Restriction Map of YIL071W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YIL071W-A on chromosome IX from coordinates 228550 to 229026.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.17522

MaeIII Tsp45I | MaeII FatI | TspDTI |CviAII | |MaeIII || NlaIII | || SetI || | FatI | || TaiI || | |CviAII \ \\ \ \\ \ \\ ATGAATAATAAAGTGACGTTACTTCCCCCCAGAGTTTTTTTCTGCCTGTCATGGTCTGTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATTATTTCACTGCAATGAAGGGGGGTCTCAAAAAAAGACGGACAGTACCAGACAG // // / / // / || || MaeIII | |FatI NlaIII || |MaeII | CviAII || Tsp45I NlaIII || MaeIII |TaiI |SetI TspDTI M N N K V T L L P P R V F F C L S W S V * I I K * R Y F P P E F F S A C H G L S E * * S D V T S P Q S F F L P V M V C H ----:----|----:----|----:----|----:----|----:----|----:----| X F L L T V N S G G L T K K Q R D H D T X S Y Y L S T V E G W L K K R G T M T Q H I I F H R * K G G S N K E A Q * P R D NlaIII | SspI | | Hin4II* | | |MboI | | || DpnI | | || |TaqI | | || |HphI XbaI | | || |BstKTI |MaeI | | || ||Ksp632I* |Hpy178III* | | || ||| TspGWI || MboI | | || ||| | MboI || BclI | | || ||| | | DpnI || | DpnI | | || ||| | | |BstKTI || | |BstKTI | | || ||| | | || MboII || | || BsmI \ \ \\ \\\ \ \ \\ \ \\ \ \\ \ ATGGTGAATATTGATCGAAGGAAGAGTGATCGCTCCGTAAATCTAGATGATCAGCATTCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TACCACTTATAACTAGCTTCCTTCTCACTAGCGAGGCATTTAGATCTACTAGTCGTAAGT // // // // / / // // // // / |FatI || || || | | || |MboII || || BclI CviAII || || || | | || MboI || || MboI || || || | | |DpnI || || BsmI || || || | | BstKTI || |DpnI || || || | TspGWI || BstKTI || || || Ksp632I* |XbaI || || |TaqI Hpy178III* || || MboI MaeI || |HphI || |DpnI || BstKTI |Hin4II* SspI M V N I D R R K S D R S V N L D D Q H S W * I L I E G R V I A P * I * M I S I Q G E Y * S K E E * S L R K S R * S A F K ----:----|----:----|----:----|----:----|----:----|----:----| M T F I S R L F L S R E T F R S S * C E * P S Y Q D F S S H D S R L D L H D A N H H I N I S P L T I A G Y I * I I L M * Hpy188I TspDTI |TfiI | MseI |HinfI | |HpaI ||MnlI | |HindII SetI ||| MnlI | |Hpy166II \ \\\ \ \ \\ AACAAACCTCCCTCTGAATCACTAATATCACTTCTATCGTTAACTTCATCTATGTCCATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTTGGAGGGAGACTTAGTGATTATAGTGAAGATAGCAATTGAAGTAGATACAGGTAT / / / // / // / SetI | | |MnlI TspDTI |MseI TspDTI | | HinfI Hpy166II | | TfiI HindII | MnlI HpaI Hpy188I N K P P S E S L I S L L S L T S S M S I T N L P L N H * Y H F Y R * L H L C P Y Q T S L * I T N I T S I V N F I Y V H I ----:----|----:----|----:----|----:----|----:----|----:----| F L G G E S D S I D S R D N V E D I D M L C V E R Q I V L I V E I T L K M * T W V F R G R F * * Y * K * R * S * R H G Y TspDTI MaeIII Tsp45I | BtsI TspRI AciI \ \ \ \ TCGTCACTGCTTTCATTATTGATAATAGTCGCTGTATTGTTTCCACCGCTATACATTAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAGTGACGAAAGTAATAACTATTATCAGCGACATAACAAAGGTGGCGATATGTAATCA / / / | Tsp45I AciI | MaeIII TspRI BtsI S S L L S L L I I V A V L F P P L Y I S R H C F H Y * * * S L Y C F H R Y T L V V T A F I I D N S R C I V S T A I H * W ----:----|----:----|----:----|----:----|----:----|----:----| D D S S E N N I I T A T N N G G S Y M L I T V A K M I S L L R Q I T E V A I C * R * Q K * * Q Y Y D S Y Q K W R * V N T StyI SecI* | SetI TspGWI TspDTI \ \ \ \ GGATTACCTTGGATAATGTCTTTCAAATCCGTGTTTTCATTTTTTAGTTTATCTATAACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAATGGAACCTATTACAGAAAGTTTAGGCACAAAAGTAAAAAATCAAATAGATATTGG / / / / / SetI | TspGWI TspDTI SetI SecI* StyI G L P W I M S F K S V F S F F S L S I T D Y L G * C L S N P C F H F L V Y L * P I T L D N V F Q I R V F I F * F I Y N L ----:----|----:----|----:----|----:----|----:----|----:----| P N G Q I I D K L D T N E N K L K D I V H I V K S L T K * I R T K M K * N I * L S * R P Y H R E F G H K * K K T * R Y G FatI |MnlI |CviAII MseI || HgiCI* |HpaI || NlaIII |HindII SetI || | NlaIV MwoI TspEI |Hpy166II \ \\ \ \ \ \ \\ TCGTTTATCATGGTGCCATTTCTGCTAATTTCGTTAACAATACTTTGTAAAATAGAACTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAAATAGTACCACGGTAAAGACGATTAAAGCAATTGTTATGAAACATTTTATCTTGAT / // / / / / // | || | | MwoI | |MseI | || | HgiCI* | Hpy166II | || NlaIV | HindII | |FatI | HpaI | CviAII TspEI NlaIII MnlI S F I M V P F L L I S L T I L C K I E L R L S W C H F C * F R * Q Y F V K * N Y V Y H G A I S A N F V N N T L * N R T I ----:----|----:----|----:----|----:----|----:----|----:----| E N I M T G N R S I E N V I S Q L I S S R T * * P A M E A L K T L L V K Y F L V R K D H H W K Q * N R * C Y K T F Y F * TspEI MnlI | TaqI | MaeII | AsuII | |BtrI | | ApoI | || SetI | | TspEI BslFI | || TaiI | | | MseI MseI \ \ \\ \ \ \ \ \ \ TCCTCAAAGTGTATCACGTCCCCGTCAATTTCGAAATTTAACTGCCCTGATATTATTAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGTTTCACATAGTGCAGGGGCAGTTAAAGCTTTAAATTGACGGGACTATAATAATTG / / / // / / / / / | | | |MaeII | | | MseI MseI | | | BtrI | | TspEI | | TaiI | | ApoI | | SetI | AsuII | MnlI | TaqI BslFI TspEI S S K C I T S P S I S K F N C P D I I N P Q S V S R P R Q F R N L T A L I L L T L K V Y H V P V N F E I * L P * Y Y * L ----:----|----:----|----:----|----:----|----:----|----:----| D E F H I V D G D I E F N L Q G S I I L I R L T Y * T G T L K S I * S G Q Y * * G * L T D R G R * N R F K V A R I N N V MboII MaeI | TspEI MseI MnlI |SetI \ \ \ \ \\ TTTGTCAATTCTTCCTTAATATCCTCCAAATCAATACCTAGTGTAGATGATAAATAA 430 440 450 460 470 ----:----|----:----|----:----|----:----|----:----|----:-- AAACAGTTAAGAAGGAATTATAGGAGGTTTAGTTATGGATCACATCTACTATTTATT / / / / / / MboII TspEI MseI | SetI MaeI MnlI F V N S S L I S S K S I P S V D D K * L S I L P * Y P P N Q Y L V * M I N X C Q F F L N I L Q I N T * C R * * I X ----:----|----:----|----:----|----:----|----:----|----:-- K T L E E K I D E L D I G L T S S L Y S Q * N K R L I R W I L V * H L H Y I K D I R G * Y G G F * Y R T Y I I F L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BclI 1 FbaI,Ksp22I BslFI 1 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BstKTI 3 BtrI 1 BmgBI,AjiI BtsI 1 CviAII 3 DpnI 3 MalI FatI 3 HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4II* 1 HpyAV HindII 2 HincII HinfI 1 HpaI 2 KspAI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MnlI 5 MseI 5 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I SecI* 1 BseDI,BssECI,BsaJI SetI 6 SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TfiI 1 PfeI Tsp45I 2 NmuCI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BsmAI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtsCI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviJI CviQI CviRI* DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiJII* HhaI Hin4I Hin6I HindIII HinP1I HpaII Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TatI TauI TseI TsoI Tsp4CI* TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769