:----|----:----|----:----|----:----|----:----|----:----| S S * * R R * R T L T S S L S E G G A L P R S D A D R G R * R V P Y P S A A P W V V I L T E V E D A Y Q I P V R R R G T BsrDI | TseI MlyI | |FokI PleI | |BisI Hin6I MseI | ||BlsI |GlaI SetI | ||MnlI ||HhaI |HpaI | |||Hin6I |||HpaII |HindII | ||||GlaI |||HaeII |Hpy166II | ||||MstI* |||| HinfI SspI || BbvI | |||||HhaI Hpy166II \\\\ \ \ \\ \ \ \\\\\\ \ TTCAGCGCCGGACTCAATATTAGAAAGGTTAACTATAAATCCTCCATTGCTGCGCAGTTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCGCGGCCTGAGTTATAATCTTTCCAATTGATATTTAGGAGGTAACGACGCGTCAAG //// / / / / // / / ///// / |||| | | SspI SetI |MseI | BsrDI ||||| Hpy166II |||| | HinfI Hpy166II BbvI ||||Hin6I |||| HpaII HindII ||||FokI |||Hin6I HpaI |||MstI* ||GlaI |||GlaI ||PleI ||TseI |HhaI ||HhaI |MlyI |BisI HaeII MnlI BlsI F S A G L N I R K V N Y K S S I A A Q F S A P D S I L E R L T I N P P L L R S S Q R R T Q Y * K G * L * I L H C C A V H ----:----|----:----|----:----|----:----|----:----|----:----| K L A P S L I L F T L * L D E M A A C N N * R R V * Y * F P * S Y I R W Q Q A T E A G S E I N S L N V I F G G N S R L E AciI |BisI ||BlsI |||AciI |||TauI AvaI ||||BisI |SduI |||||BlsI |TspRI ||||||TauI |HgiAI* HgaI ||||||Hin6I |BmeT110I |Ksp632I* ||||||MboII BseGI ||Hpy178III* ||MnlI |||||||GlaI TspDTI ||| MwoI |||BslFI ||||||||HhaI \ \\\ \ \\\\ \\\\\\\\\ ACACATCCAAACTTCATTATCAGTGCTCGGGACGCAGGGAACGGGGAAGAGGCGGCGGCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTAGGTTTGAAGTAATAGTCACGAGCCCTGCGTCCCTTGCCCCTTCTCCGCCGCCGC / / / /// / // / ///////// TspDTI | | ||Hpy178III* | || | ||||||||Hin6I BseGI | | ||AvaI | || | |||||||GlaI | | |BmeT110I | || | ||||||HhaI | | MwoI | || | |||||MboII | HgiAI* | || | |||||BisI | SduI | || | |||||AciI TspRI | || | ||||BlsI | || | |||TauI | || | ||BisI | || | ||AciI | || | |BlsI | || | TauI | || BslFI | |HgaI | Ksp632I* MnlI T H P N F I I S A R D A G N G E E A A A H I Q T S L S V L G T Q G T G K R R R R T S K L H Y Q C S G R R E R G R G G G A ----:----|----:----|----:----|----:----|----:----|----:----| V C G F K M I L A R S A P F P S S A A A * V D L S * * * H E P R L S R P L P P P C M W V E N D T S P V C P V P F L R R R AclI MaeII | SetI | TaiI | | Hpy188I | | | XmnI | | | | TaqI | | | | | Csp6I Hpy188I | | | | | |RsaI | CviJI | | | | | || BsrI SetI TspEI | | MaeI \ \ \ \ \ \\ \ \ \ \ \ \ CAGAACGTTCTGAACTGCTTCGAGTACCAGTTTCCCAACCTACAAACAATTCAGAGCCTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTGCAAGACTTGACGAAGCTCATGGTCAAAGGGTTGGATGTTTGTTAAGTCTCGGAT / / / / / // / // / / | | | XmnI | |Csp6I SetI || | MaeI | | Hpy188I | RsaI || CviJI | MaeII | BsrI |Hpy188I | AclI TaqI TspEI TaiI SetI Q N V L N C F E Y Q F P N L Q T I Q S L R T F * T A S S T S F P T Y K Q F R A * E R S E L L R V P V S Q P T N N S E P S ----:----|----:----|----:----|----:----|----:----|----:----| C F T R F Q K S Y W N G L R C V I * L R A S R E S S S R T G T E W G V F L E S G L V N Q V A E L V L K G V * L C N L A * TseI MwoI |BisI ||BlsI |||EciI |||AluI |||CviJI |||| SetI |||| Cac8I |||| | NheI |||| | |MaeI |||| | ||Cac8I |||| | ||| AluI |||| | ||| BmtI |||| | ||| BseRI |||| | ||| CviJI |||| | ||| |BbvI AclI |||| | ||| ||SetI BsgI MaeII |||| | ||| ||MwoI | AciI | SetI |||| | ||| |||AciI | | MnlI Hpy166II | TaiI |||| | ||| |||| EciI | | | CviRI* \ \ \ \\\\ \ \\\ \\\\ \ \ \ \ \ GTCCACGAACAAACGTTGCTATCGCAGCTCGCTAGCTCCGCCACTCCTCACTCCGCCTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGTGCTTGTTTGCAACGATAGCGTCGAGCGATCGAGGCGGTGAGGAGTGAGGCGGAAC / / / / /// / / /// / / / / Hpy166II | MaeII | ||| | | ||| BbvI BsgI MnlI CviRI* | AclI | ||| | | ||| AciI AciI TaiI | ||| | | ||| EciI SetI | ||| | | ||CviJI | ||| | | ||NheI | ||| | | ||AluI | ||| | | |MwoI | ||| | | |MaeI | ||| | | Cac8I | ||| | | BseRI | ||| | | SetI | ||| | BmtI | ||| Cac8I | ||CviJI | ||TseI | ||AluI | |BisI | BlsI | SetI | EciI MwoI V H E Q T L L S Q L A S S A T P H S A L S T N K R C Y R S S L A P P L L T P P C P R T N V A I A A R * L R H S S L R L A ----:----|----:----|----:----|----:----|----:----|----:----| T W S C V N S D C S A L E A V G * E A K L G R V F T A I A A R * S R W E E S R R D V F L R Q * R L E S A G G S R V G G Q SetI |BssKI || HpaII MboI || ScrFI CviRI* BccI | DpnI || CauII* | SfaNI SspI Hpy188I | |BstKTI || | Hin4II* \ \ \ \ \ \\ \\ \ \ CATCTGCACGATAAAAATATTCTGATGGGTAAGATCATACTACCTTCCCGGTCTAACAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGACGTGCTATTTTTATAAGACTACCCATTCTAGTATGATGGAAGGGCCAGATTGTTT / / // / // / / //// CviRI* | || Hpy188I || MboI SetI |||Hin4II* | |BccI |DpnI ||BssKI | SspI BstKTI |HpaII SfaNI CauII* ScrFI H L H D K N I L M G K I I L P S R S N K I C T I K I F * W V R S Y Y L P G L T K S A R * K Y S D G * D H T T F P V * Q N ----:----|----:----|----:----|----:----|----:----|----:----| C R C S L F I R I P L I M S G E R D L L A D A R Y F Y E S P Y S * V V K G T * C M Q V I F I N Q H T L D Y * R G P R V F BsrI Hin4II* | HphI SfaNI | TaqII | |DdeI BspCNI | | BtgZI HindII | || BsmAI |BseMII | | | CviJI Hpy166II FnuDII* \ \\ \ \\ \ \ \ \ \ \ ACACCAGTCTCAGCATCACCCACCAAGCAAGAAAAGAAGGCTCTGTCAACAGCATCGCGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTCAGAGTCGTAGTGGGTGGTTCGTTCTTTTCTTCCGAGACAGTTGTCGTAGCGCA / / / / // / / / / / / / BsrI HphI | | || | | TaqII | | Hpy166II FnuDII* | | || | Hin4II* | | HindII | | || SfaNI | BtgZI | | |BseMII CviJI | | BspCNI | BsmAI DdeI T P V S A S P T K Q E K K A L S T A S R H Q S Q H H P P S K K R R L C Q Q H R V T S L S I T H Q A R K E G S V N S I A * ----:----|----:----|----:----|----:----|----:----|----:----| V G T E A D G V L C S F F A R D V A D R F V L R L M V W W A L F S P E T L L M A C W D * C * G G L L F L L S Q * C C R T MnlI Hin4I Hin4I | MnlI Hin4I AsuI* SfaNI Hin4I | | TfiI HindII AvaII | BseRI |SetI | | HinfI Hpy166II |BmgT120I \ \ \\ \ \ \ \ \\ GAAAATGCCACCTCCTCGCTGACAAAGAATCAGCAGTTCAAGTTGACCAAAATGGACCAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACGGTGGAGGAGCGACTGTTTCTTAGTCGTCAAGTTCAACTGGTTTTACCTGGTA / / / / / / / / / // | | | SetI | MnlI HinfI | Hpy166II |AvaII | | Hin4I MnlI TfiI | HindII |AsuI* | | Hin4I Hin4I BmgT120I | SfaNI Hin4I BseRI E N A T S S L T K N Q Q F K L T K M D H K M P P P R * Q R I S S S S * P K W T I K C H L L A D K E S A V Q V D Q N G P * ----:----|----:----|----:----|----:----|----:----|----:----| S F A V E E S V F F * C N L N V L I S W H F H W R R A S L S D A T * T S W F P G F I G G G R Q C L I L L E L Q G F H V M MlyI PleI EcoP15I | FatI | MboI | |CviAII | BclI | || HinfI | Hpy188I AluI | || NlaIII | | DpnI CviJI | || | HpaII | | |BstKTI | SetI | || | |TspDTI \ \ \\ \ \ \ \\ \ \\ AATCTGATCAATGACAAGCTCATCAACCCTAACAACTGCGTAATATGGTCGCATGACTCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGACTAGTTACTGTTCGAGTAGTTGGGATTGTTGACGCATTATACCAGCGTACTGAGG // // / / / /// // / || || BclI | CviJI ||| || TspDTI || || MboI | AluI ||| || HinfI || |DpnI SetI ||| |FatI || BstKTI ||| CviAII |Hpy188I ||NlaIII EcoP15I |PleI MlyI N L I N D K L I N P N N C V I W S H D S I * S M T S S S T L T T A * Y G R M T P S D Q * Q A H Q P * Q L R N M V A * L R ----:----|----:----|----:----|----:----|----:----|----:----| L R I L S L S M L G L L Q T I H D C S E Y D S * H C A * * G * C S R L I T A H S I Q D I V L E D V R V V A Y Y P R M V G AciI FatI |BisI BspHI ||BlsI |CviAII ||SfaNI Hpy178III* FokI |Hpy178III* |||TauI | Hin4II* | CviJI CviJI || NlaIII |||CviJI | | BseGI | | PsiI \ \\ \ \\\\ \ \ \ \ \ \ GGCTATGTGTTCATGACGGGCATCTGGCGGCTGTATCAGGATGTTATGAAGGGGCTTATA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATACACAAGTACTGCCCGTAGACCGCCGACATAGTCCTACAATACTTCCCCGAATAT // / // //// / / / / / / // |CviJI | |BspHI |||| SfaNI | | BseGI | | |TspDTI HpaII | |FatI |||CviJI | Hin4II* | | PsiI | Hpy178III* ||BisI Hpy178III* | FokI | CviAII ||AciI CviJI NlaIII |BlsI TauI G Y V F M T G I W R L Y Q D V M K G L I A M C S * R A S G G C I R M L * R G L * L C V H D G H L A A V S G C Y E G A Y K ----:----|----:----|----:----|----:----|----:----|----:----| P * T N M V P M Q R S Y * S T I F P S I R S H T * S P C R A A T D P H * S P A * A I H E H R A D P P Q I L I N H L P K Y TsoI | CviRI* | | CviJI MaeIII HphI | | | ApoI TspDTI Tsp45I | MaeI | | | TspEI | MnlI | SetI | | CviJI | | | EcoRI \ \ \ \ \ \ \ \ \ \ \ AACTTGCCCAGAGGTGACAGCGTTTCCACTAGCCAACAGCAGTTCTTTTGCAAGGCTGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACGGGTCTCCACTGTCGCAAAGGTGATCGGTTGTCGTCAAGAAAACGTTCCGACTT / / / / // / / / MnlI SetI | HphI |CviJI TsoI | CviJI Tsp45I MaeI CviRI* MaeIII N L P R G D S V S T S Q Q Q F F C K A E T C P E V T A F P L A N S S S F A R L N L A Q R * Q R F H * P T A V L L Q G * I ----:----|----:----|----:----|----:----|----:----|----:----| F K G L P S L T E V L W C C N K Q L A S L S A W L H C R K W * G V A T R K C P Q V Q G S T V A N G S A L L L E K A L S F Tsp4CI* | BseMII | |BspCNI | || Hpy166II TaqI | || | DdeI |Hpy178III* | || | MboII || EcoP15I | || | |Hpy188I || |ApoI | || | || TfiI || |TspEI | || |MnlI || HinfI \\ \\ \ \\ \\ \\ \ TTCGAGAAAATTCTATCTTTTTGCTTTTACAATCACAGTTCGTTCACTTCTGAGGAATCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTCTTTTAAGATAGAAAAACGAAAATGTTAGTGTCAAGCAAGTGAAGACTCCTTAGA / // / / / // / // / / | || | TspEI | || | || DdeI HinfI | || | ApoI | || | |Hpy188I TfiI | || EcoP15I | || | MboII | |Hpy178III* | || Hpy166II | TaqI | || MnlI EcoRI | |BspCNI TspEI | BseMII ApoI Tsp4CI* F E K I L S F C F Y N H S S F T S E E S S R K F Y L F A F T I T V R S L L R N L R E N S I F L L L Q S Q F V H F * G I F ----:----|----:----|----:----|----:----|----:----|----:----| N S F I R D K Q K * L * L E N V E S S D I R S F E I K K S K C D C N T * K Q P I E L F N * R K A K V I V T R E S R L F R SetI | MnlI | | Ksp632I* | | |AciI | | |BisI | | ||BlsI | | |||FokI | | |||TauI Csp6I | | |||MnlI |RsaI | | |||Esp3I || Tsp4CI* MboII | | |||BsmAI BseGI TspGWI \\ \ \ \ \ \\\\ \ \ TCAAGCGTACTGTTGTCGTCCTCCACCTCTTCGCCGCCAAAGAGACGGACATCCACAGGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCGCATGACAACAGCAGGAGGTGGAGAAGCGGCGGTTTCTCTGCCTGTAGGTGTCCC /// / / / //// / / / ||Tsp4CI* | SetI | |||| BsmAI BseGI TspGWI |Csp6I MboII | |||| Esp3I RsaI | |||| FokI | |||Ksp632I* | |||AciI | ||MnlI | ||BisI | |BlsI | TauI MnlI S S V L L S S S T S S P P K R R T S T G Q A Y C C R P P P L R R Q R D G H P Q G K R T V V V L H L F A A K E T D I H R V ----:----|----:----|----:----|----:----|----:----|----:----| E L T S N D D E V E E G G F L R V D V P K L R V T T T R W R K A A L S V S M W L * A Y Q Q R G G G R R R W L S P C G C P AccI |Hpy166II || SetI || | HgaI || | | AcyI || | | |Hin4II* || | | || MboII || | | || BbvII* || | | || | MboII || | | || | TspDTI || | | || | | HgaI MboII Cac8I TspEI \\ \ \ \\ \ \ \ \ \ \ TCTACCTTCTTGGACGCCAATGCGTCTTCTTCATCTACTTCTTCAACGCAGGCAAACAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGAAGAACCTGCGGTTACGCAGAAGAAGTAGATGAAGAAGTTGCGTCCGTTTGTTA // / / // / / / / / |AccI | | || | | MboII Cac8I TspDTI |SetI | | || | HgaI Hpy166II | | || BbvII* | | |MboII | | TspDTI | MboII | AcyI | HgaI Hin4II* S T F L D A N A S S S S T S S T Q A N N L P S W T P M R L L H L L L Q R R Q T I Y L L G R Q C V F F I Y F F N A G K Q L ----:----|----:----|----:----|----:----|----:----|----:----| D V K K S A L A D E E D V E E V C A F L T * R R P R W H T K K M * K K L A P L C R G E Q V G I R R R * R S R * R L C V I CviJI | FauI | | MwoI | | | BsiYI* | | | |AciI | | | || AsuI* | | | || AvaII | | | || DraII | | | || PpuMI TspDTI | | | || |NlaIV | TaqI | | | || |BmgT120I BsrI | ClaI | | | || || SetI |BslFI \ \ \ \ \ \\ \\ \ \\ TACATCGATTTTCATTGGAACAACATCAAGCCCGAACTGCGGGACCTTATTTGCCAGTCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAGCTAAAAGTAACCTTGTTGTAGTTCGGGCTTGACGCCCTGGAATAAACGGTCAGA / / / /// / /// / / TspEI ClaI | ||| | ||PpuMI BsrI BslFI TaqI | ||| | ||DraII | ||| | ||AvaII | ||| | ||AsuI* | ||| | |BmgT120I | ||| | NlaIV | ||| | SetI | ||| AciI | ||BsiYI* | |FauI | MwoI CviJI Y I D F H W N N I K P E L R D L I C Q S T S I F I G T T S S P N C G T L F A S L H R F S L E Q H Q A R T A G P Y L P V L ----:----|----:----|----:----|----:----|----:----|----:----| * M S K * Q F L M L G S S R S R I Q W D N C R N E N S C C * A R V A P G * K G T V D I K M P V V D L G F Q P V K N A L R Hpy178III* AsuI* | MboI AvaII | BclI |BmgT120I | | DpnI || Hpy178III* | | |BstKTI || | TspDTI MseI \ \ \\ \\ \ \ \ TACAAAGACTTCCTGATCAATGAACTTGGTCCTGACCAAATAGACTTGCCCAACTTAAAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTCTGAAGGACTAGTTACTTGAACCAGGACTGGTTTATCTGAACGGGTTGAATTTA /// / // / / ||| BclI || Hpy178III* MseI ||| MboI || TspDTI ||DpnI |AvaII |BstKTI |AsuI* Hpy178III* BmgT120I Y K D F L I N E L G P D Q I D L P N L N T K T S * S M N L V L T K * T C P T * I Q R L P D Q * T W S * P N R L A Q L K S ----:----|----:----|----:----|----:----|----:----|----:----| * L S K R I L S S P G S W I S K G L K F K C L S G S * H V Q D Q G F L S A W S L V F V E Q D I F K T R V L Y V Q G V * I HpaII | ApoI MnlI SetI ApoI Csp6I BccI | TspEI |TsoI |MaeIII TspEI |RsaI Bce83I* \ \ \\ \\ \ \\ \ CCGGCAAATTTTACGAAAAGAATAAGAGGTGGTTACATCAAAATTCAGGGTACTTGGTTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCGTTTAAAATGCTTTTCTTATTCTCCACCAATGTAGTTTTAAGTCCCATGAACCAAC / / / / / / // / / HpaII TspEI MnlI SetI MaeIII TspEI || | BccI ApoI TsoI ApoI || Bce83I* |Csp6I RsaI P A N F T K R I R G G Y I K I Q G T W L R Q I L R K E * E V V T S K F R V L G C G K F Y E K N K R W L H Q N S G Y L V A ----:----|----:----|----:----|----:----|----:----|----:----| G A F K V F L I L P P * M L I * P V Q N D P L N * S F F L L H N C * F E P Y K T R C I K R F S Y S T T V D F N L T S P Q MboI Hpy188I MwoI | DpnI BsaBI |Cac8I | |BstKTI | SmlI SetI || AciI | || Hpy188I HgiCI* \ \ \ \\ \ \ \\ \ \ CCGATGGAAATCTCAAGGTTGCTATGCCTGCGGTTTTGTTTTCCGATCAGATACTTTCTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTACCTTTAGAGTTCCAACGATACGGACGCCAAAACAAAAGGCTAGTCTATGAAAGAC / // / / / / // / BsaBI |SmlI | | AciI | || Hpy188I SetI | Cac8I | || MboI MwoI | |DpnI | BstKTI Hpy188I P M E I S R L L C L R F C F P I R Y F L R W K S Q G C Y A C G F V F R S D T F W D G N L K V A M P A V L F S D Q I L S G ----:----|----:----|----:----|----:----|----:----|----:----| G I S I E L N S H R R N Q K G I L Y K R A S P F R L T A I G A T K N E S * I S E R H F D * P Q * A Q P K T K R D S V K Q BsiYI* | AsuI* | AvaII | |BmgT120I | || Hpy178III* CviJI | || | Hin4I TfiI | Hin4I NlaIV | || | Hin4I HinfI | Hin4I \ \ \\ \ \ \ \ \ GTGCCTATTTTTGGTCCAGATTTCCCCAAAGATTGCGAATCGTGGTATTTGGCTCATCAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGATAAAAACCAGGTCTAAAGGGGTTTCTAACGCTTAGCACCATAAACCGAGTAGTT / / / //// / / / | | BsiYI* |||Hpy178III* HinfI | CviJI | HgiCI* ||Hin4I TfiI Hin4I NlaIV ||Hin4I Hin4I |AvaII |AsuI* BmgT120I V P I F G P D F P K D C E S W Y L A H Q C L F L V Q I S P K I A N R G I W L I K A Y F W S R F P Q R L R I V V F G S S K ----:----|----:----|----:----|----:----|----:----|----:----| T G I K P G S K G L S Q S D H Y K A * * P A * K Q D L N G W L N R I T T N P E D H R N K T W I E G F I A F R P I Q S M L MaeI | EcoP15I | | AarI | | BspMI | | | BbvI | | | |EcoP15I | | | || EcoP15I | | | || | BsrI | | | || | TspRI | | | || | |CviRI* | | | || | || BbvI | | | || | || | SetI | | | || | || | |TseI | | | || | || | |MwoI | | | || | || | |AlwNI | | | || | || | |BstAPI | | | || | || | ||BisI | | | || | || | |||BlsI | | | || | || | |||| BbvI | | | || | || | |||| |MwoI | | | || | || | |||| || BbvI | | | || | || | |||| || |TseI | | | || | || | |||| || |MwoI | | | || | || | |||| || ||BisI | | | || | || | |||| || |||BlsI | | | || | || | |||| || |||| BsgI | | | || | || | |||| || |||| | MwoI | | | || | || | |||| || |||| | | TseI | | | || | || | |||| || |||| | | MwoI AclI | | | || | || | |||| || |||| | | |BisI MaeII | | | || | || | |||| || |||| | | ||BlsI |MaeIII | | | || | || | |||| || |||| | | |||TseI || SetI | | | || | || | |||| || |||| | | ||||BisI || TaiI | | | || | || | |||| || |||| | | |||||BlsI \\ \ \ \ \ \\ \ \\ \ \\\\ \\ \\\\ \ \ \\\\\\ AACGTTACATTTGCTAGTTCTACCACTGGTGCAGGTGCTGCTACTGCTGCTACTGCTGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCAATGTAAACGATCAAGATGGTGACCACGTCCACGACGATGACGACGATGACGACGA / / / / / / /// /// / //// / //// / ///// | | MaeIII | | | ||| ||| | |||| | |||| | ||||BisI | MaeII | | | ||| ||| | |||| | |||| | |||BlsI | AclI | | | ||| ||| | |||| | |||| | ||TseI TaiI | | | ||| ||| | |||| | |||| | |BisI SetI | | | ||| ||| | |||| | |||| | BlsI | | | ||| ||| | |||| | |||| MwoI | | | ||| ||| | |||| | |||MwoI | | | ||| ||| | |||| | |||TseI | | | ||| ||| | |||| | |||BbvI | | | ||| ||| | |||| | ||BsgI | | | ||| ||| | |||| | ||BisI | | | ||| ||| | |||| | |BlsI | | | ||| ||| | |||| | BbvI | | | ||| ||| | |||| MwoI | | | ||| ||| | |||MwoI | | | ||| ||| | |||TseI | | | ||| ||| | ||BisI | | | ||| ||| | |BlsI | | | ||| ||| | BbvI | | | ||| ||| BstAPI | | | ||| ||| AlwNI | | | ||| ||| MwoI | | | ||| ||SetI | | | ||| |CviRI* | | | ||| EcoP15I | | | ||BsrI | | | ||BbvI | | | |EcoP15I | | | BspMI | | | AarI | | TspRI | EcoP15I MaeI N V T F A S S T T G A G A A T A A T A A T L H L L V L P L V Q V L L L L L L L L R Y I C * F Y H W C R C C Y C C Y C C C ----:----|----:----|----:----|----:----|----:----|----:----| F T V N A L E V V P A P A A V A A V A A F R * M Q * N * W Q H L H Q * Q Q * Q Q V N C K S T R G S T C T S S S S S S S S MaeII | AccI BtsI | SetI TspRI | TaiI | StyI | |Hpy166II | AvrII Csp6I | || SfeI* | SecI* |RsaI | || | CviRI* | |MaeI || TspEI | || | | PstI | ||SetI CviJI \\ \ \ \\ \ \ \ \ \\\ \ GCTAATACAAGTACCAATTTTACGTCTACTGCAGTGGCAAGACCTAGGCAGAAGCCCAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTATGTTCATGGTTAAAATGCAGATGACGTCACCGTTCTGGATCCGTCTTCGGGTCT / // / / / // / / / / / // / / TseI |Csp6I | | | || | | | BtsI SetI |SecI* | BsiYI* RsaI | | | || | | SfeI* |AvrII CviJI | | | || | CviRI* |StyI | | | || TspRI MaeI | | | || PstI | | | |AccI | | | Hpy166II | | MaeII | TaiI | SetI TspEI A N T S T N F T S T A V A R P R Q K P R L I Q V P I L R L L Q W Q D L G R S P D * Y K Y Q F Y V Y C S G K T * A E A Q T ----:----|----:----|----:----|----:----|----:----|----:----| A L V L V L K V D V A T A L G L C F G L Q * Y L Y W N * T * Q L P L V * A S A W S I C T G I K R R S C H C S R P L L G S BssKI SecI* EcoRII |BsiYI* ||ScrFI BslFI ||BseBI |MboI ||| FalI |BglII ||| FalI |XhoII FatI Hin6I ||| CviJI || DpnI |CviAII FalI |GlaI ||| HaeIII || |BstKTI || NlaIII FalI ||HhaI MnlI \\\ \ \\ \\ \\ \ \ \\\ \ CCCAGGCCAAGACAAAGATCTACTTCCATGTCCCATTCCAAAGCGCAGAAACTTGTTATT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTCCGGTTCTGTTTCTAGATGAAGGTACAGGGTAAGGTTTCGCGTCTTTGAACAATAA / /// //// / // / /// / | ||EcoRII |||XhoII | || FalI ||Hin6I MnlI | ||HaeIII |||BglII | || FalI |GlaI | ||BssKI |||MboI | |FatI HhaI | ||CviJI ||BslFI | CviAII | |SecI* |DpnI NlaIII | BseBI BstKTI | ScrFI FalI FalI P R P R Q R S T S M S H S K A Q K L V I P G Q D K D L L P C P I P K R R N L L L Q A K T K I Y F H V P F Q S A E T C Y * ----:----|----:----|----:----|----:----|----:----|----:----| G L G L C L D V E M D W E L A C F S T I V W A L V F I * K W T G N W L A S V Q * G P W S L S R S G H G M G F R L F K N N HgaI | MlyI | PleI AsuI* | | TaqI |BmgT120I | | | HinfI ||CviJI TspDTI AcyI | | | | MnlI ||HaeIII | MnlI \ \ \ \ \ \ \\\ \ \ GAGGACGCCTTGCCCTCATTCGACTCATTTGTAGAAAACTTGGGCCTTTCCTCAAATGAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTGCGGAACGGGAGTAAGCTGAGTAAACATCTTTTGAACCCGGAAAGGAGTTTACTG / /// // / // / / AcyI ||| || HinfI |AsuI* | MnlI ||| |MnlI BmgT120I TspDTI ||| TaqI HaeIII ||HgaI CviJI |PleI MlyI E D A L P S F D S F V E N L G L S S N D R T P C P H S T H L * K T W A F P Q M T G R L A L I R L I C R K L G P F L K * Q ----:----|----:----|----:----|----:----|----:----|----:----| S S A K G E N S E N T S F K P R E E F S Q P R R A R M R S M Q L F S P G K R L H L V G Q G * E V * K Y F V Q A K G * I V Hpy166II | BsaXI | | SetI MseI | | |MboII MnlI \ \ \ \\ \ AAGAACTTCATTAAAAAAAACAGCAAAAGGCAAAAGTCGTCCACATACACCTCTCAAACT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTGAAGTAATTTTTTTTGTCGTTTTCCGTTTTCAGCAGGTGTATGTGGAGAGTTTGA / / / / / / MseI | | | MboII MnlI | | SetI | BsaXI Hpy166II K N F I K K N S K R Q K S S T Y T S Q T R T S L K K T A K G K S R P H T P L K L E L H * K K Q Q K A K V V H I H L S N F ----:----|----:----|----:----|----:----|----:----|----:----| L F K M L F F L L L C F D D V Y V E * V C S S * * F F C C F A F T T W M C R E F L V E N F F V A F P L L R G C V G R L S AsuI* |BmgT120I ||CviJI ||HaeIII |||BinI* |||| BsaXI |||| | MboI |||| | XhoII |||| | | DpnI |||| | | |BstKTI |||| | | || Tsp4CI* |||| | | || | CviRI* MaeI |||| | | || | | ApoI MmeI |||| | | || | | TspEI |SetI |||| | | || | | | FokI || BseGI \\\\ \ \ \\ \ \ \ \ \\ \ TCTTCTCCAATAGGGCCAAGAGATCCAACGGTGCAAATTTTGTCAAACCTAGCATCCTTC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGAGGTTATCCCGGTTCTCTAGGTTGCCACGTTTAAAACAGTTTGGATCGTAGGAAG /// // / / / / / // // ||| || | | | | | || |MaeI ||| || | | | | | || BseGI ||| || | | | | | |MmeI ||| || | | | | | SetI ||| || | | | | FokI ||| || | | | TspEI ||| || | | | ApoI ||| || | | CviRI* ||| || | Tsp4CI* ||| || XhoII ||| || MboI ||| |DpnI ||| BstKTI ||BinI* |AsuI* BmgT120I HaeIII BsaXI CviJI S S P I G P R D P T V Q I L S N L A S F L L Q * G Q E I Q R C K F C Q T * H P S F S N R A K R S N G A N F V K P S I L L ----:----|----:----|----:----|----:----|----:----|----:----| E E G I P G L S G V T C I K D F R A D K K K E L L A L L D L P A F K T L G L M R R R W Y P W S I W R H L N Q * V * C G E SfaNI | Hin4II* | |HphI | || SecI* | || DsaI* | || | MaeIII | || | Tsp45I | || | BstEII | || | Tsp4CI* | || | |TspDTI | || | || AgeI PfoI | || | || BetI* BssKI | || | || Cfr10I |HpaII | || | || |HpaII ||ScrFI FalI | || | || || TaqII ||CauII* FalI \ \\ \ \\ \\ \ \\\ \ TACAACACCCACGGTCACCGGTATTCATATCCGGGAAATATCTATATACCACAGCAAAGA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTGTGGGTGCCAGTGGCCATAAGTATAGGCCCTTTATAGATATATGGTGTCGTTTCT // // / // / / / |HphI || | |Cfr10I | BssKI FalI | || | |BetI* | PfoI FalI | || | |AgeI CauII* | || | TaqII HpaII | || | HpaII ScrFI | || BstEII | || Tsp45I | || MaeIII | |DsaI* | |SecI* | Tsp4CI* | TspDTI Hin4II* SfaNI Y N T H G H R Y S Y P G N I Y I P Q Q R T T P T V T G I H I R E I S I Y H S K D Q H P R S P V F I S G K Y L Y T T A K I ----:----|----:----|----:----|----:----|----:----|----:----| * L V W P * R Y E Y G P F I * I G C C L R C C G R D G T N M D P F Y R Y V V A F V V G V T V P I * I R S I D I Y W L L S FalI FalI | AluI | CviJI | | SetI | | | MwoI | | | | Hpy99I | | | | | AciI | | | | | BglI | | | | | MwoI | | | | | NspBII* | | | | | |BisI | | | | | ||BlsI | | | | | |||TseI | | | | | |||TauI | | | | | ||||BisI | | | | | |||||BlsI | | | | | ||||||AluI | | | | | ||||||CviJI | | | | | ||||||| SetI BbvI \ \ \ \ \ \\\\\\\ \ \ TACTCTTTACCCCCACCAAACCAGCTCTCGTCGCCACAGCGGCAGCTAAACTATACTTAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGAAATGGGGGTGGTTTGGTCGAGAGCAGCGGTGTCGCCGTCGATTTGATATGAATG / / / // / /// /// / / FalI | | |Hpy99I | ||| ||CviJI | HphI FalI | | MwoI | ||| ||TseI BbvI | CviJI | ||| ||AluI | AluI | ||| |BisI SetI | ||| BlsI | ||| SetI | ||BisI | ||AciI | |BlsI | NspBII* | TauI MwoI BglI Y S L P P P N Q L S S P Q R Q L N Y T Y T L Y P H Q T S S R R H S G S * T I L T L F T P T K P A L V A T A A A K L Y L R ----:----|----:----|----:----|----:----|----:----|----:----| Y E K G G G F W S E D G C R C S F * V * I S K V G V L G A R T A V A A A L S Y K V R * G W W V L E R R W L P L * V I S V DdeI | TaqII | |Csp6I | ||RsaI | |||Hin4II* MboII | |||| BspCNI MaeII | |||| |BslFI | HphI | |||| |BseMII | SetI HphI BfiI BsrI | ||||BsrI ||BsmAI | TaiI \ \ \ \ \\\\\ \\\ \ \ GACCACATTCACCCAGTTCCTTCTCAGTACCAGTCTCCAAGACACTACAACGTCCCCTCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTGTAAGTGGGTCAAGGAAGAGTCATGGTCAGAGGTTCTGTGATGTTGCAGGGGAGA / / / / // // // / / BfiI BsrI | | || || |BsmAI | MaeII | | || || BslFI | HphI | | || |BseMII MboII | | || BspCNI TaiI | | |Csp6I SetI | | Hin4II* | | RsaI | | BsrI | DdeI TaqII D H I H P V P S Q Y Q S P R H Y N V P S T T F T Q F L L S T S L Q D T T T S P L P H S P S S F S V P V S K T L Q R P L F ----:----|----:----|----:----|----:----|----:----|----:----| S W M * G T G E * Y W D G L C * L T G E R G C E G L E K E T G T E L V S C R G R V V N V W N R R L V L R W S V V V D G R Ksp632I* | MnlI | | BseRI MboI | | | Hin6I BclI | | | FnuDII* BdaI | DpnI | | | |GlaI BdaI | |BstKTI | | | ||HhaI | SetI | || BsaBI | | | ||| Cac8I MnlI | | MnlI | || | HphI \ \ \ \\\ \ \ \ \ \ \ \\ \ \ TCACCAATCGCGCCTGCTCCTCCCACTTTCCCTCAACCTTATGGTGATGATCACTATCAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGTTAGCGCGGACGAGGAGGGTGAAAGGGAGTTGGAATACCACTACTAGTGATAGTA // /// / / / / // /// || ||| Cac8I MnlI SetI MnlI || ||HphI || ||Hin6I BdaI || |BsaBI || |GlaI BdaI || BclI || FnuDII* || MboI || HhaI |DpnI |Ksp632I* BstKTI |BseRI MnlI S P I A P A P P T F P Q P Y G D D H Y H H Q S R L L L P L S L N L M V M I T I I T N R A C S S H F P S T L W * * S L S F ----:----|----:----|----:----|----:----|----:----|----:----| E G I A G A G G V K G * G * P S S * * * K V L R A Q E E W K G E V K H H H D S D * W D R R S R G S E R L R I T I I V I M BdaI BdaI | NheI | |MaeI AluI | ||Cac8I CviJI | ||| BmtI PsiI | SetI \ \\\ \ \ \ \ TTTTTGAAATATGCTAGCGAAGTTTATAAGCAACAAAACCAACGACCAGCTCATAATACA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACTTTATACGATCGCTTCAAATATTCGTTGTTTTGGTTGCTGGTCGAGTATTATGT / / /// / / / | | ||NheI PsiI | CviJI | | |MaeI | AluI | | Cac8I SetI | BmtI BdaI BdaI F L K Y A S E V Y K Q Q N Q R P A H N T F * N M L A K F I S N K T N D Q L I I Q F E I C * R S L * A T K P T T S S * Y K ----:----|----:----|----:----|----:----|----:----|----:----| K K F Y A L S T * L C C F W R G A * L V N K S I H * R L K Y A V F G V V L E Y Y K Q F I S A F N I L L L V L S W S M I C MnlI BdaI TspRI |StyI BdaI |TspEI ApoI SetI |SecI* | TspEI ||XmnI TspEI \ \\ \ \ \\\ \ AATACCAATATGGACACCTCTTTTTCGCCAAGGGCGAACAATTCACTGAACAATTTCAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGGTTATACCTGTGGAGAAAAAGCGGTTCCCGCTTGTTAAGTGACTTGTTAAAGTTT / / / / / / / / SetI MnlI | BdaI | TspEI | TspEI | BdaI TspRI XmnI SecI* StyI N T N M D T S F S P R A N N S L N N F K I P I W T P L F R Q G R T I H * T I S N Y Q Y G H L F F A K G E Q F T E Q F Q I ----:----|----:----|----:----|----:----|----:----|----:----| F V L I S V E K E G L A F L E S F L K L L Y W Y P C R K K A L P S C N V S C N * I G I H V G R K R W P R V I * Q V I E F MseI |AhaIII* || BdaI || BdaI \\ \ TTTAAAACAAACTCAAAACAATAA 1930 1940 ----:----|----:----|---- AAATTTTGTTTGAGTTTTGTTATT /// / ||| BdaI ||| BdaI ||MseI |AhaIII* TspEI ApoI F K T N S K Q * L K Q T Q N N X * N K L K T I X ----:----|----:----|---- N L V F E F C Y I * F L S L V I K F C V * F L L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 2 FblI,XmiI AciI 11 BspACI,SsiI AclI 3 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 6 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BclI 3 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmeT110I 1 BmgT120I 6 BmtI 2 BspOI BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BseRI 3 BsgI 2 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 7 BtgZI 1 BtsI 1 Cac8I 7 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CviAII 3 CviJI 20 CviKI-1 CviRI* 6 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 7 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 2 EcoP15I 5 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI Esp3I 2 BsmBI FalI 4 FatI 3 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 5 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 6 HpyAV Hin6I 5 HinP1I,HspAI HindII 3 HincII HinfI 7 HpaI 1 KspAI HpaII 7 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 7 Hpy99I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 5 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MlyI 4 SchI MmeI 1 MnlI 19 MroNI 1 NgoMIV MseI 6 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 12 HpyF10VI,BstMWI NaeI 1 PdiI NheI 2 AsuNHI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PfoI 1 PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PsiI 2 AanI PstI 1 RsaI 7 AfaI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 28 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 4 TaqII 3 TauI 6 TfiI 3 PfeI TseI 7 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 5 TscAI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AflII AflIII AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII BaeI BalI BamHI BarI BbvCI BceAI BcgI BciVI BplI Bpu10I BsaAI BsePI BseSI BseYI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BsrBI BssNAI Bst1107I BstXI BstZ17I BtrI Cfr9I CspCI DinI DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRV EcoT22I EgeI EheI EspI* FseI FspAI GsaI GsuI HgiJII* HindIII KasI KpnI MauBI McrI* MfeI MluI Mph1103I MslI NarI NcoI NdeI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769